Multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) detection method of Brucella strain

Abstract

The invention relates to a multiplex fluorescent quantitative PCR (polymerase chain reaction) detection method of a Brucella strain, which belongs to the technical field of strain detection and comprises the following steps: S1, designing a plurality of pairs of specific primers and fluorescent labeled probes according to a specific gene sequence of Brucella; s2, preparing a PCR amplification reaction system, and performing fluorescent quantitative PCR amplification by taking the DNA of the sample to be detected as a template to obtain a PCR amplification product; and S3, detecting a fluorescence signal of an amplification product, specifically detecting A19, S2 and M5, and non-specifically detecting all Brucella of the Brucella genus. According to the detection method provided by the invention, high sensitivity of a PCR technology and accuracy of a fluorescent quantitative technology are combined, and rapid and accurate identification of Brucella vaccine strains A19, S2 and M5 and other Brucella strains can be realized.

Description

Technical Field

[0001] The present application relates to the technical field of strain detection, and more specifically, to a multiplex fluorescence quantitative PCR detection method for Brucella strains. Background Art

[0002] Brucellosis, as a highly contagious disease, has long caused huge economic losses to the global livestock industry and seriously threatened human health and safety. The prevention and control of this disease is particularly important, and vaccination, as a key means of preventing brucellosis, has been widely used in many countries and regions. However, in the context of widespread vaccination, how to effectively distinguish between wild strains and vaccine strains has become an important prerequisite for evaluating the protective effect of vaccines, monitoring the development trend of the epidemic, and formulating targeted prevention and control strategies.

[0003] Traditionally, methods for distinguishing wild strains from vaccine strains mainly include biochemical tests, serological tests, etc. Although these methods can provide a basis for identification to a certain extent, they have many limitations. For example, the biochemical test operation process is cumbersome, requires professional personnel to perform, and is time-consuming, making it difficult to meet the needs of rapid identification. Although serological testing has a certain specificity, it is easily affected by multiple factors such as antibody levels and detection time windows, resulting in insufficient sensitivity, and may result in false negative or false positive results, thereby affecting the accuracy of identification.

[0004] In view of the various shortcomings of traditional identification methods, it is particularly important to develop a new, efficient and accurate method for identifying wild strains and vaccine strains of Brucella. The new identification method should be able to overcome the limitations of traditional methods, achieve rapid and accurate identification, and provide strong support for the prevention and control of brucellosis. At the same time, the method should also be easy to operate and easy to promote to meet the detection needs of different regions and levels.

[0005] Based on the above statements, the present application provides a multiplex fluorescence quantitative PCR detection method for Brucella strains. Summary of the invention

[0006] In order to solve the problem raised in the background technology, the application provides a kind of multiple fluorescence quantitative PCR detection method of Brucella strain.This method combines the high sensitivity of PCR technology and the accuracy of fluorescence quantitative technology, can realize the fast and accurate identification of Brucella vaccine A19, S2, M5 strains and other Brucella strains.

[0007] The present application provides a multiplex fluorescence quantitative PCR detection method for Brucella strains, which adopts the following technical scheme:

[0008] A multiplex fluorescence quantitative PCR detection method for Brucella strains comprises the following steps:

[0009] S1. Design multiple pairs of specific primers and fluorescent labeled probes based on the specific gene sequences of Brucella;

[0010] S2, preparing a PCR amplification reaction system, and using the DNA of the sample to be tested as a template, performing fluorescent quantitative PCR amplification to obtain a PCR amplification product;

[0011] S3, detect the fluorescent signal of the amplified product, specifically detect A19, S2, M5 and non-specifically detect all Brucella species of the genus Brucella.

[0012] Further, in step S1, the multiple pairs of specific primers and fluorescent labeled probe sequences include reagent group L23, reagent group L21, reagent group L22 and reagent group L24;

[0013] Wherein, the reagent set L23 includes a primer sequence L23-F as shown in SEQ ID NO: 1, a primer sequence L23-R as shown in SEQ ID NO: 2, and a probe sequence L23-Probe as shown in SEQ ID NO: 3;

[0014] Reagent set L21 includes a primer sequence L21-F as shown in SEQ ID NO:4, a primer sequence L21-R as shown in SEQ ID NO:5, and a probe sequence L21-Probe as shown in SEQ ID NO:6;

[0015] Reagent set L22 includes a primer sequence L22-F as shown in SEQ ID NO:7, a primer sequence L22-R as shown in SEQ ID NO:8, and a probe sequence L22-Probe as shown in SEQ ID NO:9;

[0016] The reagent set L24 includes a primer sequence L24-F as shown in SEQ ID NO:10, a primer sequence L24-R as shown in SEQ ID NO:11, and a probe sequence L24-Probe as shown in SEQ ID NO:12.

[0017] The specific primers and fluorescent probe sequences are shown in Table 1 below:

[0018] Table 1

[0019] name Serial Number sequence L23-F SEQ ID NO:1 GGCGAGAGGCTGAAAGATGGT L23-R SEQ ID NO:2 AAGGGTCGGTGTTTCCGCCAC L23-Probe SEQ ID NO:3 CTGGACGCCTATTTCTTTGTG L21-F SEQ ID NO:4 GGCTGGCCGGTSTGG L21-R SEQ ID NO:5 AGTCAAAGCCCGTATTGCCA L21-Probe SEQ ID NO:6 CTCATCACCTGCGCGC L22-F SEQ ID NO:7 CGATAGCGATCGTCAGTTTCC L22-R SEQ ID NO:8 CGTCTCCTCCTTATTAGCGGAC L22-Probe SEQ ID NO:9 TGTTCGTAGCCGACC L24-F SEQ ID NO:10 GCCAGAAGGCGCAAATCTTC L24-R SEQ ID NO:11 GCTCTGGAGTCCGGCTTTAC L24-Probe SEQ ID NO:12 GCCGGTGCCGTTATAGGCCC

[0020] Furthermore, the concentrations of the multiple pairs of specific primers and fluorescently labeled probe sequences are all 0.1-0.25 μmol / L.

[0021] Furthermore, in step S2, the PCR amplification reaction system includes the following components:

[0022] 10× amplification buffer, specific primers and fluorescently labeled probes, DNA polymerase, MgCl2, dNTPs, nuclease-free water, and template DNA.

[0023] Furthermore, in step S2, the specific procedure of fluorescence quantitative PCR amplification is:

[0024] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 15 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 30 cycles; final extension at 72°C for 1 min.

[0025] In summary, this application has the following beneficial effects:

[0026] 1. In the technical solution of the present invention, this method realizes the high-sensitivity detection of Brucella vaccine A19, S2, M5 strains and other Brucella strains by optimizing the design of primers and probes, and carefully regulating the PCR reaction conditions. Even if the concentration of Brucella in the sample is extremely low, the method can accurately identify and effectively avoid the situation of missed detection. At the same time, the adoption of specific primers and probes greatly improves the specificity of detection, ensures the accuracy of the test results, and avoids the risk of misjudgment caused by nonspecific amplification and false positive results. This improvement not only enhances the credibility of detection, but also provides strong support for the early detection and accurate diagnosis of brucellosis.

[0027] 2. In the technical solution of the present invention, this method also uses multiplex fluorescence quantitative PCR technology, which can complete the detection of a large number of samples in a short time, significantly improving the detection efficiency. This is of great significance for large-scale screening and rapid response to the epidemic, and helps to timely grasp the dynamics of the epidemic and take effective prevention and control measures. At the same time, the method is easy to operate and does not require complex equipment and technical support, so that grassroots laboratories can easily carry out detection work. This feature not only lowers the detection threshold, but also increases the popularity and coverage of detection work, providing more convenience for the extensive monitoring and prevention and control of brucellosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0029] Figure 1 This is a sensitivity experiment result diagram in Example 2 of the present invention.

[0030] Figure 2 This is a diagram of the specificity experiment results in Example 2 of the present invention. DETAILED DESCRIPTION

[0031] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Example 1

[0033] The present application provides a multiplex fluorescence quantitative PCR detection method for Brucella strains, comprising the following steps:

[0034] S1. Design specific primers and fluorescent labeled probes according to the specific gene sequence of Brucella;

[0035] Wherein, the multiple pairs of specific primers and fluorescent labeling probe sequences include reagent group L23, reagent group L21, reagent group L22 and reagent group L24;

[0036] Reagent set L23 includes a primer sequence L23-F as shown in SEQ ID NO: 1, a primer sequence L23-R as shown in SEQ ID NO: 2, and a probe sequence L23-Probe as shown in SEQ ID NO: 3;

[0037] Reagent set L21 includes a primer sequence L21-F as shown in SEQ ID NO:4, a primer sequence L21-R as shown in SEQ ID NO:5, and a probe sequence L21-Probe as shown in SEQ ID NO:6;

[0038] Reagent set L22 includes a primer sequence L22-F as shown in SEQ ID NO:7, a primer sequence L22-R as shown in SEQ ID NO:8, and a probe sequence L22-Probe as shown in SEQ ID NO:9;

[0039] Reagent set L24 includes a primer sequence L24-F as shown in SEQ ID NO: 10, a primer sequence L24-R as shown in SEQ ID NO: 11, and a probe sequence L24-Probe as shown in SEQ ID NO: 12;

[0040] The concentration of each sequence was 0.1-0.25 μmol / L.

[0041] S2, preparing a PCR amplification reaction system, and using the DNA of the sample to be tested as a template, performing fluorescent quantitative PCR amplification to obtain a PCR amplification product;

[0042] The specific procedure of fluorescence quantitative PCR amplification is as follows:

[0043] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 15 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 30 cycles; final extension at 72°C for 1 min;

[0044] The specific components of the PCR amplification reaction system are shown in Table 2 below:

[0045] Table 2

[0046] Serial number Components Dosage / μL 1 10× Amplification Buffer 2.5 2 <![CDATA[100mM MgCl2]]> 2.5 3 10mM dNTP 4 4 L23-F 0.5 5 L23-R 0.5 6 L23-Probe 0.5 7 L21-F 0.5 8 L21-R 0.5 9 L21-Probe 0.5 10 L22-F 0.5 11 L22-R 0.5 12 L22-Probe 0.5 13 L24-F 0.5 14 L24-R 0.5 15 L24-Probe 0.5 16 <![CDATA[10 3 Copy / μl template]]> 6 17 Nuclease-free water 5.5

[0047] S3, detect the fluorescent signal of the amplified product, specifically detect A19, S2, M5 and non-specifically detect all Brucella species of the genus Brucella.

[0048] Example 2

[0049] The difference between this embodiment and embodiment 1 is that in this embodiment, the concentrations of the multiple pairs of specific primers and the fluorescent labeled probe sequences are all 0.2 μmol / L.

[0050] Example 3

[0051] The difference between this embodiment and embodiment 1 is that in this embodiment, the concentrations of the multiple pairs of specific primers and the fluorescent labeled probe sequences are all 0.25 μmol / L.

[0052] Performance Testing

[0053] Now, the sensitivity experiment and specificity experiment are carried out on the multiplex fluorescence quantitative PCR detection method of Brucella strains in Example 2 of the technical solution of the present invention.

[0054] Sensitivity test:

[0055] Brucella DNA samples of a series of concentrations were prepared from high concentration to low concentration. According to the detection steps and reaction conditions in Example 2, multiple fluorescence quantitative PCR reactions were performed on the Brucella DNA samples of each concentration. When the Ct value was ≤36 and a specific amplification curve appeared, it was positive; when the Ct value was 38≥36 and a specific amplification curve appeared, it was necessary to resample and extract DNA, and the result was determined after amplification. If a specific amplification curve still appeared, it could be determined as positive; for some samples with a Ct value >38 that did not show a specific amplification curve but had a high background, it should be determined as negative. The sensitivity of the detection method was determined by the minimum detection threshold.

[0056] The results of sensitivity experiments are as follows Figure 1 shown.

[0057] From the results of the sensitivity test, the nucleic acid was detected at 328ng / µL. After continuous dilution and the final dilution of 10,000 times, it could not be amplified, and the lowest sensitivity was 32.8fg.

[0058] Specificity experiments:

[0059] Brucella A19, S2, M5 and Yersinia colitis O:9, Tularensis, Escherichia coli 0:116 nucleic acids were tested. The changes in the fluorescence signal of each sample were observed and recorded to determine the specificity of the detection method.

[0060] Specificity test results such as Figure 2 shown.

[0061] From the specific experimental results, it can be seen that the brucellosis vaccine strains A19, S2, and M5 can all be amplified, and the Brucella primer 31kd can also be amplified, while other bacteria were not amplified.

[0062] In the description of the specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0063] The above contents are merely examples and explanations of the present invention. Those skilled in the art may make various modifications or additions to the specific embodiments described or replace them in a similar manner. As long as they do not deviate from the invention or exceed the scope defined by the claims, they shall all fall within the protection scope of the present invention.

Claims

1. A multiplex fluorescence quantitative PCR detection method for Brucella strains, characterized in that, The following steps are involved: S1. Design multiple pairs of specific primers and fluorescent labeled probes based on the specific gene sequences of Brucella; S2, preparing a PCR amplification reaction system, and using the DNA of the sample to be tested as a template, performing fluorescent quantitative PCR amplification to obtain a PCR amplification product; S3, detect the fluorescent signal of the amplified product, specifically detect A19, S2, M5 and non-specifically detect all Brucella species of the genus Brucella.

2. The multiplex fluorescence quantitative PCR detection method for a Brucella strain according to claim 1, characterized in that, In step S1, the multiple pairs of specific primers and fluorescent labeled probes include the following sequences: reagent group L23, reagent group L21, reagent group L22 and reagent group L24; Wherein, the reagent set L23 includes a primer sequence L23-F as shown in SEQ ID NO: 1, a primer sequence L23-R as shown in SEQ ID NO: 2, and a probe sequence L23-Probe as shown in SEQ ID NO: 3; Reagent set L21 includes a primer sequence L21-F as shown in SEQ ID NO:4, a primer sequence L21-R as shown in SEQ ID NO:5, and a probe sequence L21-Probe as shown in SEQ ID NO:6; Reagent set L22 includes a primer sequence L22-F as shown in SEQ ID NO:7, a primer sequence L22-R as shown in SEQ ID NO:8, and a probe sequence L22-Probe as shown in SEQ ID NO:9; The reagent set L24 includes a primer sequence L24-F as shown in SEQ ID NO:10, a primer sequence L24-R as shown in SEQ ID NO:11, and a probe sequence L24-Probe as shown in SEQ ID NO:

12.

3. The multiplex fluorescence quantitative PCR detection method for a Brucella strain according to claim 2, characterized in that, The sequence concentrations of the multiple pairs of specific primers and fluorescent labeling probes are all 0.1-0.25 μmol / L.

4. The multiplex fluorescence quantitative PCR detection method for a Brucella strain according to claim 1, characterized in that, In step S2, the PCR amplification reaction system includes the following components: 10× amplification buffer, specific primers and fluorescently labeled probes, DNA polymerase, MgCl2, dNTPs, nuclease-free water, and template DNA.

5. The multiplex fluorescence quantitative PCR detection method for a Brucella strain according to claim 1, characterized in that, The specific procedure of fluorescence quantitative PCR amplification is as follows: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 15 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 30 cycles; final extension at 72°C for 1 min.

Images