LAMP (Loop-Mediated Isothermal Amplification) and CRISPR / BrCas12b mediated one-pot nucleic acid molecule detection method for detecting staphylococcus aureus

Abstract

The invention belongs to the field of biology, relates to staphylococcus aureus gene detection, and discloses a one-pot nucleic acid molecule detection method combining loop-mediated isothermal amplification (LAMP) and CRISPR / BrCas12b mediation, which is suitable for rapid detection of staphylococcus aureus. The method comprises the following steps: designing an LAMP primer, a small guide RNA (Ribonucleic Acid) and a transcription template overlapping PCR (Polymerase Chain Reaction) primer, combining LAMP with a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas shearing recognition (Cas-LAMP) technology, constructing a single-tube one-pot method detection reaction, detecting the specificity and sensitivity of Cas-LAMP amplification and the like. The invention provides a Cas-LAMP (loop-mediated isothermal amplification) technology capable of simultaneously joining two-step reaction of amplification and shearing recognition, aiming at the problem that amplification and shearing recognition are difficult to be synchronously carried out in the same reaction system. The technology is carried out in an in-vitro single reaction tube system, and nucleic acid molecules can be accurately, sensitively and rapidly detected. Compared with a traditional nucleic acid molecule detection method, the method has the remarkable advantages that a one-pot method is adopted for direct detection, step-by-step operation is not needed, higher sensitivity and specificity are achieved, and rapid on-site detection can be achieved. The method not only provides technical support for conventional nucleic acid detection, but also has a wide field instant detection application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and relates to a highly sensitive nucleic acid molecule detection method for detecting Staphylococcus aureus in the field of foodborne pathogen detection, and in particular to a loop-mediated isothermal amplification and CRISPR / BrCas12b-mediated one-pot highly sensitive detection method for detecting Staphylococcus aureus and its related primer probes and small guide RNA (sgRNA) sequences. Background Art

[0002] Staphylococcus aureus, also known as "golden Staphylococcus", is a common Gram-positive coccus that is widely found on human skin, upper respiratory tract and in animals. As an important pathogen, Staphylococcus aureus can cause a variety of infections, including skin and soft tissue infections, pneumonia, sepsis, endocarditis and food poisoning. In particular, the Staphylococcus aureus enterotoxin it produces is one of the main causes of food poisoning. In addition, Staphylococcus aureus has also attracted much attention because it can produce methicillin-resistant Staphylococcus aureus (MRSA). MRSA infections usually have high drug resistance and strong transmissibility, and are one of the main pathogens of hospital-acquired infections. The pathogenic mechanism of Staphylococcus aureus mainly includes the production of a variety of toxins, enzymes and cell surface proteins, which can promote bacterial adhesion, invasion, toxin release and escape from the host immune response. Infection with this bacterium can be transmitted through direct contact, airborne transmission, or fomite transmission, and it has strong tolerance and can survive for a long time under adverse environmental conditions.

[0003] In recent years, the infection rate of Staphylococcus aureus has continued to rise worldwide, becoming an important challenge in the field of public health. Due to its increasing drug resistance, treatment has become more difficult, so early, rapid and accurate detection is essential to control Staphylococcus aureus infection. Traditional methods for detecting Staphylococcus aureus, including bacterial culture and drug sensitivity testing, have high accuracy, but are cumbersome and time-consuming, and are not suitable for emergency and on-site rapid detection. Immunological methods have the problems of difficult availability of antibodies and high cost, making them difficult to promote and apply in production. With the continuous development of molecular biology technology, molecular detection methods such as PCR technology and real-time fluorescence quantitative PCR have been widely used in the detection of Staphylococcus aureus, greatly improving the detection speed and sensitivity. However, these methods usually require expensive equipment and complex operations. In recent years, isothermal amplification technology, such as loop-mediated isothermal amplification (LAMP) and other nucleic acid detection methods have shown great application potential in the detection of Staphylococcus aureus. Its simplicity, rapidity and low cost provide new solutions for the rapid on-site detection of the bacteria.

[0004] Prokaryotes such as bacteria and archaea use their internal clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas) to build their own adaptive immune systems. That is, CRISPR and Cas proteins together constitute the CRISPR-Cas system, which synergistically protect prokaryotes from the invasion of foreign genetic material. Initially, the CRISPR-Cas system was widely studied and applied in the field of synthetic biology as a gene editing tool. According to the biological functions and characteristics of different Cas proteins, researchers have developed a large number of new gene editing elements and tools. In 2015, Zhang Feng's team reported that CRISPR-Cas12a has nuclease activity and proposed that it will play an important role in gene editing and biotechnology. The powerful gene editing ability of the CRISPR-Cas system mainly comes from the specific or nonspecific cutting activity of Cas proteins. This characteristic has stimulated the interest of researchers in using the system to develop new detection tools. In 2016, Abudayyeh et al. found that Cas12 has "bypass cleavage" activity, that is, Cas12 protein can not only specifically cleave the target sequence, but also non-specifically cleave the single-stranded fluorescent reporter probe after recognizing and binding to the target sequence, releasing fluorescent signals, thereby realizing the detection of nucleic acids. This discovery has opened up a new research direction for nucleic acid detection technology based on CRISPR-Cas. Since then, the CRISPR-Cas system has been applied to nucleic acid detection for the first time, and in subsequent research and development, it has demonstrated efficient and accurate pathogen nucleic acid detection performance. Among the second class of Cas effector proteins, Cas9 is widely used due to its excellent performance in genome modification, editing and regulation; while Cas12 has higher specificity and can be used in combination with nucleic acid amplification methods, or as a separate signal amplification method, showing great application potential in nucleic acid detection and disease monitoring. Today, the CRISPR-Cas system, as a powerful detection and diagnostic tool, has been widely used in nucleic acid detection, molecular imaging and other fields. By utilizing the various characteristics of the CRISPR-Cas system, specific and low-cost detection of different targets can be achieved, thereby promoting the development of disease diagnosis technology. However, since the optimal enzyme activity temperature of most Cas12s does not match the optimal reaction temperature of Bst DNA polymerase in the LAMP reaction, it is difficult to carry out amplification and cleavage reactions simultaneously in the same reaction system. If the reaction is divided into two steps, it not only increases the complexity of the operation steps, but also may cause aerosol contamination due to the second opening of the lid, thereby increasing the difficulty of successful diagnosis. Summary of the invention

[0005] The present invention aims to solve the compatibility problem of LAMP and Cas shearing system, and provides a one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / Cas for rapid, highly sensitive and highly specific detection of Staphylococcus aureus, and includes relevant primer probes and small guide RNA (sgRNA) sequences. The method relates to DNA amplification and CRISPR / Cas12b shearing signal amplification detection, specifically through the effect of Bst DNA polymerase, under the combination and amplification of 4-6 specific primers, the target DNA is accurately amplified; Meanwhile, BrCas12b, sgRNA and amplified product form a ternary complex, activate the "bypass cutting" activity of BrCas12b, cut the single-stranded fluorescent reporter probe, release the fluorescent signal, so as to achieve the synchronization of amplification and detection. Meanwhile, the present invention cleverly modifies the prototype spacer adjacent motif (PAM, protospacer adjacent motif) in the double-stranded DNA product by primer design, effectively avoiding the sgRNA design dependence on the target sequence PAM site. By optimizing the reaction system and conditions, the present invention realizes the idea of ​​simultaneous amplification and shearing reactions in the same reaction system, thereby completing the detection of Staphylococcus aureus samples in a single system. This method not only has the advantages of high sensitivity, strong specificity, and rapid detection, but also shows a high degree of adaptability to other single-stranded or double-stranded DNA targets, and has broad application prospects.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] <First aspect>

[0008] The present invention provides a Cas-LAMP one-pot nucleic acid molecule detection method for Staphylococcus aureus, the method comprising the following steps:

[0009] S1. Extracting nucleic acid samples from samples to be tested;

[0010] S2. Design synthetic primers and probes; design 4 specific oligonucleotide LAMP primers according to the nuc gene sequence of Staphylococcus aureus: upstream internal primer FIP, downstream internal primer BIP, upstream external primer F3 and downstream external primer R3; random TA-rich single-stranded DNA reverse cleavage probe; LAMP product targeting specific small guide RNA (sgRNA) sequence and its transcription template overlapping PCR synthetic primers, the base sequence is as SEQ ID No: 1-12;

[0011]

[0012]

[0013] S3. Prepare a reaction mixture system, wherein the mixture system includes: a single-stranded DNA reverse-cleavage probe, four oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or a derivative thereof, a CRISPR-associated Cas protein or a variant thereof, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or a variant thereof; wherein the small guide RNA or a derivative thereof contains a sequence complementary to the oligonucleotide LAMP primer nuc-FIP-2; and the oligonucleotide LAMP primer nuc-FIP-2 sequence is complementary to a partial sequence of one chain of the target molecule and a partial sequence of the small guide RNA or a derivative thereof, and also introduces a PAM site sequence;

[0014] S4, adding the nucleic acid sample extracted in step 1 to the reaction system of step 3, and performing a constant temperature reaction. Under the action of Bst DNA polymerase, four specific primers bind to and amplify the nucleic acid target. At the same time, BrCas12b, sgRNA and the amplified product form a ternary complex; activating the "bypass cleavage" activity of BrCas12b, cutting the single-stranded DNA trans-cutting fluorescent reporter probe, and releasing a fluorescent signal;

[0015] S5. Use a fluorescence detector to collect, read and record the fluorescence signal generated by the Cas-LAMP one-pot reaction, and use the fluorescence signal to determine the presence or absence of the target nucleic acid molecule in the sample to be tested. The reaction result is presented in real time in the form of a fluorescence curve. The temperature of the Cas-LAMP one-pot reaction is 63°C and the reaction time is 20 minutes.

[0016] The technical principles of the present invention are as follows:

[0017] The target gene amplification of the LAMP reaction is divided into two stages: the initial stage and the cycle stage. The initial stage starts from the forward inner primer FIP. The inner primer nuc-FIP-2 consists of two regions, F2 and F1c. In order to make the CRISPR-BrCas12b system independent of the target PAM site, we added TTT-PAM sites to the linker between F2 and F1c to modify FIP, introduce the PAM site into the LAMP product, and cleverly avoid the dependence of BrCas12b on the target sequence PAM site sequence; the F2 region is complementary to F2c on the nuc gene, and the primer is extended using Bst chain displacement DNA polymerase to start the DNA chain displacement reaction. At the same time, the outer primer nuc-F3-2 is complementary to the target F3c region. Under the action of the Bst enzyme, the synthesized DNA chain is displaced after extension; the displaced single-stranded 5' end contains F1c and F1 regions, and the bases in these two regions can amplify the target fragment to form a ring structure. Similarly, another inner primer nuc-BIP-2 is composed of B2 and B1c, the B2 region is complementary to B2c on the nuc gene sequence, the outer primer nuc-F3-2 is complementary to F3c on the nuc gene sequence, and the outer primer nuc-R3 is complementary to B3c on the nuc gene sequence. The nuc gene primer set has a total of 4 primers. Under the action of Bst DNA enzyme, the extension of the new DNA chain begins, and the displaced single-stranded BIP including B1c and B1 regions will also form a ring structure. Finally, through the action of extension and chain displacement, dumbbell-shaped structures are formed at both ends of the target sequence, which is the starting structure of the LAMP amplification cycle. In the cycle stage, starting from the F1 loop at the 3' end, the F2 end and the circular F2c region are synthesized and extended, and then the initial single strand of F1 is displaced by chain displacement to form a circular structure; similarly, starting from the B1 end, the primer B2 end and the B2c end region are synthesized and extended, and the single strand of B1 end is displaced by the Bst enzyme to finally form a circular structure. After cyclic amplification, the final product is a mixture of circular structure and polycyclic cauliflower-like structure DNA.

[0018] At the same time, nuc-sgRNA is specially designed to target LAMP products with a given PAM site. BrCas12b forms a ternary complex of BrCas12b-sgRNA-dsDNA with the target DNA under the guidance of sgRNA, activating the trans-cleavage activity of BrCas12b, resulting in the shearing of the single-stranded DNA trans-cleavage fluorescent reporter probe. The shearing of LAMP and BrCas12b is achieved simultaneously in the same system. When there is no target, BrCas12b does not work, and the FAM fluorescent group attached to the fluorescent probe is quenched by BHQ1, and no fluorescent signal is generated. When the target is present, LAMP amplifies, and at the same time sgRNA recognizes the target sequence to form a ternary complex of BrCas12b-sgRNA-dsDNA, and then the fluorescent probe is sheared, the fluorescent group is separated from the quenching group, and fluorescence is released.

[0019] The fluorescence signal generated by the Cas-LAMP one-pot reaction can be collected, read, recorded and analyzed by a fluorescence detector to determine the presence or absence of target nucleic acid molecules in the sample to be tested.

[0020] The Cas-LAMP one-pot reaction is a DNA nucleic acid detection platform, which is highly adaptable to the detection of different single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) targets. The detection system proposed by the present invention is simple to operate, can simultaneously amplify and detect targets in a single reaction tube, reduce the contamination risk of open tube reactions, has low requirements for temperature control, can reduce laboratory equipment requirements, shorten detection time, has a high degree of automation, has high sensitivity, strong specificity, and is suitable for simple and rapid nucleic acid detection.

[0021] The CRISPR-associated Cas protein or its variant is a nuclease with single-stranded or double-stranded DNA recognition and cleavage functions and single-stranded DNA cleavage functions. It is a CRISPR-Cas protease that can tolerate a reaction temperature above 55°C and can specifically recognize target DNA under the guidance of sgRNA, and has cis- and trans-cleavage activity, including but not limited to any one or any variant of AapCas12b, BrCas12b, and AacCas12b proteins. The enzyme may include a mixture of wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or more than one Cas protein. The CRISPR-Cas protease is preferably BrCas12b. The CRISPR-Cas nuclease combined with sgRNA can be specifically activated by the target nucleic acid sequence to have non-specific DNA nuclease activity, thereby achieving the cleavage of the DNA fluorescent probe.

[0022] The Bst chain displacement DNA polymerase is a DNA polymerase with chain displacement effect, which can displace the downstream DNA chain without template denaturation. The DNA polymerase or its variant can be any one or any variant of Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Warmstar Bst 2.0 DNA polymerase, Bst LF DNA polymerase, OmniAmp DNA polymerase, etc. The enzyme can include a mixture of wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or more than one chain displacement DNA polymerase. The Bst chain displacement DNA polymerase is preferably Bst 3.0 DNA polymerase. The DNA polymerase has 5'-3' DNA polymerase activity and chain displacement activity, which can automatically dissociate from the hydrogen bond of the template double-stranded DNA and then synthesize a new DNA chain. Due to its characteristics, the Bst enzyme can synthesize DNA at a constant temperature without the double-strand dissociation of DNA, and the synthesis is not affected by the secondary structure of DNA.

[0023] The single-stranded DNA trans-cleavage probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group including but not limited to FAM, HEX, VIC, CY5, CY3, ROX, TAMRA, TET, FITC, and JOE, and the 3' end is labeled with a quenching group including but not limited to TAMRA, BHQ1, MGB, BHQ2, etc. that can be combined with any fluorescent group at the 5' end.

[0024] The random TA-rich single-stranded DNA sequence may be TTATTATT or TTTTT or TTTTTTTT or other TA-rich single-stranded DNA sequences, and the preferred sequence is TTATTATT; the sequence can be recognized and cut by the CRISPR-Cas protein.

[0025] The spacer sequence of the small guide RNA (sgRNA) or its derivative is complementary to the LAMP product nucleic acid molecule sequence.

[0026] The main components of the Cas-LAMP one-pot reaction buffer include dNTPs, Tris-HCl, MgSO4, KCl, ATP, DTT, (NH4)2SO4, Triton X-100 and mannitol. The preferred reaction buffer includes: 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH value between 6.5-8.0.

[0027] In the above technical solution of the present invention, the nucleic acid sample of Staphylococcus aureus to be detected can be extracted from food, clinical samples, etc. by magnetic bead method or column method to obtain nucleic acid.

[0028] The temperature of the isothermal reaction is 61°C-68°C, preferably 63°C, and the isothermal reaction time is 10-80min, preferably 20min; during the isothermal reaction, under the action of the Bst enzyme, the inner primer and the outer primer perform LAMP amplification on the target gene fragment to produce DNA fragments of different lengths, thereby achieving target enrichment. At the same time, the CRISPR-BrCas12b system starts working, and the sgRNA targets the LAMP product with a given PAM site. Under the guidance of the sgRNA, a ternary complex of BrCas12b-sgRNA-dsDNA is formed, which activates the trans-cleavage activity of BrCas12b, resulting in the shearing of the single-stranded DNA probe, thereby generating a detectable fluorescent signal.

[0029] <Second Aspect>

[0030] Furthermore, the present invention also provides a reaction system for Staphylococcus aureus nucleic acid detection, including a single-stranded DNA trans-cleavage fluorescent reporter probe, four oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants.

[0031] A kit including the reaction system also belongs to the protection scope of the present invention, and can realize accurate, rapid and highly sensitive detection of Staphylococcus aureus DNA molecules under isothermal conditions.

[0032] The present invention can quickly complete the detection of Staphylococcus aureus nucleic acid molecules under isothermal conditions. First, the nucleic acid of the sample to be detected is obtained by rapid nucleic acid extraction; then, the chain displacement DNA polymerase, the combined enzyme of CRISPR-related proteins, sgRNA, single-stranded DNA fluorescent probe and oligonucleotide primers are used to react with the nucleic acid to be detected under isothermal conditions; finally, by detecting the fluorescent signal, it is determined whether the target nucleic acid molecule exists in the sample to be detected.

[0033] The CRISPR-associated Cas protein or its variant and sgRNA form a binary complex, which specifically binds to the amplified product to form a ternary complex, thereby activating nonspecific trans-cleavage activity and ultra-sensitively cutting single-stranded DNA molecules in the reaction system; the CRISPR-associated Cas protein or its variant may include wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or a mixture of more than one Cas protein.

[0034] Preferably, the kit comprises an enzyme mixture, a single-stranded DNA probe, a small guide RNA, a fluorescently labeled single-stranded DNA probe, an oligonucleotide primer and a Cas-LAMP reaction buffer; the enzyme mixture comprises CRISPR-Cas nuclease and a strand-displacing DNA polymerase.

[0035] Furthermore, the CRISPR-Cas nuclease is preferably BrCas12b. In the oligonucleotide primer, in order to achieve the independence of the CRISPR / BrCas12b system on the target PAM site, we added a TTT-PAM site to the connecting region between F2 and F1c to modify the primer FIP; the strand displacement DNA polymerase is Bst DNA polymerase; the DNA fluorescent probe is a single-stranded DNA with a fluorescent group labeled at the 5' end and a fluorescent quenching group labeled at the 3' end.

[0036] In a specific embodiment, the buffer includes 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH between 6.5-8.0. Primer FIP / BIP 10μM-100μM, primer F3 / R3 2.5μM-25μM, primer LF / LB 0μM-50μM; FAM-labeled fluorescent probe 3μM-12μM; small guide RNA 20 nM-100nM, enzyme mixture (Bst DNA polymerase, 8U-32U; Cas12b protein, 75nM-300nM).

[0037] In the kit of the present invention, the target DNA, the small guide RNA and the Cas12b protein form a complex, which can cut other single-stranded DNA molecules in the system.

[0038] The present invention also provides a reaction system, which includes: a single-stranded DNA probe, an oligonucleotide primer, a strand-displacing DNA polymerase and its variants, a small guide RNA (sgRNA) or its derivatives, a CRISPR-associated (Cas) protein or its variants, and a Cas-LAMP reaction buffer.

[0039] The present invention can quickly complete the detection of Staphylococcus aureus DNA molecules under isothermal conditions. First, the DNA of the sample to be detected is obtained by nucleic acid extraction; then, the amplification enzyme, the combined enzyme of CRISPR-related proteins, and the single-stranded DNA probe are used to react with the nucleic acid to be detected under isothermal conditions. Finally, by detecting the fluorescent signal, it is determined whether the target nucleic acid exists in the sample to be detected.

[0040] The detection method and kit of the present invention is a rapid detection platform, which can quickly complete the detection of Staphylococcus aureus nucleic acid molecules.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] (1) High sensitivity: The present invention can detect nucleic acid molecules at the single copy level;

[0043] (2) Rapid: The present invention can complete the detection in as little as 20 minutes;

[0044] (3) Convenience: The present invention realizes isothermal reaction in a single tube with a single buffer solution, which is easy to operate and has simple steps;

[0045] (4) Low false positives: Although the reaction system of the present invention includes an amplification step, based on the specific recognition of the pre-amplification primer and the highly targeted specific recognition of the pre-amplification product by sgRNA, such a bispecific recognition system overcomes the problem of easy contamination of traditional molecular detection methods. At the same time, this method is a closed-tube reaction, which avoids the risk of aerosol contamination caused by secondary opening of the lid, and is physically isolated, which minimizes the possibility of contamination;

[0046] (5) Isothermal detection: Two engineered enzymes and chemical components together create an environment that simulates nucleic acid amplification in vivo to the greatest extent possible, and each engineered enzyme performs its own function and works at its optimal reaction temperature, so the working efficiency is the highest;

[0047] (6) One-step method: Two reaction-compatible buffers were constructed, and the target amplification and Cas12b cleavage detection reactions were placed in the same reaction tube. The sample detection was completed by a one-time addition, achieving a one-step method. Therefore, the operation is simpler, and the reaction efficiency is further improved and the reaction time is shortened. It is more suitable for rapid on-site detection, especially in areas with limited resources;

[0048] (7) Universality: The present invention can be used to detect any DNA target and distinguish point mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0050] Figure 1 It is a schematic diagram of the process of detecting samples of the present invention;

[0051] Figure 2 is the detection sensitivity of the Staphylococcus aureus samples in this method;

[0052] Figure 3 for the detection specificity of Staphylococcus aureus samples in this method;

[0053] Figure 4 This is a stability comparison chart of the one-pot method with different additives;

[0054] Figure 5 Batch sample testing of Staphylococcus aureus samples in this method. DETAILED DESCRIPTION

[0055] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0056] The present invention is a one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / BrCas12b for detecting Staphylococcus aureus, and the process is as follows: Figure 1 shown.

[0057] The sequences of primers, probes, etc. used in the examples are listed as follows:

[0058]

[0059] Example 1: A method for detecting Staphylococcus aureus

[0060] Staphylococcus aureus dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0061] AGCGATTGATGGTGATACGGTTAAATTAATGTACAAAGGTCAACCAATGACATTTAGACTATTATTGGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACGTGGGCTTAGCGTATATTTATGC

[0062] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0063] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0064] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0065] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0066] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0067] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0068] The forward primer Br-Gene-nuc2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0069] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACGTTTCAGGTGTAT CAACCAA;

[0070] The reverse complementary long primer Br-Gene-nuc2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: TTGGTTGATACACCTGAAACGTGCT;

[0071] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0072] The LAMP reaction primer sequence of Target, nuc-F3-2, is shown in SEQ ID NO.7, which is: CGATTGATGGTGATACGGTTA;

[0073] The LAMP reaction primer sequence of Target, nuc-R3-2, is shown in SEQ ID NO.8, which is: CAGTTCTTTGACCTTTGTCA;

[0074] The LAMP reaction primer sequence of Target, nuc-FIP-2, is shown in SEQ ID NO.9, which is: GCTTTGTTTCAGGTGTATCAACCAATTTATTAATGTACAAAGGTCAACCA ATG;

[0075] The LAMP reaction primer sequence of Target, nuc-BIP-2, is shown in SEQ ID NO. 10, which is: AAGGTGTAGAGAAATATGGTCCTGATCGACTTCAATTTTCTTTGCA;

[0076] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA is extracted from the Staphylococcus aureus sample to be tested, and the concentration is gradually diluted from 10 6 copies / μL-10 -2 copies / μL; the reaction system was added separately, the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mM ATP, 10mM DTT, 20mM (NH4)2SO4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0077] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.11: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 20 minutes.

[0078] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 20 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute and the detection time is 20 minutes.

[0079] Results: Figure 2 As shown, this method can be used to detect double-stranded DNA of Staphylococcus aureus, and this method can be used to detect double-stranded DNA of Staphylococcus aureus as low as 1 copy / μL within 20 minutes.

[0080] Example 2: Characterization of detection specificity using this method

[0081] Staphylococcus aureus dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0082] AGCGATTGATGGTGATACGGTTAAATTAATGTACAAAGGTCAACCAATGACATTTAGACTATTATTGGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACGTGGGCTTAGCGTATATTTATGC

[0083] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0084] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0085] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0086] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0087] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0088] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0089] The forward primer Br-Gene-nuc2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0090] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACGTTTCAGGTGTAT CAACCAA;

[0091] The reverse complementary long primer Br-Gene-nuc2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: TTGGTTGATACACCTGAAACGTGCT;

[0092] The sgRNA transcription template was synthesized by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0093] The LAMP reaction primer sequence of Target, nuc-F3-2, is shown in SEQ ID NO.7, which is: CGATTGATGGTGATACGGTTA;

[0094] The LAMP reaction primer sequence of Target, nuc-R3-2, is shown in SEQ ID NO.8, which is: CAGTTCTTTGACCTTTGTCA;

[0095] The LAMP reaction primer sequence of Target, nuc-FIP-2, is shown in SEQ ID NO.9, which is: GCTTTGTTTCAGGTGTATCAACCAATTTATTAATGTACAAAGGTCAACCA ATG;

[0096] The LAMP reaction primer sequence of Target, nuc-BIP-2, is shown in SEQ ID NO. 10, which is: AAGGTGTAGAGAAATATGGTCCTGATCGACTTCAATTTTCTTTGCA;

[0097] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the samples of Staphylococcus aureus, Salmonella, Listeria monocytogenes, Vibrio parahaemolyticus and Escherichia coli O157:H7 to be tested, and then the concentration was graded and diluted to 10 3 copies / μL; the reaction system was added separately, the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM (NH4)2SO4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0098] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.11: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 20 minutes.

[0099] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 20 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute and the detection time is 20 minutes.

[0100] Results: Figure 3 As shown, this method can detect double-stranded DNA of Staphylococcus aureus with high specificity, and this method will not cross-react with other common foodborne pathogens, and there will be no false positives.

[0101] Example 3: Optimization of the detection stability of the method using different additives

[0102] Staphylococcus aureus dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0103] AGCGATTGATGGTGATACGGTTAAATTAATGTACAAAGGTCAACCAATGACATTTAGACTATTATTGGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACGTGGGCTTAGCGTATATTTATGC

[0104] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0105] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0106] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0107] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0108] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0109] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0110] The forward primer Br-Gene-nuc2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0111] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACGTTTCAGGTGTAT CAACCAA;

[0112] The reverse complementary long primer Br-Gene-nuc2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: TTGGTTGATACACCTGAAACGTGCT;

[0113] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0114] The LAMP reaction primer sequence of Target, nuc-F3-2, is shown in SEQ ID NO.7, which is: CGATTGATGGTGATACGGTTA;

[0115] The LAMP reaction primer sequence of Target, nuc-R3-2, is shown in SEQ ID NO.8, which is: CAGTTCTTTGACCTTTGTCA;

[0116] The LAMP reaction primer sequence of Target, nuc-FIP-2, is shown in SEQ ID NO.9, which is: GCTTTGTTTCAGGTGTATCAACCAATTTATTAATGTACAAAGGTCAACCA ATG;

[0117] The LAMP reaction primer sequence of Target, nuc-BIP-2, is shown in SEQ ID NO. 10, which is: AAGGTGTAGAGAAATATGGTCCTGATCGACTTCAATTTTCTTTGCA;

[0118] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the Staphylococcus aureus sample to be tested, and the concentration was gradiently diluted to 10 3copies / μL; betaine, sucrose, glycine, trehalose, mannitol and proline were diluted to 150mM-450mM, 100mM-300mM, 100mM-300mM, 100mM-400mM, 100mM-400mM and 100mM-300mM respectively; the reaction systems were added according to the gradient, and the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM (NH4)2SO4, 0.2% Triton X-100, and the pH value was 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0119] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.11: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, the detection time is 80 minutes, and the reaction is repeated 9 times.

[0120] The specific reaction process is as follows: the double-stranded DNA to be tested is added to the integrated system of amplification and reaction, and the reaction is carried out at a constant temperature of 63°C for 80 minutes. The 7900HT Fast Real-Time RCR system is used for fluorescence signal detection simultaneously. The fluorescence signal collection time interval is 1 minute, the detection time is 80 minutes, and the average SD value of each fluorescence signal collection value of 9 repetitions is calculated.

[0121] Results: Figure 4 As shown, the addition of mannitol can greatly reduce the curve fluorescence fluctuation when the method is used to detect double-stranded DNA of Staphylococcus aureus, so that the stability of the results is further improved.

[0122] Example 4: Batch sample testing of the method for detecting Staphylococcus aureus

[0123] Staphylococcus aureus dsDNA (Target) was selected as the target sequence, and the Target sequence is shown in SEQ ID NO.1, which is:

[0124] AGCGATTGATGGTGATACGGTTAAATTAATGTACAAAGGTCAACCAATGACATTTAGACTATTATTGGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACGTGGGCTTAGCGTATATTTATGC

[0125] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0126] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0127] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0128] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0129] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0130] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0131] The forward primer Br-Gene-nuc2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0132] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACGTTTCAGGTGTAT CAACCAA;

[0133] The reverse complementary long primer Br-Gene-nuc2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: TTGGTTGATACACCTGAAACGTGCT;

[0134] The sgRNA transcription template was synthesized by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0135] The LAMP reaction primer sequence of Target, nuc-F3-2, is shown in SEQ ID NO.7, which is: CGATTGATGGTGATACGGTTA;

[0136] The LAMP reaction primer sequence of Target, nuc-R3-2, is shown in SEQ ID NO.8, which is: CAGTTCTTTGACCTTTGTCA;

[0137] The LAMP reaction primer sequence of Target, nuc-FIP-2, is shown in SEQ ID NO.9, which is: GCTTTGTTTCAGGTGTATCAACCAATTTATTAATGTACAAAGGTCAACCA ATG;

[0138] The LAMP reaction primer sequence of Target, nuc-BIP-2, is shown in SEQ ID NO. 10, which is: AAGGTGTAGAGAAATATGGTCCTGATCGACTTCAATTTTCTTTGCA;

[0139] like Figure 1 As shown, amplification and shearing reaction: first, DNA was extracted from 10 groups of positive Staphylococcus aureus samples and 10 groups of negative samples to be tested; the reaction system was added separately, and the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM (NH4) 2SO4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0140] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.11: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 80 minutes.

[0141] The specific reaction process is as follows: the target to be detected is added to the integrated system of amplification and reaction, the reaction is carried out at a constant temperature of 63°C for 80 minutes, and the 7900HT Fast Real-Time RCR system is used for fluorescence signal detection simultaneously. The fluorescence signal collection time interval is 1 minute and the detection time is 80 minutes.

[0142] Results: Figure 5 As shown, the accuracy of this method in detecting Staphylococcus aureus is 100%, and no false positive or false negative events will occur.

[0143] The reaction process of this method includes LAMP target pre-amplification, CRISPR-related Cas protein or its variant recognition and shearing, and single-tube one-pot detection reaction. The present invention successfully constructed a Cas-LAMP technology that integrates these two steps of reaction into one by targeting the technical difficulties of target amplification, product recognition and shearing, and the difficulty of performing both simultaneously in a single reaction system. This technology achieves accurate, ultra-sensitive and rapid detection of nucleic acid molecules by using constant temperature in a single reaction tube system in vitro to enrich, amplify and identify nucleic acid molecules.

[0144] Compared with traditional nucleic acid molecule detection methods, the present invention has the following significant advantages: no reliance on PAM sites, extremely short detection time, high specificity, and a stable and reliable method, which is applicable to any DNA nucleic acid molecule target. This method has a wide range of application prospects in the field of rapid nucleic acid molecule detection.

[0145] The specific embodiments of the present invention are described in detail above. It should be emphasized that the present invention is not limited to the above specific embodiments, and technicians can make various deformations or modifications to the present invention without departing from the scope of the claims, and these changes should not affect the essential content of the present invention.

[0146] Sequence Listing

[0147] <110> Shanghai Jiao Tong University

[0148] <120> A one-pot nucleic acid molecular detection method mediated by LAMP and CRISPR / BrCas12b for detecting Staphylococcus aureus

[0149] <130> KAG

[0150] <160>12

[0151] <170>SIPO Sequence Listing 1.0

[0152] <210>1

[0153] <211>234

[0154] <212>DNA

[0155] <213>Artificial Sequence

[0156] <400>1

[0157] agcgattgat ggtgatacgg ttaaattaat gtacaaaggt caaccaatga catttagact 60

[0158] attattggtt gatacacctg aaacaaagca tcctaaaaaa ggtgtagaga aatatggtcc 120

[0159] tgaagcaagt gcatttacga aaaaaatggt agaaaatgca aagaaaattg aagtcgagtt 180

[0160] tgacaaaggt caaagaactg ataaatatgg acgtggctta gcgtatattt atgc 234

[0161] <210>2

[0162] <211>59

[0163] <212>DNA

[0164] <213>Artificial Sequence

[0165] <400>2

[0166] ttcttaatac gactcactat aggggaaggt ggttagctac aggctgacca gtgcagttg 59

[0167] <210>3

[0168] <211>59

[0169] <212> DNA

[0170] <213> Artificial Sequence

[0171] <400> 3

[0172] ggctgaccag tgcagttgtg tcatgtgcta cggtgaccta acacgtcact cagtcacaa 59

[0173] <210> 4

[0174] <211> 59

[0175] <212> DNA

[0176] <213> Artificial Sequence

[0177] <400> 4

[0178] cacgtcactc agtcacaacg gctatctata tttccactaa ccaaagttag tggaaatgt 59 <210> 5

[0179] <211> 53

[0180] <212> DNA

[0181] <213> Artificial Sequence

[0182] <400> 5

[0183] accaaagtta gtggaaatgt agatggttag cacgtttcag gtgtatcaac caa 53

[0184] <210> 6

[0185] <211> 25

[0186] <212> DNA

[0187] <213> Artificial Sequence

[0188] <400> 6

[0189] ttggttgata cacctgaaac gtgct 25

[0190] <210> 7

[0191] <211> twenty one

[0192] <212> DNA

[0193] <213> Artificial Sequence

[0194] <400> 7

[0195] cgattgatgg tgatacggtt a 21

[0196] <210> 8

[0197] <211> 20

[0198] <212> DNA

[0199] <213> Artificial Sequence

[0200] <400> 8

[0201] cagttctttg acctttgtca 20

[0202] <210> 9

[0203] <211> 53

[0204] <212> DNA

[0205] <213> Artificial Sequence

[0206] <400> 9

[0207] gctttgtttc aggtgtatca accaatttat taatgtacaa aggtcaacca atg 53

[0208] <210> 10

[0209] <211> 46

[0210]

Claims

1. A one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / BrCas12b for detecting Staphylococcus aureus, characterized in that: The nucleic acid molecule detection method comprises the following steps: S1. Extract nucleic acid samples from Staphylococcus aureus samples; S2. Prepare a reaction system mixed solution, wherein the mixed solution includes: a single-stranded DNA reverse cleavage probe, four oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants; S3, adding the nucleic acid sample to the reaction system mixture, performing a constant temperature reaction, and releasing a fluorescent signal; S4. After the fluorescent probe is cut, it generates a detectable fluorescent signal, which is read and recorded. The fluorescent signal is used to determine the presence of the target nucleic acid molecule in the sample to be tested. The nucleic acid test result is presented in real time in the form of a fluorescence curve.

2. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The nucleic acid molecules to be detected in the nucleic acid sample in step (1) include one or more of single-stranded DNA and double-stranded DNA.

3. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The CRISPR-associated Cas protein or its variant is a nuclease having single-stranded or double-stranded DNA recognition and cleavage functions and single-stranded DNA cleavage functions; the CRISPR-associated Cas protein or its variant includes any one of AacCas12b, AapCas12b, and BrCas12b or any one of their variants.

4. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The single-stranded DNA trans-cleavage probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group including but not limited to FAM, HEX, VIC, CY5, CY3, ROX, TAMRA, TET, FITC, and JOE, and the 3' end is labeled with a quenching group including but not limited to TAMRA, BHQ1, MGB, BHQ2, etc. that can be combined with any fluorescent group at the 5' end.

5. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The small guide RNA or its derivative comprises a sequence complementary to the oligonucleotide LAMP primer nuc-FIP-2; and the oligonucleotide LAMP primer nuc-FIP-2 sequence is complementary to a partial sequence of one chain of the target molecule and a partial sequence of the small guide RNA or its derivative, and also introduces a PAM site sequence.

6. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The Bst strand displacement DNA polymerase described in step (2) is a DNA polymerase with strand displacement effect, which can displace the downstream DNA chain without template denaturation; the DNA polymerase can be any one of Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Warmstar Bst 2.0 DNA polymerase, Bst LF DNA polymerase, OmniAmp DNA polymerase, etc., or any variant of any one of them.

7. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The spacer sequence of the small guide RNA (sgRNA) or its derivative described in step (2) is complementary to the LAMP product nucleic acid molecule sequence.

8. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The DNA single-stranded trans-cleavage probe described in step (2) is a random TA-rich single-stranded DNA sequence, which can be TTATTATT or TTTTT or TTTTTTTT or other TA-rich single-stranded DNA sequences, and the preferred sequence is TTATTATT; this sequence can be recognized by the CRISPR-Cas protein and non-specifically cleaved.

9. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The main components of the Cas-LAMP one-pot reaction buffer in step (2) include dNTPs, Tris-HCl, MgSO4, KCl, ATP, DTT, (NH4)2SO4, Triton X-100 and mannitol. The preferred reaction buffer includes: 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH value between 6.5-8.

0.

10. An isothermal nucleic acid detection system (kit) for Staphylococcus aureus nucleic acid detection method according to claim 1, characterized in that: The kit includes a single-stranded DNA trans-cleavage fluorescent reporter probe, four oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants.

Images