InDel molecular marker of bcapx6 gene, primer and application thereof

By developing the InDel molecular marker of the BcAPX6 gene and its specific primers, and using PCR technology to quickly identify the ascorbic acid content of non-heading cabbage at the seed stage, the problems of long breeding time and high cost were solved, and rapid breeding and efficient selection were achieved at the seedling stage.

CN119685506BActive Publication Date: 2025-10-14NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311230379.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-22
Publication Date
2025-10-14
Estimated Expiration
2043-09-22

AI Technical Summary

Technical Problem

The existing method for breeding non-heading cabbage with high ascorbic acid content is time-consuming and costly, and lacks a rapid identification method at the seed stage.

Method used

The InDel molecular marker of the BcAPX6 gene and its specific primers were developed, and the ascorbic acid content of non-heading Chinese cabbage was rapidly identified at the seed stage using PCR amplification technology. High and low ascorbic acid content were distinguished by detecting the presence or absence of 198bp and 201bp DNA fragments.

Benefits of technology

It achieves rapid, simple, and high-throughput breeding identification at the seedling stage, improves selection efficiency, reduces breeding costs, and establishes a marker-assisted breeding system with high ascorbic acid content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685506B_ABST
    Figure CN119685506B_ABST
Patent Text Reader

Abstract

The application provides an InDel molecular marker of BcAPX6 gene, primers and application thereof, an upstream primer of the InDel molecular marker sequence is CTCCTCTCTCTGAGAGTAGAC, and a downstream primer is GTTTAAAGAAGAAGAAGAGTGGC. The molecular marker is verified by using 39 parts of Brassica chinensis var. communis germplasm. The APX6 Indel can be used for assisted breeding of genes, and is used for identifying ascorbic acid content of the Brassica chinensis var. communis, so that field screening work is reduced, breeding cost is reduced, and breeding progress is accelerated, and has high practical value. The application is beneficial to establishment of a high ascorbic acid content marker assisted breeding system of the Brassica chinensis var. communis, and can be simply, quickly and high-throughput applied to breeding practice of the Brassica chinensis var. communis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular assisted breeding of Brassica campestris L. var. chinensis L., and particularly relates to an InDel molecular marker for assisting selection of BcAPX6 gene of Brassica campestris L. var. chinensis L. ascorbic acid content, primers and application thereof. BACKGROUND

[0002] Ascorbic acid (L-ascorbic acid, AsA) is an important member of the vitamin family and is also an indispensable nutrient for maintaining human health. Deficiency of AsA can lead to decreased immunity, decreased detoxification function of the human body, dry and dull skin, and even scurvy in severe cases. However, humans cannot synthesize AsA themselves and mainly rely on food such as vegetables and fruits. Brassica campestris L. var. chinensis L. is a popular vegetable widely planted in the middle and lower reaches of the Yangtze River in China. It occupies an important economic share of the market due to its rich germplasm resources, short growth cycle, high yield per unit area, and easy cultivation. AsA is an important nutrient in Brassica campestris L. var. chinensis L., and breeding varieties with high AsA content is one of the breeding goals of Brassica campestris L. var. chinensis L. Molecular marker-assisted breeding is an important means in molecular biological breeding, which is efficient and accurate. Therefore, the development of molecular markers related to AsA content is of great significance for high-quality Brassica campestris L. var. chinensis L. breeding.

[0003] Ascorbate peroxidase (APX) gene is a key enzyme in the ascorbate-glutathione cycle (AsA-GSH). When plants face abiotic stress, APX can oxidize AsA to dehydroascorbic acid and H2O, and GR can reduce oxidized glutathione (GSSG) to GSH, while dehydroascorbic acid is reduced to AsA. Currently, it has been shown in Arabidopsis, cherry, soybean and other plants that APX activity significantly increases under stress conditions, showing high specificity for ascorbic acid. The ascorbic acid content of transgenic tomato leaves and fruits is consistent with the activity change of APX gene, and the decrease of APX activity leads to the increase of AsA content.

[0004] Currently, in the breeding process of Brassica campestris L. var. chinensis L. with high ascorbic acid content, it is necessary to determine the ascorbic acid content by cultivating seedlings, which is time-consuming and costly. A detection method for rapidly identifying the ascorbic acid content of Brassica campestris L. var. chinensis L. at the seed stage has not been developed. SUMMARY

[0005] To solve the above technical problems in the prior art, the present application takes Brassica rapa as the research object, detects the allelic variation of BcAPX6 gene on the basis of resequencing of various varieties of Brassica rapa, and develops an Indel molecular marker of BcAPX6 by using the variation; the molecular marker is verified by using 39 Brassica rapa core germplasms. The molecular marker obtained by the present application can be used for assisted breeding of genes, and is used for identifying ascorbic acid content of Brassica rapa, so as to reduce field screening work, reduce breeding cost, accelerate breeding process, and has high practical value.

[0006] The technical method of the present application is as follows:

[0007] The first object of the present application is to provide an InDel molecular marker, which is a 198bp DNA fragment molecule as shown in the nucleotide sequence of SEQ ID No. 3 and / or a 201bp DNA fragment molecule as shown in SEQ ID No. 4.

[0008] SEQ ID No. 3:

[0009] CTCCTCTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAACAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTAAAC

[0010] SEQ ID No. 4:

[0011] CTCCTCTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAAACTCAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTAAAC

[0012] The second object of the present application is to provide a specific primer pair, which consists of primer BcAPX6indel-F and primer BcAPX6indel-R.

[0013] The primer BcAPX6indel-F is a single-stranded DNA molecule shown in SEQ ID NO. 1 of the sequence listing: CTCCTCTCTCTGAGAGTAGAC;

[0014] The primer BcAPX6indel-R is a single-stranded DNA molecule shown in SEQ ID NO. 2 of the sequence listing: GTTTAAAGAAGAAGAAGAGTGGC.

[0015] A third object of the present application is to provide a kit for detecting the aforementioned InDel molecular marker.

[0016] The present application also provides a kit containing the aforementioned specific primer pair.

[0017] A fourth object of the present application is to provide a method for identifying or assisting in identifying the ascorbic acid content of Brassica chinensis, comprising the following steps:

[0018] Using the genomic DNA of the Brassica chinensis to be tested as a template, the aforementioned specific primer pair is used for PCR amplification, if the amplification product has a 198bp DNA fragment shown in SEQ ID No. 3 and does not have a 201bp DNA fragment shown in SEQ ID No. 4, then the Brassica chinensis to be tested is a low ascorbic acid content Brassica chinensis;

[0019] If the amplification product has a 201bp DNA fragment shown in SEQ ID No. 4 and does not have a 198bp DNA fragment shown in SEQ ID No. 3, then the Brassica chinensis to be tested is a high ascorbic acid content Brassica chinensis;

[0020] If the amplification product has both a 198bp DNA fragment shown in SEQ ID No. 3 and a 201bp DNA fragment shown in SEQ ID No. 4, then the Brassica chinensis to be tested is a low ascorbic acid content Brassica chinensis.

[0021] A fourth object of the present application is to provide the use of the aforementioned InDel molecular marker or the aforementioned specific primer pair or the aforementioned kit in identifying or assisting in identifying the ascorbic acid content of Brassica chinensis

[0022] Compared with the prior art, the present application has the following beneficial effects:

[0023] The application discloses an InDel molecular marker of a Chinese cabbage ascorbic acid content gene, and designs a pair of specific primers according to the molecular marker, the primers can generate specific markers of high ascorbic acid content materials and specific markers of low ascorbic acid content materials, have good repeatability and high specificity. The InDel molecular marker is applied to identification of ascorbic acid content, can be used for quickly identifying Chinese cabbage quality at the seedling stage, and can be simply, quickly and high-throughput applied to Chinese cabbage breeding practice.

[0024] The application has the following advantages:

[0025] (1) The InDel molecular marker in the application can reflect the ascorbic acid content of Chinese cabbage, and the primer of the InDel molecular marker has high specificity and high stability;

[0026] (2) The method of the application can quickly select Chinese cabbage with high ascorbic acid content at the seedling stage, and improves the selection efficiency;

[0027] (3) The application is beneficial to establishment of a Chinese cabbage high ascorbic acid content marker-assisted breeding system, and can be simply, quickly and high-throughput applied to Chinese cabbage breeding practice. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Genotyping of the InDel molecular marker of the APX6 gene;

[0029] Figure 2 Corresponding ascorbic acid contents of 39 core germplasms of different genotypes. DETAILED DESCRIPTION

[0030] The application will be further explained in combination with the following examples, and the examples do not limit the application in any form.

[0031] In the following examples, the experimental methods are all conventional methods unless otherwise specified. In the following examples, the test materials are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0032] The primers are completed by Beijing Qikexing Biological Technology Co., Ltd., and the Chinese cabbage varieties used in the following examples are all from the Chinese Cabbage Systems Biology Laboratory of the Horticulture College of Nanjing Agricultural University.

[0033] Example 1

[0034] Step 1, according to the site provided by resequencing, 127 recombinant inbred lines were obtained by selfing the inbred lines Wu Taca and Erqing and their hybrid offspring for multiple generations, and the ascorbic acid content of the 127 recombinant inbred lines was determined by planting in Nanjing, Huzhou, and Jurong for three years, and by QTL mapping, 21 QTL sites were obtained, among which an AsAA03.2 site on the A03 linkage group was found to have a gene APX6 related to ascorbic acid circulation, and the expression amount of the gene in Wu Taca and Erqing was significantly different, at the same time, an InDel molecular marker was found in the upstream promoter region of the gene, and the marker had a deletion of three bases (ACT) in the promoter region of the APX6 gene in Erqing, and the site was located at the 31459561 bp region of the A03 chromosome of Brassica chinensis.

[0035] Step 2, specific primers were designed at 100 bp left and right of the InDel site, the upstream primer of APX6indel sequence was BcAPX6indel-F: CTCCTCTCTCTGAGAGTAGAC, and the downstream primer was BcAPX6indel-R: GTTTAAAGAAGAAGAAGAGTGGC, and PCR amplification was carried out with Brassica chinensis genomic DNA as the template, and the length of the amplified fragment was about 201 bp, DNA would not change due to the influence of environment and growth cycle, and was relatively stable, and the PCR amplification product was subjected to polyacrylamide gel electrophoresis for genotyping. The difference in electrophoretic bands can be used to distinguish genotypes, and the long fragment of 201 bp is recorded as In, the short fragment of 198 bp is recorded as Del, and both the long and short fragments are recorded as H( Figure 1 )。

[0036] The reaction system of PCR amplification is 10ul, including:

[0037] (1) 1ul of forward amplification primer represented by SEQ ID No. 1 with a concentration of 10umol / L;

[0038] (2) 1ul of reverse amplification primer represented by SEQ ID No. 2 with a concentration of 10umol / L;

[0039] (3) 1ul of DNA template with a concentration of 50ng / ul;

[0040] (4) 5ul of 2xtaq PCR

[0041] (5) 2ul of ddH2O.

[0042] The program of PCR amplification is as follows:

[0043] (1) 95℃ pre-denaturation for 5min;

[0044] (2) 95℃ denaturation 15s,

[0045] (3) 57℃ annealing 15s,

[0046] (4) 72℃ extension 20s, 30 cycles;

[0047] (5) 72℃ extension 5min;

[0048] (6) 4℃ preservation.

[0049] Step 3, InDel molecular markers of BcAPX6 gene were genotyped and analyzed in 39 accessions of Brassica rapa (Table 1). The results verified that among the 39 accessions of Brassica rapa, 19 accessions were detected as In genotype, the average AsA content was 105.47 mg / 100g; 13 accessions were Del genotype, the average AsA content was 57.88 mg / 100g; 7 accessions were H genotype with two bands, the average AsA content was 60.19 mg / 100g, which showed that In genotype was high in AsA content, Del genotype was low in AsA content, and H genotype was low in AsA content; and the detection results of the application corresponded to the actual situation of each variety, and the accuracy was high. Figure 2 Ascorbic acid is easily affected by the environment. The samples for measuring the content of ascorbic acid in this embodiment were taken from different cultivation areas. Individual strains were stressed in some environments, and the content of ascorbic acid increased. For example, Figure 2 The content of ascorbic acid of some In genotype plants was higher than that of Del type, but it would not exceed the highest ascorbic acid content value of Del plants.

[0050] Significant difference analysis (P<0.001), significant difference. Person correlation analysis of marker genotype and AsA content phenotype showed that the correlation between ASA content and marker gene was 0.74, which was significantly correlated at the 0.01 level.

[0051] Table 1: Summary of 39 accessions of Brassica rapa

[0052]

[0053] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled persons in the art, without departing from the principles of the present application, several improvements and refinements can be made, which should also be considered as the protection scope of the present application.

Claims

1. An InDel molecular marker for identifying the ascorbic acid content in non-heading Chinese cabbage, characterized in that: The InDel molecular marker is a 198 bp DNA fragment with nucleotide sequences as shown in SEQ ID No. 3 and a 201 bp DNA fragment as shown in SEQ ID No. 4: SEQ ID No.3: CTCTCTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAACAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTTAAAC; SEQ ID No. 4: CTCCTCTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAAACTCAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTTAAAC.

2. A method for identifying the ascorbic acid content of non-heading Chinese cabbage, characterized in that: The steps include: PCR amplification is performed using genomic DNA of the non-heading cabbage to be tested as a template and a specific primer pair capable of detecting the InDel molecular marker according to claim 1. If the amplified product contains the 198 bp DNA fragment shown in SEQ ID No. 3 and does not contain the 201 bp DNA fragment shown in SEQ ID No. 4, the non-heading cabbage to be tested is non-heading cabbage with a low ascorbic acid content; If the amplified product contains the 201 bp DNA fragment shown in SEQ ID No. 4 and does not contain the 198 bp DNA fragment shown in SEQ ID No. 3, the non-heading Chinese cabbage to be tested is a non-heading Chinese cabbage with a high ascorbic acid content; If the amplified product contains both the 198 bp DNA fragment shown in SEQ ID No. 3 and the 201 bp DNA fragment shown in SEQ ID No. 4, the non-heading Chinese cabbage to be tested is a non-heading Chinese cabbage with a low ascorbic acid content; The specific primer pair consists of primer BcAPX6indel-F and primer BcAPX6indel-R; The primer BcAPX6indel-F is a single-stranded DNA molecule shown in SEQ ID NO.1: CTCCTCTCTCTGAGAGTAGAC; The primer BcAPX6indel-R is a single-stranded DNA molecule shown in SEQ ID NO.2: GTTTAAAGAAGAAGAAGAGTGGC.

3. Use of the InDel molecular marker according to claim 1, or a specific primer pair for detecting the InDel molecular marker according to claim 1, or a kit containing the specific primer pair for detecting the InDel molecular marker according to claim 1, in identifying the ascorbic acid content in non-heading Chinese cabbage.

4. The use according to claim 3, characterized in that The specific primers for detecting the InDel molecular marker according to claim 1 are composed of primer BcAPX6indel-F and primer BcAPX6indel-R; The primer BcAPX6indel-F is a single-stranded DNA molecule shown in SEQ ID NO.1 of the sequence table: CTCCTCTCTCTGAGAGTAGAC; The primer BcAPX6indel-R is a single-stranded DNA molecule shown in SEQ ID NO. 2 in the sequence table: GTTTAAAGAAGAAGAAGAGTGGC.

Citation Information

Patent Citations

  • Process for marking high Vc content gene molecules of Chinese cabbage

    CN101338341A

  • Convergent cross breeding method for multi-resistance high-quality orange heart baby cabbage for spring and autumn

    CN101904295A