Application of ZNF528 gene as target spot in preparation of medicine for inhibiting coronavirus replication

Abstract

The invention discloses application of a ZNF528 gene as a target spot in preparation of a medicine for inhibiting coronavirus replication, and belongs to the technical field of biological genetic engineering. In order to solve the technical problems of relatively low flexibility, low efficiency and relatively narrow applicability of a traditional host factor in the prior art, the invention provides application of a ZNF528 gene as a target spot in preparation of a medicine for inhibiting coronavirus replication, and a key gene ZNF528 which affects infection and invasion of coronavirus in a human host cell is screened by utilizing a CRISPR (clustered regularly interspaced short palindromic repeats) screening technology; the ZNF528 gene expression inhibitor provided by the invention can be applied to preparation of a coronavirus replication inhibitor; the ZNF528 gene expression synergist provided by the invention can be applied to preparation of a coronavirus replication synergist or a vaccine production synergist.

Description

Technical Field

[0001] The invention belongs to the technical field of biological genetic engineering, and specifically relates to the application of ZNF528 gene as a target in the preparation of a drug for inhibiting coronavirus replication. Background Art

[0002] CRISPR screening technology is a high-throughput screening tool based on the CRISPR-Cas9 system. The CRISPR-Cas9 system was originally a naturally acquired immune system discovered in bacteria to resist the invasion of foreign DNA (such as phage DNA). The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) sequence can capture and preserve invading foreign DNA fragments to form a CRISPR fragment library. When the same foreign DNA invades again, Cas proteins (such as Cas9) can use the RNA generated by these fragments to recognize and cut the foreign DNA, thereby achieving an immune effect.

[0003] CRISPR screening technology is based on CRISPR-Cas9 gene editing technology, using high-throughput methods to knock out, knock down or activate thousands of genes to observe the phenotypic changes of cells under different gene changes; CRISPR screening is generally divided into the following two categories: CRISPR knockout screening (CRISPR Knockout Screen): and CRISPR interference screening and activation screening (CRISPRi and CRISPRa Screen); specifically includes the following steps: (1) Construction of sgRNA library: According to the experimental objectives (e.g., whole genome screening or specific pathway screening), a sgRNA library covering multiple genes is designed. Each gene usually corresponds to multiple sgRNAs to improve the reliability of screening; (2) Construction of cell lines: Introducing vectors containing Cas9 protein and sgRNA library into cells to ensure the random distribution of sgRNA in cells; (3) Setting of screening conditions: Setting of screening conditions according to research needs; for example, by adding drugs, changing growth conditions, infecting viruses, etc., observe which genes have an important effect on specific phenotypes of cells (such as survival rate or proliferation ability); (4) High-throughput sequencing: Using high-throughput sequencing to detect changes in the abundance of sgRNA in cells that survived the screening, and using bioinformatics analysis to determine which genes' loss or expression changes are related to the target phenotype.

[0004] During the reproduction process, coronavirus needs to go through the processes of adsorption, penetration, uncoating, biosynthesis, assembly and release, and this reproduction process requires the help of host cells. Host factors refer to the molecules or mechanisms that play a role in the infection process of host cells, which can affect the entry, replication, spread of the virus and the host's immune response. Coronaviruses are RNA viruses and are very prone to mutation during the replication process. Compared with easily mutated viral proteins, host genes involved in the process of virus infection of cells rarely mutate.

[0005] However, traditional host factors in the prior art have technical problems such as low flexibility and efficiency, as well as narrow applicability. For example: (1) RNA interference will non-specifically inhibit the expression of other non-target genes, and RNAi mainly inhibits gene expression at the post-transcriptional level, with low inhibition efficiency, thus leading to false positive or false negative results; (2) Mass spectrometry analysis and protein interaction screening can identify host proteins that directly interact with viral proteins, but cannot identify host factors that do not directly interact; (3) Small molecule compound screening has the disadvantage of low targeting and often produces extensive off-target effects, making it difficult to target specific host proteins for drug action, and the detection results are easily limited by factors such as drug permeability and cytotoxicity. Summary of the invention

[0006] In order to solve the technical problems of low flexibility, low efficiency and narrow applicability of traditional host factors in the prior art, the present invention provides the use of ZNF528 gene as a target in the preparation of drugs for inhibiting coronavirus replication.

[0007] One of the purposes of the present invention is to provide the use of the ZNF528 gene as a target in the preparation of a drug for preventing or treating coronavirus infection, wherein the nucleotide sequence of the ZNF528 gene is shown in SEQ ID NO.1.

[0008] In a preferred embodiment of the present invention, the drug targets the ZNF528 gene and inhibits or silences the expression of the ZNF528 gene.

[0009] The second object of the present invention is to provide an application of a ZNF528 gene expression inhibitor in the preparation of a coronavirus replication inhibitor, wherein the nucleotide sequence of the ZNF528 gene is shown in SEQ ID NO.1.

[0010] In a preferred embodiment of the present invention, the expression inhibitor is an RNA fragment that interferes with the expression of the ZNF528 gene, or a shRNA that targets the ZNF528 gene, or a small molecule compound that downregulates the expression of the ZNF528 gene.

[0011] In a preferred embodiment of the present invention, in the shRNA sequence targeting the ZNF528 gene, ZNF528-shRNA#1-F is shown in SEQ ID NO.2, and ZNF528-shRNA#1-R is shown in SEQ ID NO.3; ZNF528-shRNA#2-F is shown in SEQ ID NO.4, and ZNF528-shRNA#2-R is shown in SEQ ID NO.5.

[0012] The third object of the present invention is to provide a shRNA specifically targeting the ZNF528 gene, wherein the shRNA sequence targeting the ZNF528 gene is shown in SEQ ID NO.2, and ZNF528-shRNA#1-R is shown in SEQ ID NO.3; ZNF528-shRNA#2-F is shown in SEQ ID NO.4, and ZNF528-shRNA#2-R is shown in SEQ ID NO.5.

[0013] A fourth object of the present invention is to provide the use of the above-mentioned shRNA in the preparation of a drug for preventing or treating coronavirus infection.

[0014] The fifth object of the present invention is to provide the use of ZNF528 gene expression enhancer in the preparation of coronavirus replication enhancer or vaccine production enhancer.

[0015] In a preferred embodiment of the present invention, the nucleotide sequence of the ZNF528 gene is shown in SEQ ID NO.1.

[0016] In a preferred embodiment of the present invention, the expression enhancer targets the ZNF528 gene and promotes the expression of the ZNF528 gene.

[0017] Beneficial effects of the present invention: The present invention provides the use of the ZNF528 gene as a target in the preparation of a drug for inhibiting coronavirus replication, by constructing a coronavirus-infected host cell system and a mutant cell library, and using CRISPR screening technology to screen and obtain the key gene ZNF528 that affects the infection and invasion of coronavirus in human host cells.

[0018] Compared with traditional gene knockout screening methods, the CRISPR screening technology used in the present invention has higher screening efficiency and can quickly discover potential therapeutic targets; combined with the CRISPR-Cas9sgRNA with good specificity provided by the present invention, it can achieve precise targeting of specific sites in the genome, achieve precise knockout of target genes at the DNA level, and directly and thoroughly interfere with gene function; this high-precision screening method reduces the possibility of false positive or false negative results, ensuring that the screened host factors do play an important role in viral infection; and the above-mentioned CRISPR screening technology has low cost, simplified screening process, and fewer requirements for experimental materials and steps, which is suitable for large-scale research needs.

[0019] The present invention proves through WB experiments and immunofluorescence that the expression levels of coronavirus Np protein, three subtypes of XBB, JN.1, and BF.7, and human coronavirus HCOV-043 protein in the shZNF528 stable cell line with knockdown of the ZNF528 gene are significantly reduced; indicating that the ZNF528 gene is highly correlated with the survival and replication of the coronavirus in the host cells, and the knockdown of the ZNF528 gene has the function of inhibiting the survival and replication of the coronavirus in the host cells.

[0020] The ZNF528 gene provided by the present invention overcomes the shortcomings of traditional host factors such as low flexibility, low efficiency and narrow applicability. The ZNF528 gene expression inhibitor provided by the present invention can be used to prepare coronavirus replication inhibitors; the ZNF528 gene expression enhancer provided by the present invention can be used to prepare coronavirus replication enhancers or vaccine production enhancers.

[0021] Since host factors play a key role in different stages of viral infection (such as invasion, replication, assembly and release), in-depth research on the role of ZNF528 gene in virus-infected cells is conducive to a better understanding of the mechanism of virus entry into host cells. At present, the technical problem that drugs developed directly for viruses will quickly become ineffective due to viral mutations. The present invention provides a drug for preventing or treating coronavirus infection prepared by using ZNF528 gene as a target, which effectively overcomes the above technical problems. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the Western Blot result of A549-Cas9 cell line in Example 1;

[0023] Figure 2 The peak graph of the sequencing results of A549-Cas9 cells and control cell lines in Example 1; wherein the red arrow indicates the base mutation (C→A) 3 bp upstream of the PAM sequence N(T)GG;

[0024] Figure 3 This is a bubble chart of the coronavirus CRISPR screening results in Example 3;

[0025] Figure 4 The Western Blot results of shZNF528 and shControl stably transfected cell lines after coronavirus infection in Example 4 are shown;

[0026] Figure 5 This is a graph showing the immunofluorescence results of Np protein in shZNF528 and shControl stably transfected cell lines after coronavirus infection in Example 4. DETAILED DESCRIPTION

[0027] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0028] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. The test methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0029] Example 1: Preparation and verification of stable cell lines

[0030] (1) Preparation of A549-Cas9-EGFP stable transgenic cell line

[0031] The A549-Cas9-Luc2-tdT cell line used in this example was provided by the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences. Subsequently, an ACE2 overexpression plasmid containing a green fluorescent protein EGFP tag was constructed on this basis, and an A549-Cas9-EGFP overexpressing ACE2 stable cell line was constructed by lentiviral transfection.

[0032] Specifically, the following steps were included: pLVX-ACE2(human)-IRES-tdTomato plasmid was purchased from the market. Since the A549-Cas9-Luc2-tdT cell line contained a tdTomato fluorescent tag, the tdTomato in the plasmid was replaced with EGFP using the All-in-One Gold Seamless Cloning Kit (CU201) to successfully construct the pLVX-ACE2(human)-IRES-EGFP plasmid; Lipofectamine TM The lentiviral packaging was performed with Lipo3000 transfection reagent (L3000075). The successfully constructed pLVX-ACE2(human)-IRES-EGFP plasmid, VSV-G 2 and psPAX2 were added to a 10 cm dish at a ratio of 10 μg: 2 μg: 5 μg for culture. The amount of Lipo3000 added was as described in the instruction manual. The virus liquid cultured for 48 h and 72 h was collected, concentrated by centrifugation at 4 °C, and resuspended in double-antibody-free DMEM medium. The A549-Cas9 cell line was infected with the virus liquid. Subsequently, the A549-Cas9 cell line not infected with the virus was used as a control, and the A549-Cas9-EGFP stable transfection cell line was obtained by flow cytometry screening.

[0033] (2) Western Blot (WB) verification of Cas9 expression

[0034] The A549-Cas9 cell line and the control cell line (Control A549) obtained in Example (1) were plated in a six-well plate, and three replicates were performed for each cell line. When the cells were fully grown, the supernatant was aspirated, and the cells were washed twice with PBS. Subsequently, 100 μl of RIPA (Biyuntian) lysis buffer was added to each well, pipetted several times, and then transferred to a 1.5 ml centrifuge tube, placed on ice for lysis for 15 min, and then centrifuged at 4°C and 12,000 rpm for 10 min. Then, SDS protein loading buffer was added, and the cells were boiled at 95°C for 5 min for subsequent WB experiments.

[0035] WB experiments were performed on three replicates of each cell line. After electrophoresis, transfer, blocking, primary and secondary antibodies, and development, the WB results were as follows: Figure 1 As shown, the Cas9 protein in the A549-Cas9 cell line is significantly expressed compared to the control cell line (Control A549).

[0036] (3) Design sgRNA to verify Cas9 cleavage activity

[0037] The sgRNA sequence and IL1RN primer were designed for the human IL1RN gene, wherein the sgRNA-F nucleotide sequence in the sgRNA sequence was shown in SEQ ID NO.6 (CACCGTGTACTCTCTGAGGTGCTC), and the sgRNA-R nucleotide sequence was shown in SEQ ID NO.7 (AAACGAGCACCTCAGAGAGTACAC); the IL1RN-F nucleotide sequence in the IL1RN primer was shown in SEQ ID NO.8 (CTTACGCAGATAAGAACCAGTTT), and the IL1RN-R nucleotide sequence was shown in SEQ ID NO.9 (CCAGACTCTAACTCAACTGAGC). The above sgRNA was introduced into the pSpCas9(BB)-2A-GFP(PX458) plasmid, and then stably transferred into the A549-Cas9-EGFP stable cell line obtained in Example (1). A549-Cas9 was cultured in a six-well plate in advance, and 2 μg was transfected per well. Genomic DNA was extracted 72 hours after transfection, and PCR amplification was performed using IL1RN primers (shown in SEQ ID NO.8 and SEQ ID NO.9), and agarose gel electrophoresis was performed, and the gel recovery product was sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0038] The sequencing results of this example are as follows Figure 2 As shown, the A549-Cas9 cell line underwent a base mutation (C→A) approximately 3 bp upstream of the PAM sequence N(T)GG, and a double peak appeared, while the control cell line (Control A549) maintained a single peak and did not send out base mutations. The results showed that the Cas9 cutting activity of the A549-Cas9 cell line was good and could be used for subsequent experiments.

[0039] Example 2: Construction of coronavirus-infected host cell system and mutant cell library

[0040] The Brunello whole-genome CRISPR library was used, which consists of 86,441 targeted single guide RNAs (sgRNAs), with an average of 4 sgRNAs per gene, and 1,000 non-targeted control sgRNAs; a CRISPR screening and evaluation system, i.e., quality control, was established.

[0041] In this example, psPAX2 and VSV-G plasmids were used on 293T cells, and Lipo3000 transfection reagent was used to perform lentiviral packaging on the whole genome CRISPR library plasmid. The addition ratio of library plasmid: psPAX2: VSV-G was 10 μg: 5 μg: 2 μg. After 72 hours of culture, the virus liquid was collected and the A549-Cas9-EGFP overexpressing ACE2 stable cell line obtained in Example 1 (MOI 2.0) was transfected with the virus liquid collected above. 0.3) lentiviral infection was performed, and the medium was changed 8 hours after infection to ensure that each cell was infected with only one sgRNA. The cells were screened at a Puromycin screening concentration of 3 μg / ml for 3 days to obtain a mutant cell library of A549-Cas9-EGFP overexpressing ACE2 randomly introduced into the whole genome CRISPR library, and the genome of the above cells was extracted for sgRNA second-generation sequencing (Annuouda Gene Technology Co., Ltd.). Later bioinformatics data analysis showed that the number of sgRNAs transfected into the cell line accounted for 99.6% of the total library, and the quality control results were good. It can be seen that the mutant cell library for virus-infected host cells in this embodiment was successfully constructed.

[0042] Example 3: Screening of key genes targeting coronavirus entry into host cells

[0043] In the mutant cell library obtained in Example 2, mutant cell strains infected with coronavirus are screened, mutant cells resistant to coronavirus are screened, and candidate genes targeting coronavirus entry into host cells are obtained; CRISPR Screen quality control is performed on the candidate genes targeting coronavirus entry into host cells, and after the quality control is qualified, a coronavirus CRISPR screening experiment is performed, which specifically includes the following steps:

[0044] In this example, psPAX2 and VSV-G plasmids were used on 293T cells, and Lipo3000 transfection reagent was used to perform lentiviral packaging on the whole genome CRISPR library plasmid. The mixing mass ratio of plasmid: psPAX2: VSV-G was 10:5:2. The virus liquid was collected after culturing for 72 hours, and the A549-Cas9-EGFP stably transfected cell line overexpressing ACE2 obtained in Example 1 was infected with lentivirus using the collected virus liquid. The stably transfected cell line was then screened at a Puromycin screening concentration of 3 μg / ml for 3 days. The screened stably transfected cell line was then expanded and divided into 3 equal parts. The Omicron BF.7 strain of coronavirus was used at MOI 0.1 and MOI 0. 0.3 was used to infect two of the cells, and the other one was used as a negative control without virus infection; surviving cells were collected 6 days after infection, genomic DNA was extracted from the above cells, and then sgRNA second-generation sequencing was performed, and then the sequencing results were analyzed using the MAGeCK-RRA algorithm to obtain enriched genes and depleted genes.

[0045] In this example, the ZNF528 (Zinc Finger Protein 528 T-cell factor7-like 2) gene was found in the enriched genes. Figure 3 As shown, this gene encodes a zinc finger protein and is a member of the C2H2 type zinc finger protein family; this type of zinc finger protein plays an important role in gene transcription regulation. The ZNF528 protein mainly regulates gene expression by binding to DNA, which is involved in cell differentiation, proliferation and specific developmental processes.

[0046] Example 4: Application of ZNF528 gene as a target in the preparation of drugs for inhibiting coronavirus replication

[0047] The three subtypes of coronavirus XBB, JN.1, and BF.7 and human coronavirus HCOV-043 used in this example are derived from Sinopharm Biotechnology Research Institute Co., Ltd.

[0048] (1) Construction of a stable cell line with knockdown of ZNF528 gene

[0049] In this example, the ZNF528 gene (nucleotide sequence is shown in SEQ ID NO.1) is used as the target, and shRNA targeting the ZNF528 gene is designed. Among the shRNA sequences targeting the ZNF528 gene, ZNF528-shRNA#1-F is shown in SEQ ID NO.2, and ZNF528-shRNA#1-R is shown in SEQ ID NO.3; ZNF528-shRNA#2-F is shown in SEQ ID NO.4, and ZNF528-shRNA#2-R is shown in SEQ ID NO.5.

[0050] In this example, the positive and negative strands corresponding to the above-mentioned ZNF528-shRNA#1 and ZNF528-shRNA#2 were complementary paired into double strands, and the pairing conditions were: 95°C-4min, 70°C-10min gradient annealing; the pLKO.1 vector was double-digested with EcoRI and AgeI enzymes, and the linear vector after the above-mentioned digestion and the ZNF528-shRNA#1 and ZNF528-shRNA#2 double strands after complementary pairing annealing were connected using T4 Ligase at 25°C and 1h, and the transformation was plated, and a single clone was picked, the bacteria were shaken, and the plasmid was extracted and sent to (Qingke Biotechnology Co., Ltd.) for sequencing and sequence identification; the above-mentioned successfully constructed shRNA plasmid was packaged by lentivirus using lipo3000 transfection reagent, and then the A549-Cas9 cell line was infected with the above-mentioned virus to successfully construct a shZNF528 stable cell line, and the stable cell line without knocking down the ZNF528 gene was used as the control group (shControl).

[0051] In this example, WB experiments were performed on the shZNF528 stably transfected cell lines obtained above and the shControl control cell lines. The results are as follows: Figure 4 As shown, the knockdown effect of ZNF528 gene in the stably transfected cell line with knockdown of ZNF528 gene constructed in this example is good.

[0052] (2) Western blot experiment and immunofluorescence verification

[0053] In this example, the shZNF528 stable cell line and shControl control cell line obtained above were plated in a six-well plate (WB) and a twelve-well plate (IF) one day in advance, and a cell slide with a diameter of 20 mm was placed in the twelve-well plate. The next day, the shZNF528 stable cell line and the shControl control cell line were infected with three subtypes of coronavirus XBB, JN.1, and BF.7 and human coronavirus HCOV-043 (MOI 0.1), respectively, and the medium was replaced 24 hours after infection. After 48 hours of medium replacement, the supernatant culture medium was discarded, 100 μL (Biyuntian) lysis solution was added to each well, pipetted several times, and then transferred to a 1.5 ml centrifuge tube, placed on ice for lysis for 15 minutes, and then centrifuged at 4°C and 12000 rpm for 10 minutes, and then SDS protein loading buffer was added, boiled at 95°C for 5 minutes, and the shZNF528 stable cell line and shControl control cell line to be tested were obtained for subsequent experiments.

[0054] In this example, WB experiments were performed on the shZNF528 stably transfected cell lines and shControl control cell lines obtained above. After electrophoresis, membrane transfer, blocking, primary and secondary antibodies, and subsequent development, the results were as follows: Figure 4 As shown, compared with the shControl control cell line, the expression level of coronavirus Np protein in the shZNF528 stable cell line with ZNF528 gene knockdown was significantly reduced, and the expression levels of coronavirus XBB, JN.1, BF.7 three subtypes and human coronavirus HCOV-043 protein in the shZNF528 stable cell line with ZNF528 gene knockdown were significantly reduced; it can be seen that the ZNF528 gene provided by the present invention has a certain inhibitory effect on the replication of coronavirus.

[0055] In this example, immunofluorescence experiments were performed on the shZNF528 stably transfected cell line and shControl control cell line obtained above. The liquid in the 12-well plate was removed, rinsed twice with PBS, fixed with 4% paraformaldehyde fixative for 15 minutes, and then the cell slides were taken out with tweezers and placed on a glass slide, blocked, incubated with primary and secondary antibodies, washed, stained and sealed, and then observed under a fluorescence microscope.

[0056] The results are as follows Figure 5As shown, compared with the shControl control cell line, the fluorescence intensity of the coronavirus Np protein in the shZNF528 stable cell line with knockdown of the ZNF528 gene was significantly reduced, indicating that the transcription and replication of the A549-Cas9 cell line after knockdown of the ZNF528 gene were significantly weakened in the cell; it was further verified that the ZNF528 gene provided by the present invention has a certain inhibitory effect on the replication of coronavirus, wherein the knockdown of the ZNF528 gene can effectively inhibit the transcription and replication of coronavirus in cells, and the ZNF528 gene can be used as a target to prepare drugs for preventing or treating coronavirus infection.

[0057] The contents not described in detail in the specification of the present invention are well-known technologies for those skilled in the art. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be based on the definition of the claims.

Claims

1. The use of ZNF528 gene as a target in the preparation of a drug for preventing or treating coronavirus infection, characterized in that: The nucleotide sequence of the ZNF528 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug targets the ZNF528 gene and inhibits or silences the expression of the ZNF528 gene.

3. The use of a ZNF528 gene expression inhibitor in the preparation of a coronavirus replication inhibitor, characterized in that: The nucleotide sequence of the ZNF528 gene is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The expression inhibitor is an RNA fragment that interferes with the expression of the ZNF528 gene, or a shRNA that targets the ZNF528 gene, or a small molecule compound that downregulates the expression of the ZNF528 gene.

5. The use according to claim 4, characterized in that: Among the shRNA sequences targeting the ZNF528 gene, ZNF528-shRNA#1-F is shown in SEQ ID NO.2, and ZNF528-shRNA#1-R is shown in SEQ ID NO.3; ZNF528-shRNA#2-F is shown in SEQ ID NO.4, and ZNF528-shRNA#2-R is shown in SEQ ID NO.

5.

6. A shRNA specifically targeting the ZNF528 gene, characterized in that: Among the shRNA sequences targeting the ZNF528 gene, ZNF528-shRNA#1-F is shown in SEQ ID NO.2, and ZNF528-shRNA#1-R is shown in SEQ ID NO.3; ZNF528-shRNA#2-F is shown in SEQ ID NO.4, and ZNF528-shRNA#2-R is shown in SEQ ID NO.

5.

7. Use of the shRNA described in claim 6 in preparing a drug for preventing or treating coronavirus infection.

8. Application of ZNF528 gene expression enhancer in the preparation of coronavirus replication enhancer or vaccine production enhancer.

9. The use according to claim 8, characterized in that: The nucleotide sequence of the ZNF528 gene is shown in SEQ ID NO.

1.

10. The use according to claim 8, characterized in that: The expression enhancer takes the ZNF528 gene as a target and promotes the expression of the ZNF528 gene.

Images