Application of artesunate combined desmogranulocyte glycoprotein 2

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to application of artesunate combined desmosome core glycoprotein 2. The invention relates to an application of artesunate combined desmogranulocyte glycoprotein 2 in preparation of a kit for detecting cervical cancer. According to the application disclosed by the invention, it is found that the malignant characteristics of HeLa cells are strongly inhibited by silent combination of artesunate combined deodorma glycoprotein 2 genes, and the knockout of artesunate combined deodorma glycoprotein 2 genes can be used for detection and inhibition of cervical cancer HeLa cells, so that a promising treatment strategy is provided for cervical cancer.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and particularly relates to an application of artesunate combined with desmoglein 2. Background Art

[0002] Cancer is the third most common female malignant tumor in the world. Although modern medicine has achieved certain results in cancer treatment as the understanding of the causes and molecular mechanisms of cancer deepens, there are still many problems and shortcomings.

[0003] Recent studies have shown that some components extracted from traditional Chinese medicine have significant anti-tumor effects. The article "Efferth T. From ancient herb to modern drug: Artemisia annua and artemisininfor cancer therapy" records that artesunate (ART) is an active compound extracted from Artemisia annua, which is not only effective against malaria, but also has anti-inflammatory, immunomodulatory and anti-tumor effects. Artemisinin, an artemisinin drug, has been shown to selectively kill cancer cells through multiple mechanisms and has become one of the most important therapeutic drugs for cancer. In recent years, a large number of studies have shown that artesunate can not only inhibit the proliferation and metastasis of cancer cells, but also promote the development of tumor cell apoptosis or autophagy. In general, artesunate, as a new type of chemotherapy drug, has the advantages of fewer side effects and higher efficacy compared with traditional chemotherapy drugs, and has broad prospects and important application value in future cancer treatment.

[0004] Desmoglein-2 (DSG2, desmoglein 2) is a transmembrane glycoprotein that can promote tumor metastasis through the desmosome glycoprotein structure, thereby affecting cell mitosis. It has a complex role in tumorigenesis and cancer progression, and its expression level varies significantly in different types of cancer. DSG2 is related to the regulation of cell cycle-related genes and has an impact on the cellular processes that are often dysregulated in cancer. Studies have found that high expression of DSG2 in lung adenocarcinoma is associated with tumor size, lymph node metastasis, and TNM staging, and DSG2 can be used to predict poor prognosis of lung adenocarcinoma. Studies have also shown that DSG2 promotes the growth of lung adenocarcinoma cells in vivo and increases osimertinib resistance through EGFR signaling. However, research on the role of DSG2 in cervical cancer is relatively limited. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide an application of artesunate combined with desmoglein 2 in cervical cancer.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is: an application of artesunate combined with desmoglein 2 in the preparation of a kit for detecting cervical cancer.

[0007] Another technical solution adopted by the present invention is: an application of artesunate combined with desmoglein 2 in the preparation of a drug for treating cervical cancer.

[0008] The beneficial effect of the present invention is that: the present invention found that the combination of artesunate and desmoglein 2 gene silencing effectively inhibited the malignant characteristics of HeLa cells, and artesunate combined with desmoglein 2 gene knockout can be used for the detection and inhibition of cervical cancer HeLa cells, providing a promising treatment strategy for cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is a DSG2 analysis chart of various female cancers in Example 1 of the present invention; Figure 2 This is a correlation test graph between the DSG2 expression level and the overall survival rate of cervical cancer patients in Example 1 of the present invention; Figure 3 This is the expression diagram of DSG2 protein in cervical cancer and adjacent tissue microarray in Example 1 of the present invention; Figure 4 This is a summary diagram of the positive staining rates of 31 pairs of cervical cancer tumor tissues and their corresponding adjacent normal tissues in Example 1 of the present invention; Figure 5 The expression results of DSG2 in HeLa KO detected by RT-PCR in Example 1 of the present invention; Figure 6 This is a gel image of the expression results of DSG2 in HeLa CG detected by Western blot in Example 1 of the present invention; Figure 7 This is a statistical graph of the expression results of DSG2 in HeLa-DSG detected by Western blot in Example 1 of the present invention; Figure 8 The figure is a graph showing the effect of ART on the HeLa CG cell proliferation inhibition rate detected by the CCK-8 method in Example 1 of the present invention, and the figure showing the effect of different concentrations of ART on the proliferation inhibition rate of three groups of HeLa cells at 24h, 48h and 72h; Fig. 9 This is a graph showing the effect of ART concentration on HeLa-KO cell clone formation in Example 1 of the present invention; Fig.10 This is a graph showing the effect of ART concentration on HeLa-CG cell clone formation in Example 1 of the present invention; Fig.11This is a graph showing the effect of ART concentration on HeLa-OE cell clone formation in Example 1 of the present invention; Fig.12 for Figures 9-11 Absorbance curve of crystal violet; Fig.13 This is a test diagram of the proportion of cells in GO / G1, S and G2 / M phases in 6 groups detected by flow cytometry in Example 1 of the present invention; Fig.14 for Fig.13 Statistical chart of Fig.15 This is a graph showing the effect of ART on the migration rate of HeLa-KO cells at 0, 8, 16 and 24 h in Example 1 of the present invention; Fig.16 This is a graph showing the effect of ART on the migration rate of HeLa-CG cells at 0, 8, 16 and 24 h in Example 1 of the present invention; Fig.17 This is a graph showing the effect of ART on the migration rate of HeLa-OE cells at 0, 8, 16 and 24 h in Example 1 of the present invention; Fig.18 for Figures 15-17 Data analysis chart of Fig.19 This is a graph showing the number of migrated cells measured at 48 hours by the Transwell assay in Example 1 of the present invention; Fig. 20 for Fig.19 Statistical chart of Fig.21 This is a graph showing the number of cells invading at 48 hours measured by the Transwell assay in Example 1 of the present invention; Fig. 22 for Fig.21 Statistical chart of Fig.23 This is a GO enrichment analysis diagram of differentially expressed genes in Example 1 of the present invention; Fig.24 This is a partial gene set enrichment analysis diagram in Example 1 of the present invention; Fig.25 Another part of the gene set enrichment analysis diagram in Example 1 of the present invention; Fig.26 This is a diagram showing the effect of ART on the mRNA expression of MEK, ERK, PI3K and AKT in HeLa KO, HeLa CG and HeLa-DSG2 cell lines in Example 1 of the present invention; Fig. 27 This is a diagram showing the effect of ART on the relative expression of MEK, ERK, PI3K and AKT in HeLa KO, HeLa CG and HeLa-DSG2 cell lines in Example 1 of the present invention; Fig.28 for Fig. 27 Analytical statistics chart. DETAILED DESCRIPTION

[0010] In order to explain the technical content, achieved objectives and effects of the present invention in detail, the following is an explanation in combination with the implementation modes and the accompanying drawings.

[0011] An application of artesunate combined with desmoglein 2 in the preparation of a kit for detecting cervical cancer. From the above description, it can be seen that the beneficial effects of the present invention are: during the experiment, it was found that artesunate combined with DSG2 gene silencing affected the behavior of HeLa cells, a cervical cancer cell line, and artesunate significantly reduced cell proliferation in a dose-dependent manner, and had an inhibitory effect on the proliferation activity of HeLa cells. Artesunate further hindered cell progression by inducing G2 / M cell cycle arrest. After knocking out the DSG2 gene, cell migration was reduced, and the migration and invasion ability of HeLa cells were inhibited. Artesunate can further reduce the expression of DSG2. The combination of artesunate and desmoglein 2 gene silencing effectively inhibited the malignant characteristics of HeLa cells, providing a promising treatment strategy for cervical cancer.

[0012] Furthermore, the kit detects poor prognosis of cervical cancer through up-regulation of desmoglein 2 gene expression.

[0013] Furthermore, the kit uses desmoglein 2 as a therapeutic target for cervical cancer.

[0014] Furthermore, the kit uses desmoglein 2 as a biomarker for predicting the prognosis of early cervical cancer.

[0015] Another technical solution adopted by the present invention is: an application of artesunate combined with desmoglein 2 in the preparation of a drug for treating cervical cancer.

[0016] Furthermore, the drug inhibits cervical cancer HeLa cells by combining artesunate with desmoglein 2 to treat cervical cancer.

[0017] Furthermore, the drug inhibited the proliferation, migration and invasion of HeLa cells through artesunate combined with desmoglein 2 gene silencing.

[0018] Furthermore, the combination of artesunate and desmoglein 2 plays a carcinogenic role in cervical cancer cells by mediating MAPK and PI3K / AKT signaling pathways.

[0019] Furthermore, the drug inhibited the MAPK and PI3K / AKT signaling pathways through artesunate combined with desmoglein 2 gene silencing, thereby regulating HeLa cell behavior.

[0020] Furthermore, the drug inhibited the MAPK and PI3K / AKT signaling pathways through artesunate combined with desmoglein 2 gene silencing, thereby inhibiting the proliferation, migration and invasion of HeLa cells.

[0021] Embodiment 1 of the present invention is: DSG2 combined with artesunate studies on the proliferation, migration and invasion of cervical cancer cells.

[0022] 1. Test methods 1. Cell lines and transfection ART was purchased from Sigma and prepared as a stock solution by dissolving it in dimethyl sulfoxide (DMSO) at a concentration of 200 mg / mL. This stock solution was then stored at -20 °C to maintain its stability and potency for subsequent experiments.

[0023] HeLa cell lines were purchased from the Cell Bank of the Chinese Academy of Medical Sciences (Shanghai) and genetically modified by members of the research team using CRISPR / Cas9 technology to create cells with low expression of DSG2 (HeLa-KO), overexpression of DSG2 (HeLa-OE), and empty vector control (HeLa-CG). The expression level of DSG2 in all cell lines has been verified. HeLa cells were cultured in Dulbecco's modified medium (DMEM) (HyClone, China) supplemented with 10% fetal bovine serum (FBS) (Biological Industries, Beit Hamek Ltd, Israel) and 1% penicillin / streptomycin (P / s) (Vivacel, XP Biomed Ltd, China), and the cells were incubated at 37°C with 5% CO2.

[0024] Antibodies to phosphorylated MEK (1:1000), phosphorylated ERK (1:2000), phosphorylated PI3K (1:1000), and phosphorylated AKT (1:2000) were purchased from Cell Signaling. Antibodies to MEK (1:5000), ERK (1:2000), PI3K (1:1000), and AKT (1:200) were purchased from Proteintech. Antibody to β-actin was purchased from Santa Cruz. Secondary antibody (goat anti-rabbit) was labeled with horseradish peroxidase.

[0025] 2. Immunohistochemistry (IHC) For immunohistochemical analysis of cervical cancer tissue microarrays (OD-CT-RpUt03-006, Shanghai Xinchao Biotechnology Co., Ltd.), the sections were first baked and delipidated by a series of xylene and ethanol washes. Antigen retrieval was then performed at 97°C for 30 min using buffer, followed by cooling and rinsing in distilled water. Primary antibody was then incubated with rabbit anti-human DSG2 IgG (1:250 dilution, Abcam) overnight at 4°C, followed by room temperature equilibration and PBST rinsing, and detection was performed using the Autostainer Link48 with the EnVision FLEX+ system and DAB chromogen. Slides were counterstained with hematoxylin, differentiated, and mounted. Staining evaluation included scanning with an Aperio scanner and scoring based on cell localization, intensity (0–3 scale), and percentage of positive cells, and the combined score was used to distinguish between low and high DSG2 expression groups.

[0026] 3. RNA Sequencing Total RNA was extracted from transfected HeLa cells using QIAzol Lysis reagent (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. RNA samples were then stored at −80°C until further use. RNA quality and quantity were assessed using a spectrophotometer, and RNA integrity was confirmed using a bioanalyzer. Library preparation for RNA sequencing was performed using the TruSeq RNA Library Preparation Kit. The prepared cDNA libraries were sequenced on the Salus Pro sequencing platform provided by Shenzhen Salus Medical Technology Co., Ltd. (http: / / www.salus-bio.com / ) to generate 150 bp paired-end reads. Raw sequencing data were processed using FastQC for quality trimming and adapter removal. Clean reads were aligned to the human reference genome (GRCh38) using HISAT2, and gene expression levels were quantified using featureCounts in the Subhead package and normalized to transcripts per million (TPM). Differential gene expression analysis was performed using DESeq2, and genes with an adjusted p-value < 0.05 were considered significantly differentially expressed.

[0027] 4. CCK-8 content determination In vitro cell proliferation was assessed using the CCK-8 assay. HeLa cells were aliquoted into 96-well plates and incubated at 37°C in a humidified atmosphere containing 5% CO2 for 72 h. Cell viability was assessed every 24 h. Prior to each viability measurement, cells were incubated with 10 μL of CCK-8 reagent per well at 37°C for an additional 1.5 h. Absorbance was measured at 450 nm using a Thermo Fisher Scientific Multiskan GO microplate reader.

[0028] 5. Clone formation test Trypsinize the cells and add 1x10 cells per well. 5 Cells were seeded into 6-well plates at a density of 10 cells / mL for 24 h and then treated with ART at concentrations ranging from 0 to 160 μg / mL for 48 h. Cells were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet, washed with PBS (phosphate buffered saline) and imaged. The stained cells were air-dried, the dye was dissolved in 35% acetic acid, and the absorbance was measured at 550 nm using a microplate reader.

[0029] 6. Cell migration and invasion assay To study migration ability, cells were seeded in six-well plates and cultured in culture medium until cell confluence approached 100%. Wound closure was performed using a plastic pipette tip. Floating and non-viable cells were rinsed with PBS, and then artesunate at concentrations of 0 and 20 μg / mL was added. After treatment, cultures were observed and photographed at intervals of 0, 24, 48, and 72 h to record wound closure progress.

[0030] For transwell assays, transfected cells were plated at 1 × 10 5 The density of cells was added to the upper part of the transwell chamber in 100 μL of serum-free medium. The transwell chamber using Matrigel (BD Bioscience) was used to evaluate the invasive properties of tumor cells. The lower chamber was filled with 500 μL of culture medium. After 24 h, the invasive cells that passed through the membrane were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 20 min, while the non-invasive cells in the upper chamber were removed with a cotton swab. The number of invasive cells was counted from five randomly selected fields under a microscope.

[0031] 7. Flow cytometry The effect of ART on the cell cycle of HeLa cells, a cervical cancer cell line, was studied using the Cell Cycle Detection Kit from Bio-Tech. HeLa cells were treated with different concentrations of ART (0, 20µg / mL) for 48h. After treatment, the cells were collected and washed three times with PBS. Each sample was then fixed in 70% pre-cooled ethanol at 4°C overnight. After fixation, the cells were rinsed three times in ice-cold PBS, and 0.5mL of PI staining solution containing ribonuclease at a final concentration of 200µg / mL was added to each sample. The samples were incubated at room temperature in the dark for 30min. Finally, the cells were analyzed using flow cytometry to determine the distribution of cells in different stages of the cell cycle.

[0032] 8. qRT-PCR Total RNA was extracted from HeLa cells using TRIzol reagent (QIAGEN, Germany) according to the manufacturer's protocol. The amount of RNA was assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Specific primers for the genes of interest were designed using an online tool provided by Co., Ltd. and synthesized by the same company. The primer sequences were as follows: [CTAACAGGTTACGCTTTGGATGC] and [GTGAACACTGGTTCGTTGTCAT]. cDNA was synthesized using the Takara PrimeScript™ RT reagent kit. qPCR was performed using the designed primers and cDNA template on an Applied Biosystems 7500 Real-Time PCR System using SYBR Green Master Mix. The cycling conditions were 95°C / 30s, followed by 40 cycles of 95°C / 5s and 60°C / 34s.

[0033] 9. Western blot Proteins were extracted from transfected cells using lysis buffer on ice. Protein concentrations were determined using a BCA protein assay kit (Solarbio, Beijing, China). Equal amounts of protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 1 h at room temperature and then incubated with primary antibodies (diluted 1:1000; Cell Signaling Technology, Danvers, MA, USA) overnight at 4°C. After washing three times with TBST, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (diluted 1:10000, ZSGB-BIO) for 1 h. Immunoreactive bands were detected using an enhanced chemiluminescence (ECL) substrate (Bio-Rad). Band density was quantified using Quantity One software (Bio-Rad Laboratories, Hercules, CA, USA), with β-actin as an internal control.

[0034] 10. Statistical analysis All statistical calculations were performed using SPSS software and GraphPad Prism. Comparative analysis between two different groups was performed using the Student t test. To assess differences between multiple groups, analysis of variance (ANOVA) was performed, followed by Dunnett's post hoc test to correct for multiple comparisons. The chi-square test was applied to evaluate the correlation between DSG2 expression and clinicopathological characteristics of cancer. Statistical significance was determined at a threshold of P < 0.05.

[0035] 2. Experimental Conclusion 1. Upregulation of DSG2 gene expression in cervical cancer tissue is directly associated with poor prognosis Elevated DSG2 expression in cervical cancer tissues was significantly associated with adverse clinical outcomes and poor prognosis. This association was highlighted by results from bioinformatics analysis of datasets, including results from The Cancer Genome Atlas (TCGA), which has identified DSG2 as a key gene that is upregulated in early-stage cervical cancer compared with adjacent noncancerous tissues. Figure 1 Analysis of the TCGA dataset showed that the expression level of Desmoglein 2 (DSG2) was significantly increased in various gynecological tumors, and statistical significance was observed in ovarian serous cystadenocarcinoma (OV), uterine corpus endometrial carcinoma (UCEC), cervical squamous cell carcinoma, and cervical adenocarcinoma (CESC) (all P < 0.05), however, in breast invasive carcinoma (BRCA), the expression level did not differ significantly (P > 0.05). Figure 2 The results showed that patients with high DSG2 mRNA expression levels showed significantly lower overall survival (OS) compared with patients with low DSG2 expression (P (HR) = 0.014), with a hazard ratio (HR) of 1.8, indicating that DSG2 is a high-risk factor for cancer and is associated with adverse outcomes.

[0036] In this study, we examined the expression of DSG2 by immunohistochemistry (IHC) using tissue microarrays (IHC, X10, X200) of 31 pairs of cancer and adjacent noncancerous tissues. Figure 3~4 The results showed that DSG2 staining was mainly in the cytoplasm in cervical cancer cells. Comparison of the IHC results of the high-expression group and the low-expression group in the cervical cancer tissue microarray showed that the DSG2 staining intensity in cancer tissues was significantly stronger (P<0.05). Table 1 is the general information table of the patients, and Table 2 is a comparison table of DSG2 expression in cervical cancer and adjacent tissues. Figure 4 middle These findings suggest that DSG2 could serve as a potential therapeutic target and a biomarker for predicting the prognosis of early-stage cervical cancer.

[0037] Table 1

[0038] Table 2

[0039] 2. Artesunate and DSG2 knockout inhibited the proliferation, migration and invasion of HeLa cells Figures 5 to 7HeLa cell lines with DSG2 knockout (HeLa-KO), DSG2 overexpression (HeLa-OE) and empty vector control (HeLa-CG) were generated using CRISPR / Cas9 technology (P<0.01). The successful establishment of these cell lines was confirmed by qRT-PCR and Western blot analysis, and there was a significant difference in DSG2 protein expression levels compared with the control group. The above data showed that the expression level of DSG2 decreased in the ART alone treatment group, while in the ART plus DSG2 gene knockout combined treatment group, the expression level of DSG2 was significantly reduced, which was statistically significantly different from the ART alone treatment group (P<0.05), indicating that ART treatment would reduce the content of DSG2.

[0040] At the same time, the effects of ART combined with DSG2 gene silencing on the behavior of cervical cancer cell line HeLa cells were studied. Using a comprehensive experimental method including CCK-8 test, colony formation test, cell cycle analysis, scratch test and Transwell test, it was found that ART significantly reduced cell proliferation in a dose-dependent manner. The results are shown in Figure 8 , Figure 8 middle , , , ns is meaningless. Figure 8 The results showed that the OD values ​​of HeLa cells transfected with HeLa KO were significantly decreased at 48 and 72 h compared with those in the HeLa CG group (P<0.01), indicating that silencing DSG2 inhibited cell proliferation.

[0041] The results of the clone formation assay were Figures 9-11 As shown in the figure, the magnification is x40. This result shows that ART has an inhibitory effect on the proliferation activity of HeLa cells. As the drug concentration increases, a significant decrease in cell density is observed. The results after dissolving crystal violet with acetic acid are shown in Fig.12 , absorbance measurements of all wells showed that cells with different DSG2 expressions showed different degrees of effects on proliferation activity. Fig.13 and Fig.14 The results showed that ART induced G2 / M cell cycle arrest, further hindering cell progression, Fig.13 and 14 middle , ).

[0042] Figures 15 to 18 , P<0.01. The results showed that after DSG2 was downregulated, the migration ability of HeLa KO group cells was inhibited. Figures 15-17The magnification is x40, indicating that DSG2 knockdown reduced cell migration. In addition, a Transwell assay was performed and the results are shown in Figures 19 to 22 , P < 0.05, to examine whether cells with DSG2 downregulation would show reduced ability to invade Matrigel-coated Transwell chambers compared with the control group. Interference with HeLa KO significantly inhibited the migration and invasion abilities of HeLa cells, including Fig.19 and Fig.21 The magnification is x100.

[0043] Together, these findings suggest that the combination of ART and DSG2 gene silencing robustly suppresses the malignant properties of HeLa cells and provides a promising therapeutic strategy for cervical cancer.

[0044] 3. Single gene set enrichment analysis (GSEA) identified pathways that were significantly upregulated and enriched when DSG2 was highly expressed in CC Figures 23 to 25 GSEA found that, P < 0.01, pathways related to apoptosis, injury response, and MAPK and PI3K / AKT signaling pathways were significantly upregulated when DSG2 expression changed and ART treatment was present. These upregulated pathways may affect cell proliferation, differentiation, and drug sensitivity.

[0045] 4. The combination of ART and DSG2 genes plays a carcinogenic role in cervical cancer cells by mediating MAPK and PI3K / AKT signaling pathways In the qPCR experiment, the expression levels of key proteins MEK, ERK, PI3K and AKT in the MAPK and PI3K / AKT signaling pathways were evaluated. Fig.26 , Fig.26 P<0.01, and the results showed that the mRNA expression level in HeLa cells treated with ART and DSG2 gene silencing (HeLa KO ART) was significantly decreased after drug treatment compared with the control group.

[0046] To elucidate the molecular mechanisms by which ART and DSG2 gene silencing work in combination, we used western blot analysis. This method was used to detect the expression levels of key proteins in the MAPK and PI3K / AKT signaling pathways, with a particular focus on phosphorylated MEK (p-MEK), phosphorylated ERK (p-ERK), phospho-PI3K (p-PI3K), and phosphorylated AKT (p-AKT). By evaluating the protein expression profile, we aimed to determine whether downregulation of DSG2 could sufficiently inhibit these key signaling cascades to affect the behavior of cervical cancer cells. Compared with the control group, Western blot analysis showed that the expression of p-MEK, p-ERK, p-PI3K, and p-AKT was significantly reduced in the HeLa KO ART group, as shown in Figure 2. Fig. 27 Quantitative analysis by ImageJ software is shown in Fig.28 , Fig.28 These findings were confirmed by the observation of significant differences in P < 0.01. These results suggest that the combination of ART and DSG2 gene silencing may regulate cell behavior by inhibiting the MAPK and PI3K / AKT signaling pathways.

[0047] This finding was consistent with qPCR analysis, further confirming that the combination of ART and DSG2 gene silencing may regulate cell behavior by inhibiting MAPK and PI3K / AKT signaling pathways.

[0048] The second embodiment of the present invention is: an application of artesunate combined with desmoglein 2 in the preparation of a kit for detecting cervical cancer.

[0049] Embodiment 3 of the present invention is: use of artesunate combined with desmoglein 2 in the preparation of a drug for treating cervical cancer.

[0050] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent transformations made using the contents of the present invention's specification and drawings, or directly or indirectly applied in related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. An application of artesunate combined with desmoglein 2 in the preparation of a kit for detecting cervical cancer.

2. The use according to claim 1, characterized in that: The kit detects poor prognosis of cervical cancer through up-regulation of desmoglein 2 gene expression.

3. The use according to claim 1, characterized in that: The kit uses desmoglein 2 as a target for the treatment of cervical cancer.

4. The use according to claim 1, characterized in that: The kit uses desmoglein 2 as a biomarker for predicting the prognosis of early cervical cancer.

5. Use of artesunate combined with desmoglein 2 in the preparation of a drug for treating cervical cancer.

6. The use according to claim 5, characterized in that: The drug inhibits cervical cancer HeLa cells through artesunate combined with desmoglein 2 to treat cervical cancer.

7. The use according to claim 6, characterized in that: The drug inhibits the proliferation, migration and invasion of HeLa cells through artesunate combined with desmoglein 2 gene silencing.

8. The use according to claim 5, characterized in that: The combination of artesunate and desmoglein 2 plays a carcinogenic role in cervical cancer cells by mediating MAPK and PI3K / AKT signaling pathways.

9. The use according to claim 5, characterized in that: The drug inhibits MAPK and PI3K / AKT signaling pathways through artesunate combined with desmoglein 2 gene silencing, thereby regulating HeLa cell behavior.

10. The use according to claim 9, characterized in that: The drug inhibits the MAPK and PI3K / AKT signaling pathways through artesunate combined with desmoglein 2 gene silencing, thereby inhibiting the proliferation, migration and invasion of HeLa cells.

Images