Nanoparticles and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to glycopolymer nanoparticles and application thereof. The anti-cancer drug AMG510 is wrapped in mannose, the tumor microenvironment can be reprogrammed, and the permeation effect of the drug on tumors is improved. The synthesized glycopolymer nanoparticle AMG510 (at) M-NP has hydrophilicity and is easy to absorb in vivo, the actual dosage is reduced under the theoretical dosage, and the adverse drug reaction is further relieved. Mannose and AMG510 have a synergistic effect, so that the anti-cancer effect is improved. The raw material mannose is easily available, the preparation process is simple, the cost is reduced, and the method is suitable for mass production.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a sugar polymer nanoparticle and an application thereof. Background Art

[0002] Colorectal cancer (CRC) is a common malignant tumor of the digestive tract and the third most common malignant tumor in the world. The incidence rate in men ranks third and that in women ranks second (Li Daojuan, Li Qian, He Yutong. Epidemiological trends of colorectal cancer [J]. Cancer Prevention and Treatment Research, 2015.). In 2018, there were more than 1.8 million new cases and about 881,000 deaths worldwide (Tian Chuanxin, Zhao Lei. Epidemiological characteristics of colorectal cancer and colorectal liver metastasis [J]. Chinese Journal of Cancer Prevention and Treatment, 2021.). Although traditional therapies such as surgery, radiotherapy and chemotherapy have certain effects in the early stages of CRC, they have limited effects in the late stages or cases with specific gene mutations. The mortality rate of colorectal cancer remains high, and new treatment models need to be continuously explored (Zhai Jianning, Wang Xicheng, Wu Aiwen. Progress in the treatment of colorectal cancer in 2022 [J]. Electronic Journal of Comprehensive Cancer Treatment, 2023.).

[0003] KRAS mutation is a common genetic mutation in many cancers, especially in pancreatic cancer, colorectal cancer and non-small cell lung cancer (NSCLC). The KRAS gene encodes a small GTPase that plays a crucial role in cell signaling, especially in regulating cell growth and differentiation (S. J. Drábek et al. "Clinical Relevance of KRAS in Human Cancers." Journal of Biomedicine and Biotechnology, 2010.). KRAS mutations usually cause it to remain in an activated state, thereby promoting tumor development. It usually leads to abnormal activation of the MAPK pathway, resulting in reduced patient survival (Andreas C. Damianou, Zhu Liang et al. "Interplay Between KRAS and LZTR1 Protein Turnover, Controlled by CUL3 / LZTR1 E3 Ubiquitin Ligase, is Disrupted by KRAS Mutations." bioRxiv, 2021.).

[0004] However, despite the important carcinogenic role of KRAS mutations in various cancers, its treatment has always been challenging. Due to the special structure of KRAS protein and the lack of obvious binding sites, it has long been considered an "undruggable" target (Hu Jiarui, Li Zhanlin. Research progress on biological characteristics, clinical treatment and prognosis of advanced non-small cell lung cancer with KRAS mutation [J]. Chinese Oncology, 2023.). However, with the in-depth study of the mechanism of KRAS mutation, scientists have discovered a variety of potential treatment strategies, including small molecule inhibitors targeting KRAS GTPase activity and the use of signaling pathway changes caused by KRAS mutations to develop combined treatment options (M.Molina-Arcas, D.Hancock et al. "Abstract 4163: Determination of synthetic lethal interactions in KRAS oncogene dependent cancer cells reveals novel therapeutic targeting strategies." Cancer Research, 2012.)

[0005] KRAS mutant alleles KRAS G12C This causes KRAS protein to persist in an inactive state bound to GDP, thereby activating downstream MAPK and PI3K signaling pathways and promoting the survival and proliferation of tumor cells (A. Chour, A. Toffart et al. “Mechanisms of resistance to KRASG12C inhibitors in KRAS G12C -mutated non-small cell lung cancer." Frontiers in Oncology, 2024.). In recent years, targeting KRAS G12C Significant progress has been made in the development of inhibitors of KRAS mutations. For example, MRTX849 and ARS-853 are two KRAS G12C Selective covalent inhibitors that bind to KRAS G12CAMG510 is a representative drug of these inhibitors, with an objective response rate (ORR) of only 9.7% in CRC. When used in combination with panitumumab, the ORR was only 30.0%. These drugs have shown good anti-tumor activity in preclinical models and some patients, and have also shown enhanced effects in combination therapy strategies (James G Christensen, Peter Olson et al. "Targeting Krasg12c-mutant cancer with a mutation-specific inhibitor." Journal of Internal Medicine, 2020.; Kevin Lou, V. Steri et al. "KRASG12C inhibition produces a driver-limited state revealing collateral dependencies." Science Signaling, 2019.) However, despite the positive responses of these inhibitors in some patients, treatment resistance remains a major challenge. In addition, many combination therapy regimens of AMG510 are being evaluated at different stages of clinical trials, such as the combination of anti-PD-1 antibodies and AMG510, in order to improve the therapeutic effect by reshaping the tumor microenvironment; but none of them have achieved satisfactory therapeutic effects. This suggests that KRAS G12C The treatment of mutant CRC still needs to be further optimized.

[0006] Nanotechnology has shown great potential in cancer treatment, especially in drug delivery systems, due to its unique physical and chemical properties. On the one hand, nanoparticles circulate throughout the body after entering the body and accumulate or release drug loads in tumors to achieve local treatment. On the other hand, they can also significantly improve the solubility, stability and bioavailability of drugs, thereby achieving targeted drug delivery, minimizing systemic toxicity, and maximizing therapeutic relevance and efficiency. In addition, these systems can also increase the accumulation of drugs in tumor tissues through passive and active targeting. The EPR effect refers to the phenomenon that nanomedicines can penetrate from the blood into tumor tissues and remain there for a long time due to the high permeability and poor lymphatic drainage of tumor blood vessels (U. Prabhakar, H. Maeda et al. "Challenges and key considerations of the enhanced permeability and retention effect for nanomedicine drug delivery in oncology. "Cancer research, 2013.). This phenomenon provides a theoretical basis for the passive targeting of nanomedicine in tumor therapy (Elizabeth Huynh, G. Zheng. "Cancernanomedicine: addressing the dark side of the enhanced permeability and retention effect.." Nanomedicine, 2015.). However, the EPR effect shows significant heterogeneity between different types of tumors and different patients (Jooho Park, Yongwhan Choi et al. "Alliance with EPREffect: Combined Strategies to Improve the EPR Effect in the Tumor Microenvironment." Theranostics, 2019.). Therefore, reprogramming the tumor microenvironment can increase the penetration of drugs into tumors and provide new treatment options.

[0007] As a biocompatible natural monosaccharide, mannose has excellent drug carrying capacity and can improve delivery efficiency. Mannose-modified nanoparticles have shown broad application potential in drug delivery, disease treatment and biomedical research due to their specific targeting ability, good biocompatibility (Zhou Lin, Zhu Li, Chen Li, et al. Effect of mannose-modified chitosan on macrophage uptake of nanoparticles [J]. Journal of Suzhou University (Medical Edition), 2011.), safety, versatility and stability. Mannose-modified nanoparticles can specifically target cells expressing mannose receptors, such as macrophages (Zhou Lin, Zhu Li, Chen Li, et al. Effect of mannose-modified chitosan on macrophage uptake of nanoparticles [J]. Journal of Suzhou University (Medical Edition), 2011.), tumor-associated macrophages (TAMs) (Liu Yu. Study on the binding ability of mannosylated chitosan nanoparticles to tumor tissue [D]. Luzhou Medical College, 2015.) and M2 macrophages (Huang Yan, Jiang Ou, Wen Qinglian, et al. Experimental study on the targeting binding of mannosylated carboxymethyl chitosan and etidronic acid complex nanoparticles to M2 macrophages [J]. Cancer Progress, 2018.). This specific binding ability makes mannose-modified nanoparticles an effective drug delivery system, especially in tumor treatment (Huang Yan. Preliminary study on the anti-tumor effect of mannosylated imidazolylated carboxymethyl chitosan and etidronic acid complex nanoparticles in animals [D]. Southwest Medical University, 2018.) and anti-inflammatory treatment. For example, mannose-modified superparamagnetic iron oxide nanoparticles can achieve the purpose of targeting macrophages by specifically binding to mannose receptors on the surface of macrophages (Qing Xin. Mannose-modified iron oxide nanoparticles relieve chemotherapy-induced peripheral neuropathic pain [D]. Anhui Medical University, 2022.). Currently, there are very few studies on the oral administration of mannose materials. Therefore, combining AMG510 with mannose to prepare a new oral drug preparation for cancer treatment has clinical significance and market prospects. Summary of the invention

[0008] The present invention has found that combining anticancer drugs with sugar polymers can reprogram the tumor microenvironment and increase the drug's penetration into the tumor. Based on this, the present invention has been completed.

[0009] In a first aspect, the present invention provides a sugar polymer nanoparticle having a structural formula of M@S-NP; wherein M is an anti-tumor drug and S-NP is a sugar polymer; the anti-tumor drug is encapsulated inside the sugar polymer to form a sugar polymer nanoparticle.

[0010] Furthermore, the sugar polymer is selected from mannose and / or glucose; preferably mannose.

[0011] Furthermore, the anti-tumor drug is selected from one or more of AMG510, MRTX849 and / or ARS1620; preferably AMG510.

[0012] In one embodiment of the present invention, when the sugar polymer is mannose and the anti-tumor drug is AMG510, the sugar polymer nanoparticles formed are AMG510@M-NP; when the sugar polymer is glucose, the anti-tumor drug is AMG510, and the drug for treating cancer is AMG510, the sugar polymer nanoparticles formed are AMG510@G-NP.

[0013] In a second aspect, the present invention provides a pharmaceutical composition comprising the saccharide polymer nanoparticles as described in the first aspect.

[0014] Furthermore, the sugar polymer is selected from mannose and / or glucose; preferably mannose.

[0015] Furthermore, the anti-tumor drug is selected from one or more of AMG510, MRTX849 and / or ARS1620; preferably AMG510.

[0016] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable salt or ester.

[0017] Furthermore, the pharmaceutical salts include but are not limited to pharmaceutically acceptable salts such as acetate and hydrochloride.

[0018] Furthermore, the pharmaceutically acceptable esters include but are not limited to decanoate.

[0019] Furthermore, one or more pharmaceutically acceptable carriers or excipients may be added to the pharmaceutical composition.

[0020] Furthermore, the pharmaceutical composition can be prepared into various forms such as injection, tablet, powder, granule, capsule, oral solution, injection preparation or aerosol; the above various dosage forms of drugs can be prepared according to conventional methods in the pharmaceutical field.

[0021] Furthermore, the preparation can be one or more of a conventional preparation, a sustained-release preparation, a controlled-release preparation and / or various microparticle delivery systems.

[0022] Furthermore, the tablets may widely use various carriers known in the art, including one or more of diluents and absorbents, wetting agents and binders, disintegrants, disintegration inhibitors, absorption promoters and / or lubricants.

[0023] Furthermore, the diluent and absorbent include, but are not limited to, one or more of starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose and / or aluminum silicate.

[0024] Furthermore, the wetting agent and adhesive include, but are not limited to, one or more of water, glycerol, polyethylene glycol, ethanol, propanol, starch slurry, dextrin, syrup, honey, glucose solution, acacia gum slurry, gelatin slurry, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate and / or polyvinyl pyrrolidone.

[0025] Furthermore, the disintegrant includes, but is not limited to, one or more of dry starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid ester, sodium dodecyl sulfate, methyl cellulose and / or ethyl cellulose.

[0026] Furthermore, the disintegration inhibitor includes but is not limited to sucrose, tristearin, cocoa butter and / or hydrogenated oil.

[0027] Furthermore, the absorption enhancer includes but is not limited to one or more of quaternary ammonium salts and / or sodium lauryl sulfate.

[0028] Furthermore, the lubricant includes, but is not limited to, one or more of talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin and / or polyethylene glycol.

[0029] Furthermore, the tablets can be further made into coated tablets, including sugar-coated tablets, film-coated tablets, enteric-coated tablets, double-layer tablets and multi-layer tablets.

[0030] Furthermore, the injectable preparation includes, but is not limited to, one or more of a solution, an emulsion, a lyophilized powder injection and / or a suspension.

[0031] Furthermore, the injectable preparation may use all diluents commonly used in the art, including but not limited to one or more of water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxygenated isostearyl alcohol and / or polyoxyethylene sorbitan fatty acid esters.

[0032] Furthermore, in order to prepare an isotonic injection solution, the injection preparation may be added with an appropriate amount of one or more of sodium chloride, glucose, glycerol, conventional cosolvents, buffers and / or pH regulators.

[0033] Furthermore, the various preparations may also add colorants, preservatives, spices, flavoring agents, sweeteners or other materials to the pharmaceutical preparations as needed.

[0034] Furthermore, the pharmaceutical composition can be introduced into the body by physical or chemical methods, such as intramuscularly, intradermally, subcutaneously or intravenously.

[0035] In a third aspect, the present invention provides a use of the saccharide polymer nanoparticles according to the first aspect or the pharmaceutical composition according to the second aspect in the preparation of an anti-tumor drug, wherein the use comprises at least one of the following effects:

[0036] (1) Reprogramming the tumor microenvironment;

[0037] (2) Increase drug penetration into tumors;

[0038] (3) Treatment of cancer.

[0039] Furthermore, the anti-tumor drug is selected from one or more of AMG510, MRTX849 and / or ARS1620; preferably AMG510.

[0040] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable salt or ester.

[0041] Furthermore, the pharmaceutical salts include but are not limited to pharmaceutically acceptable salts such as acetate and hydrochloride.

[0042] Furthermore, the pharmaceutically acceptable esters include but are not limited to decanoate.

[0043] Furthermore, one or more pharmaceutically acceptable carriers or excipients may be added to the pharmaceutical composition.

[0044] Furthermore, the pharmaceutical composition can be prepared into various forms such as injection, tablet, powder, granule, capsule, oral solution, injection preparation or aerosol; the above various dosage forms of drugs can be prepared according to conventional methods in the pharmaceutical field.

[0045] Furthermore, the preparation can be one or more of a conventional preparation, a sustained-release preparation, a controlled-release preparation and / or various microparticle delivery systems.

[0046] Furthermore, the tablets may widely use various carriers known in the art, including one or more of diluents and absorbents, wetting agents and binders, disintegrants, disintegration inhibitors, absorption promoters and / or lubricants.

[0047] Furthermore, the diluent and absorbent include, but are not limited to, one or more of starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose and / or aluminum silicate.

[0048] Furthermore, the wetting agent and adhesive include, but are not limited to, one or more of water, glycerol, polyethylene glycol, ethanol, propanol, starch slurry, dextrin, syrup, honey, glucose solution, acacia gum slurry, gelatin slurry, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate and / or polyvinyl pyrrolidone.

[0049] Furthermore, the disintegrant includes, but is not limited to, one or more of dry starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid ester, sodium dodecyl sulfate, methyl cellulose and / or ethyl cellulose.

[0050] Furthermore, the disintegration inhibitor includes but is not limited to sucrose, tristearin, cocoa butter and / or hydrogenated oil.

[0051] Furthermore, the absorption enhancer includes but is not limited to one or more of quaternary ammonium salts and / or sodium lauryl sulfate.

[0052] Furthermore, the lubricant includes, but is not limited to, one or more of talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin and / or polyethylene glycol.

[0053] Furthermore, the tablets can be further made into coated tablets, including sugar-coated tablets, film-coated tablets, enteric-coated tablets, double-layer tablets and multi-layer tablets.

[0054] Furthermore, the injectable preparation includes, but is not limited to, one or more of a solution, an emulsion, a lyophilized powder injection and / or a suspension.

[0055] Furthermore, the injectable preparation may use all diluents commonly used in the art, including but not limited to one or more of water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxygenated isostearyl alcohol and / or polyoxyethylene sorbitan fatty acid esters.

[0056] Furthermore, in order to prepare an isotonic injection solution, the injection preparation may be added with an appropriate amount of one or more of sodium chloride, glucose, glycerol, conventional cosolvents, buffers and / or pH regulators.

[0057] Furthermore, the various preparations may also add colorants, preservatives, spices, flavoring agents, sweeteners or other materials to the pharmaceutical preparations as needed.

[0058] Furthermore, the pharmaceutical composition can be introduced into the body by physical or chemical methods, such as intramuscularly, intradermally, subcutaneously or intravenously.

[0059] Beneficial Effects

[0060] The present invention encapsulates the anticancer drug AMG510 in mannose, which can reprogram the tumor microenvironment and increase the drug's penetration into the tumor. The synthesized sugar polymer nanoparticles AMG510@M-NP are hydrophilic and easily absorbed in the body. Under the theoretical dosage, the actual dosage of the drug is reduced, further reducing the adverse drug reactions. Mannose and AMG510 play a synergistic role, and the anticancer effect is improved. In addition, the raw material mannose is easy to obtain, the preparation process is simple, the cost is reduced, and it is suitable for mass production. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 This is the H NMR spectrum of 2′-bromoethylmannose.

[0062] Figure 2 This is the H NMR spectrum of 2′-bromoethylglucose.

[0063] Figure 3 This is the H NMR spectrum of 2′-aminoethylmannose.

[0064] Figure 4 This is the H NMR spectrum of 2′-aminoethylglucose.

[0065] Figure 5 This is the GPC curve of PtBMA tested with tetrahydrofuran as the mobile phase.

[0066] Figure 6 This is the hydrogen NMR spectrum analysis of PtBMA and PMAA.

[0067] Figure 7 For PMAA in d 6 - in DMSO 1 H NMR spectrum.

[0068] Figure 8 For PMan 6 - in DMSO 1 HNMR spectrum.

[0069] Fig. 9 For PGlc in d 6 - in DMSO 1 H NMR spectrum.

[0070] Fig.10 The particle size and morphology of AMG510@M-NP and AMG510@G-NP nanoparticles after encapsulating AMG510.

[0071] Fig.11 Tumor invasion ability.

[0072] Note: (A) Immunofluorescence co-localization entity map, green-phalloidin cytoskeleton, blue-AMG510 drug; (B) Immunofluorescence co-localization statistical map, *** indicates p value <0.0001.

[0073] Fig.12 Sugar nanoparticles further kill tumors through the immune system.

[0074] Note: (A) Schematic diagram of nude mouse tumor-bearing and treatment; (B) Solid image and statistical graph of mouse tumor, * indicates p value < 0.05; (C) Schematic diagram of Balbc mouse tumor-bearing and treatment; (D) Solid image and statistical graph of mouse tumor, * indicates p value < 0.05. DETAILED DESCRIPTION

[0075] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0076] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0077] Explanation of terms

[0078] Mouse tumor-bearing: refers to the process of transplanting tumor cells into mice to form tumor tissue in the mice. This experimental method is widely used in tumor research to evaluate the proliferation ability of tumor cells, drug efficacy, and immune system response. Tumor-bearing operation: Inject the treated tumor cell suspension into the subcutaneous or other parts of the mouse. Commonly used inoculation sites include the flank, armpit, or back. Before inoculation, the injection site needs to be disinfected with an alcohol cotton ball, and the tumor cell suspension should be injected slowly to prevent leakage or excessive injection leading to cell overflow.

[0079] AMG510, also known as Sotorasib, is a targeted drug targeting the KRAS G12C mutation and is mainly used to treat patients with non-small cell lung cancer (NSCLC) and colorectal cancer (CRC) with the KRAS G12C mutation.

[0080] SW1463: A cell line derived from a 66-year-old Caucasian female patient with colorectal adenocarcinoma, with epithelial morphology, isolated primarily from colon and rectal tissue. This cell line is suitable for cancer research, exhibits adherent growth, and has been tested for sterility and shown to be negative for bacteria, yeast, and mycoplasma.

[0081] SW1463: is a human rectal adenocarcinoma cell line originally isolated from the rectum of a 66-year-old Caucasian female with colorectal adenocarcinoma. This cell line exhibits an epithelial-like morphology and has the property of adherent growth. The SW1463 cell line is commonly used in cancer research, especially in the study of radioresistance and tumor repopulation in colorectal cancer.

[0082] CT26 -KRASG12C Tumor cells: A model cell line generated by introducing KRASG12C mutations into the mouse colon cancer cell line CT26 using CRISPR / Cas9 technology. This mutation causes the KRAS protein to remain activated, thereby promoting the proliferation and survival of tumor cells. Studies have shown that AMG510 (a KRASG12C inhibitor) can significantly inhibit the growth of these tumor cells, and when AMG510 and anti-PD-1 immunotherapy are used in combination, the anti-tumor effect can be further enhanced, and even complete tumor regression can be achieved in some mice.

[0083] BALB / c mice: an inbred mouse strain widely used in scientific research, its origin can be traced back to 1913, when Dr. HJ Bagg purchased white mice from Ohio, USA, and conducted isolated breeding and behavioral studies. In 1923, E. Carleton MacDowell obtained these mice from Bagg and began inbreeding, and in 1932, the 26th generation was named BALB / c. BALB / c mice are commonly used in immunology, oncology, physiology, nuclear medicine research, and monoclonal antibody preparation.

[0084] Experimental Materials

[0085] CPDB: 2-cyano-2-propylbenzodisulfide.

[0086] tBMA: tert-butyl methacrylate.

[0087] AIBN: azobisisobutyronitrile.

[0088] TFA: trifluoroacetic acid.

[0089] Palladium / Carbon: 10% palladium, 55% water.

[0090] TA: tyramine hydrochloride.

[0091] EDC: ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.

[0092] NHS: N-hydroxysuccinimide.

[0093] SW837 cell line was purchased from the official website of the Chinese Academy of Sciences.

[0094] SW1463 cell line was purchased from the official website of the Chinese Academy of Sciences.

[0095] CT26 -KRASG12C Tumor cells, CT26.WT were purchased from the official website of the Chinese Academy of Sciences, and then CRISPR-Cas9 gene editing was performed to mutate KRAS G12V to KRAS G12C.

[0096] Balb / c mice and athymic nude mice aged 4-6 weeks were fed adaptively for one week before the experiment.

[0097] Example 1 Amino-modified mannose and glucose

[0098] The synthetic route of amino-modified mannose and glucose includes the following steps:

[0099]

[0100] A. Synthesis of 2′-bromoethyl sugar

[0101] (1) Mannose or glucose (3.0 g, 16.7 mmol) and H 2 SO 4 -silica (120 mg) mixed;

[0102] (2) Add 2-bromoethanol (15 mL) to the system of (1);

[0103] (3) passing argon gas into the mixed solution of (2) and stirring at 60° C.;

[0104] (4) purifying the product of (3) by silica gel column chromatography;

[0105] The excess 2-bromoethanol was washed off with DCM, and then eluted through the column with DCM:MeOH (v / v=5:1) to obtain pure 2'-bromoethyl-mannose or glucose product 2'-bromoethyl sugar (such as Figure 1 and Figure 2 shown).

[0106] B. Synthesis of 2′-azidoethyl sugar

[0107] (1) Dissolve 2′-bromoethyl sugar (2 g, 7.0 mmol) in DMF and add sodium azide (0.91 g 14 mmol);

[0108] (2) stirring the system in (1) at 80° C. overnight to obtain the product;

[0109] (3) The product in (2) is filtered and dried to obtain 2′-azidoethyl sugar.

[0110] C. Synthesis of 2′-aminoethyl sugars

[0111] (1) dissolving the 2′-azidoethyl sugar obtained in B in anhydrous methanol and adding palladium-carbon catalyst;

[0112] (2) by replacing the gas multiple times so that the reaction atmosphere in (1) is hydrogen;

[0113] (3) TLC detection of raw materials to confirm the completion of the reaction;

[0114] (4) adjusting the pH of the mixture to neutral using an ion exchange resin;

[0115] (5) Filter to remove impurities, and spin-dry the filtrate to obtain 2′-aminoethyl sugar.

[0116] like Figure 3 As shown, it is the H NMR spectrum of 2′-aminoethylmannose; Figure 4 Shown is the H NMR spectrum of 2′-aminoethylglucose.

[0117] Example 2 Synthesis of Sugar Polymers

[0118] Synthesis route of sugar polymer: The polymerization part adopts reversible addition-fragmentation chain transfer polymerization method, and then sugar and tyramine are modified to the polymer backbone by post-grafting method. First, poly tert-butyl methacrylate (PtBMA) is prepared, and then the tert-butyl ester protecting group in PIBMA is hydrolyzed with trifluoroacetic acid (TFA) to obtain poly methacrylic acid (PMAA).

[0119] The synthetic route for preparing manno / glucose polymers by RAFT polymerization includes the following steps:

[0120]

[0121] A. Synthesis of PtBMA

[0122] (1) Commercial RAFT chain transfer agent 2-cyano-2-propylbenzodisulfide CPDB (0.220 g, 0.001 mol) and monomer

[0123] tBMA (20.406 g, 143.50 mmol) and initiator AIBN (0.041 g, 0.25 mmol) were dissolved in a polymerization bottle;

[0124] (2) subjecting the dissolved system of (1) to a freeze-deoxygenation-thaw operation, sealing the system after the cycle, and conducting a polymerization reaction;

[0125] (3) After the reaction in (2) is complete and the reaction is quenched with liquid nitrogen, the mixture is precipitated into pre-cooled water / methanol (3 / 1, v / v);

[0126] (4) Repeat the precipitation operation, collect the filter cake by filtration, and vacuum dry to obtain a light pink solid, which is PtBMA.

[0127] like Figure 5 As shown, the GPC curve of PtBMA was tested with tetrahydrofuran as the mobile phase. The GPC analysis results of the product PtBMA were: Mn was 12.1 kg / mol, and the molecular weight distribution polydispersity index (Mw / Mn, M / M) was 1.14.

[0128] B. Synthesis of PMAA

[0129] (1) Weigh the PtBMA prepared in step A and dissolve it in DCM;

[0130] (2) adding TFA to the solution in (1) to carry out reaction;

[0131] (3) After the reaction in (2) is complete, the reaction solution is concentrated under reduced pressure, and the product is transferred to a dialysis bag and dialyzed in deionized water;

[0132] (4) After dialysis in (3) is completed, freeze-drying is performed to obtain the product PMAA.

[0133] like Figure 6 and Figure 7 As shown, CDCl 3 PtBMA and d 6 -PMAA in DMSO 1 H NMR spectrum shows that the proton signal of tert-butyl disappears after hydrolysis, proving that the hydrolysis is complete. H NMR spectrum analysis shows that TFA completely hydrolyzes the tert-butyl group.

[0134] Synthesis of C.PMan

[0135] (1) Weigh the PMAA prepared in step B and mix it with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC)

[0136] and N-hydroxysuccinimide (NHS) were dissolved in DMF and reacted;

[0137] (2) adding aminated sugar (Saccharide-NH2) and tyramine hydrochloride (TA) to the system of (1), and continuing the reaction to obtain the product;

[0138] (3) transferring the product in (2) into a dialysis bag and dialyzing it against deionized water;

[0139] (4) After the dialysis in (3) is completed, the sample is freeze-dried and the sugar polymers prepared using mannose and glucose are named

[0140] PMan and PGlc.

[0141] like Figure 8 and Fig. 9 As shown, the glycopolymers prepared using mannose and glucose were named PMan and PGlc, respectively; through nuclear magnetic resonance hydrogen spectrum analysis, the carboxyl group in PMAA was completely reacted, and the modification ratio of sugar to tyramine in the obtained glycopolymer was approximately 4 / 1.

[0142] Example 3 Formation of Sugar Nanoparticles Encapsulating AMG510

[0143] The nanoparticles are obtained by nanoprecipitation method, which includes the following steps:

[0144] The sugar polymer and AMG510 were dissolved in DMSO and then added to water. Due to the hydrophobicity of AMG510, it was encapsulated within the core of the nanoparticles.

[0145] Mannose polymer and AMG510 were dissolved in DMSO and then added into water together to form mannose polymer nanoparticles AMG510@M-NP.

[0146] Glucose polymer and AMG510 were dissolved in DMSO and then added into water together to form glucose polymer nanoparticles AMG510@G-NPs.

[0147] like Fig.10 As shown, the particle size of the two nanoparticles after encapsulating AMG510 was characterized by dynamic light scattering test; the particle size range is 80nm-100nm; the drug particles have a small particle size, are easy to swallow, and have good patient compliance.

[0148] Example 4 Drug Loading

[0149] A. Preparation of AMG510-loaded Glycopolymer Nanoparticles by Solvent Replacement Method

[0150] The glycopolymer nanoparticles loaded with AMG510 were prepared by solvent replacement method. Taking AMG510@M-NP as an example, the preparation method includes the following steps:

[0151] (1) Dissolve PMan and AMG510 in DMSO (PMan 20 mg / mL);

[0152] (2) After the solution in (1) is mixed evenly, it is added dropwise into deionized water and placed into a dialysis bag;

[0153] (3) dialyze in deionized water in the dark, changing the dialysis medium every 4 hours;

[0154] (4) After dialysis, the nanoparticles loaded with AMG510 were freeze-dried.

[0155] B. Determination of drug loading

[0156] In order to determine the drug loading of the nanoparticles, the nanoparticles were destroyed with DMSO. The specific method included the following steps:

[0157] (1) Destroy the nanoparticles with DMSO and extract AMG510;

[0158] (2) using a fluorescence spectrophotometer to measure the fluorescence intensity of AMG510;

[0159] (3) The drug concentration was calculated using the standard curve.

[0160] The drug loading and encapsulation efficiency were calculated by the following formula:

[0161] Drug loading (wt.%) = (loaded drug weight / (polymer weight + loaded drug weight)) × 100;

[0162] Encapsulation efficiency (%) = (loaded drug weight / total drug input) × 100.

[0163] C. Test Results

[0164] The drug loading of AMG510@M-NP was 10.3%, and the encapsulation efficiency was 76.4%; the drug loading of AMG510@G-NP was 10.0%, and the encapsulation efficiency was 73.9%.

[0165] D.Comparison with finished drugs

[0166] (1) AMG510 commonly seen on the market:

[0167] The specification of the version of Sotolacib produced by Lucius Pharmaceuticals is 120mg*56 tablets. For example, when the theoretical dosage is 96mg / day, the actual dosage is: 960mg per day.

[0168] Without sugar polymer nanocarriers to encapsulate AMG510, its absorption effect is poor, and an excess amount of the drug needs to be taken to achieve the desired effect. That is, the actual amount of the drug taken into the body is 960 mg. A large amount of the drug is not absorbed, resulting in waste, and it accumulates in the body, causing more adverse reactions.

[0169] (2) AMG510@M-NP of this application:

[0170] The drug loading of this nanodrug is about 10%. For example, when the theoretical dosage is 96 mg / day, 960 mg of AMG510@M-NP is actually required to be taken orally, and the actual drug content taken into the body is 96 mg. After the material is loaded with AMG510 drug, its hydrophilicity is improved, the absorption capacity is improved, waste is reduced, and the risk of adverse drug reactions is reduced.

[0171] The specific dosage is based on the clinician's opinion and can be adjusted flexibly. When the dosage is small, the conditions are still met, and the required dosage can be reduced by reducing the drug loading in actual application.

[0172] In addition, mannose itself plays an important role in the energy metabolism and biosynthesis of tumor cells and has the effect of inhibiting the growth of malignant tumors. In the synthesized AMG510@M-NP, mannose and AMG510 play a synergistic role, and the anti-cancer effect is improved.

[0173] Example 5 Cell Infiltration Ability

[0174] A. Immunofluorescence colocalization

[0175] (1) SW837 and SW1463 cell lines grown to the logarithmic phase were inoculated into a cell culture dish;

[0176] (2) For the two cell lines in (1), 0.1 μM AMG510, AMG510@M-NP or

[0177] AMG510@G-NP, for incubation;

[0178] (3) Fix the cells with paraformaldehyde and use an immunohistochemistry pen to draw circles around the area where the cells are evenly distributed;

[0179] (4) Add 50-100 μL of membrane permeabilization solution to the system in (3) and incubate;

[0180] (5) Washing the slides;

[0181] (6) Add the diluted Phalloidin solution to the marked area in (3) and incubate in a dark room;

[0182] (7) After washing and drying, use anti-fading sealing liquid to seal the slides;

[0183] (8) Fluorescence images were taken using a confocal microscope.

[0184] B. Test Results

[0185] Fluorescence images were taken, wherein the excitation wavelength of AMG510 was 370-400 nm, and the excitation wavelength of Phalloidin was 465-495 nm.

[0186] like Fig.11 As shown in Figure 2, the number of encapsulated drugs entering tumor cells increases. Fig.11 As shown in A, green represents the cytoskeleton and blue represents the AMG510 drug. Fig.11The statistical graph in B shows that the number of AMG510@M-NP entering tumor cells is significantly greater than that of AMG510 alone.

[0187] Example 6 Tumor Killing Ability

[0188] A. Tumor Cell Modification

[0189] The guide RNA (sgRNA) targeting site for the KRAS G12C mutation was selected by using the guide RNA prediction tool provided by Professor Feng Zhang's laboratory website (http: / / crispr.mit.edu).

[0190] The sgRNA sequence selected for targeting the KRAS G12C locus is:

[0191] GACTGAGTATAAACTTGTGA.

[0192] sgRNA oligonucleotides were synthesized, cloned and introduced into the lenti-CRISPR-V2 vector. A single-stranded oligodeoxynucleotide (ssODN) was designed as a homology donor to repair the sgRNA cleavage site. This ssODN introduced a cysteine ​​codon at position 12 (GAT: aspartate to TGT: cysteine) and added a silent mutation to prevent further cleavage.

[0193] Among them, the ssODN sequence is:

[0194] ATGTTCTAATTTAGTTGTATTTTATTATTTTTATTGTAAGGCCTGCTGAAAATGACTGAGT

[0195] ATAAATTAGTCATGGTTGGAGCTTGTGGCGTAGGCAAGAGCGCCTTGACGATACAGCT AATTCAGAATCACTTTGTGGATGAGTACGACCCTACGATAGAGGTAACGCT.

[0196] After subculturing, CT26 cells in the logarithmic growth phase were cultured at 1×10 6 The density of cells / well was seeded in the well plate;

[0197] Transfection was performed using lenti-CRISPR-V2 vector and ssODN;

[0198] After transfection, cells were subjected to initial puromycin selection;

[0199] After puromycin selection, cells were subjected to limiting dilution, and approximately 50–100 cells were seeded into well plates;

[0200] Isolation of KRAS knock-in clones;

[0201] The amplified KRAS KI clone was used to detect the KRAS G12C mutation.

[0202] Genomic DNA was extracted from the screened clones and PCR amplified the G12C mutation site using the designed primers. The PCR primers used were:

[0203] Forward primer—GTGTGTCCACAGGGTATAGCGTACT;

[0204] Reverse primer—CACCTATGGTTCCCTAACACCCAG.

[0205] Isolate high molecular weight genomic DNA from mouse tumor tissues and extract them. Evaluate the quality of the DNA and select samples with a score of A or B+ for further sequencing.

[0206] B. Test Methods

[0207] (1) CT26 -KRASG12C Tumor cells were inoculated into 1640 medium containing 10% serum and cultured until the cell confluence reached 70-80%;

[0208] (2) centrifuging the cells in (1) and collecting the tumor cells;

[0209] (3) The tumor cells collected in (2) were resuspended in PBS, centrifuged again, and the tumor cells were collected, and the process was repeated; (4) The tumor cells collected in (3) were resuspended in PBS, counted, and the concentration was adjusted to 5×10 6 cells / mL; (5) Balb / c mice and athymic nude mice aged 4-6 weeks were shaved and disinfected, and injected subcutaneously in the left inguinal region (4)

[0210] The number of cells injected was 1×10 6 The injection volume was 200 μL;

[0211] (6) From the 15th day after inoculation, the mice in (5) were divided into four groups and orally administered with saline, AMG510 (M-NP) and

[0212] or glucose nanoparticles (G-NPs) at a dose of 30 mg / kg;

[0213] (7) Tumor measurements were performed every 3 days using a vernier caliper to measure the length and width of the tumor and using the formula: (length x width) 2 / 2

[0214] To calculate tumor volume.

[0215] C. Test Results

[0216] Two types of mice were subcutaneously tumor-bearing and treated with three treatment methods (as shown in Table 1), and the control group was orally administered with normal saline.

[0217] The killing effect of mannose- and glucose-coated AMG510 (AMG510@M-NP and AMG510@G-NP, respectively) was significantly better than that of AMG510 alone ( Fig.12 AB), which shows that in mice, the AMG510 encapsulated by nanomaterials also has better tumor infiltration ability and better kills tumors. However, there is no significant difference between the two nanomaterial-encapsulated AMG510.

[0218] In immune-normal Balbc mice, the effect of AMG510@M-NP was significantly stronger than that of AMG510@G-NP ( Fig.12 CD). This result shows that AMG510@M-NP can activate the immune system to further kill tumor cells.

[0219] Table 1. Tumor killing ability of treatment groups

[0220]

[0221]

Claims

1. A sugar polymer nanoparticle, wherein the structural formula of the sugar polymer nanoparticle is M@S-NP; wherein: M is an anti-tumor drug, and S-NP is a sugar polymer; the anti-tumor drug is wrapped inside the sugar polymer to form sugar polymer nanoparticles.

2. A pharmaceutical composition comprising the saccharide polymer nanoparticles according to claim 1.

3. The pharmaceutical composition according to claim 2, further comprising a pharmaceutically acceptable salt or ester; the pharmaceutically acceptable salts include but are not limited to pharmaceutically acceptable salts such as acetate and hydrochloride; the pharmaceutically acceptable esters include but are not limited to decanoate.

4. Use of the glycopolymer nanoparticles according to claim 1 or the pharmaceutical composition according to claim 2 in the preparation of an anti-tumor drug, wherein the use comprises at least one of the following effects: (1) Reprogramming the tumor microenvironment; (2) Increase drug penetration into tumors; (3) Treatment of cancer.

5. The sugar polymer nanoparticle according to any one of claims 1 to 4, wherein the sugar polymer is selected from mannose and / or glucose; Mannose is preferred.

6. The glycopolymer nanoparticles according to any one of claims 1 to 4, wherein the anti-tumor drug is selected from one or more of AMG510, MRTX849 and / or ARS1620; preferably AMG510.

7. The pharmaceutical composition according to any one of claims 2 to 4, further comprising one or more pharmaceutically acceptable carriers or excipients.

8. The pharmaceutical composition according to any one of claims 2 to 4, which can be prepared in various forms such as injection, tablets, powders, granules, capsules, oral solutions, injection preparations or aerosols; the above-mentioned various dosage forms of drugs can be prepared according to conventional methods in the pharmaceutical field.

9. The pharmaceutical composition according to any one of claims 2 to 4, wherein the preparation can be one or more of a conventional preparation, a sustained-release preparation, a controlled-release preparation and / or various microparticle delivery systems.

10. The pharmaceutical composition according to any one of claims 2 to 4, which can be introduced into the body by physical or chemical methods, such as intramuscularly, intradermally, subcutaneously or intravenously.

Images