Chimeric antigen receptor for cis-platinum drug-resistant non-small cell lung cancer

Abstract

The invention discloses a chimeric antigen receptor aiming at cis-platinum drug-resistant non-small cell lung cancer, which comprises a single-chain antibody fragment targeting a non-small cell lung cancer epidermal growth factor receptor, and the nucleotide sequence of the single-chain antibody fragment is shown as a sequence 1; a CD3z signal transduction region; a CD28 costimulatory region; and the nucleotide sequence of the chemokine receptor CCR5 fragment is shown as a sequence 2. The CAR disclosed by the invention can be beneficial to the distribution of CAR-T cells in tumor tissues, enhances the killing effect on drug-resistant non-small cell solid tumor clone strains, is expected to provide a more effective treatment scheme for cis-platinum drug-resistant NSCLC patients clinically, and has important clinical application prospects and transformation values.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a chimeric antigen receptor targeting cisplatin-resistant non-small cell lung cancer. Background Art

[0002] Lung cancer is the leading cause of cancer-related deaths worldwide. About 85% of lung cancers are non-small cell lung cancer (NSCLC). Cisplatin (CDDP) is a chemotherapy drug commonly used to treat various types of tumors. It is widely used in the first-line treatment of various cancers, including NSCLC, ovarian cancer, testicular cancer, head and neck squamous cell carcinoma, etc. CDDP belongs to the platinum chemotherapy drugs. Its mechanism of action is to bind to DNA, interfere with DNA replication and transcription, and cause tumor cell death. Although CDDP can achieve significant therapeutic effects in the early stages of various cancer treatments, similar to other chemical drugs or small molecule drugs, the therapeutic effect will gradually be limited by drug pressure-induced drug resistance or multidrug resistance (such as resistance to carboplatin or oxaliplatin). Resistant tumors urgently need to find new treatment options. At present, the main way to overcome drug resistance is through combination therapy (such as combination with other mechanism chemotherapy drugs, targeted drugs or immunotherapy).

[0003] The development of CDDP resistance is related to a variety of molecular mechanisms. Studies have found that chemokines and their receptors play an important role in tumor cell progression. The expression of certain chemokines will recruit regulatory T cells (Treg) to form an immunosuppressive environment that is conducive to tumor proliferation. Chemokines are a class of small molecule signaling molecules that are involved in regulating the chemotaxis, migration, and localization of immune cells. We found that the expression level of chemokine ligands is closely related to CDDP resistance. At present, high expression of CCL5 has been found in CDDP-resistant NSCLC cell lines. The chemotactic effect of the CCL5-CCR5 signaling axis on Treg is used. Since cyclophosphamide and fludarabine are used to clear lymphocytes before immune cell transfusion to reduce the effect of Treg on transfused CAR-T cells, we try to insert CCR5 into the chimeric antigen receptor (CAR) to observe whether CAR-T may be recruited to tumor tissue more.

[0004] In the experiment, it was found that inserting its CCR5 receptor into the CAR fragment can help control the tumor volume of cisplatin-resistant strains, and higher copies of the CAR fragment can be obtained in the tumor. This experimental result suggests that although CDDP-resistant NSCLC expresses higher chemokine ligand CCL5, it forms an immunosuppressive environment by recruiting Treg. Just like the PD1-PDL1 / 2 signal, using the CCL5-CCR5 signal, integrating CCR5 into the CAR fragment through gene editing to transform CD8+ toxic T cells, increasing the enrichment of CAR-T in the tumor, can improve the cell's killing effect on the tumor. At present, chemotherapy drugs are still the first-line treatment for many tumors. Combined with surgery and radiotherapy, they can effectively control tumor burden, but after the drug becomes resistant, it will enter the second and third line of therapy, including antibody therapy and immunotherapy. Immunotherapy is becoming an effective treatment for tumors by modifying T cell functions. For example, immune checkpoint therapy has effectively improved the survival of T cells in tumor tissues in the past two decades. In particular, the great success of CAR-T cell therapy in hematological tumors is a milestone in cell immunotherapy; however, the potential of CAR-T therapy in solid tumors needs to be further explored. The development of this invention is to deal with cisplatin resistance, based on immune cell therapy. Summary of the invention

[0005] The purpose of the present invention is to provide a chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer to solve the problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] A chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer, comprising:

[0008] A single-chain antibody fragment targeting epidermal growth factor receptor of non-small cell lung cancer, the nucleotide sequence of which is shown in sequence 1;

[0009] CD3z signaling region;

[0010] CD28 co-stimulatory region;

[0011] The nucleotide sequence of the chemokine receptor CCR5 fragment is shown in SEQ ID NO:2.

[0012] A nucleic acid molecule encoding the chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer.

[0013] An expression vector comprises the above nucleic acid molecule.

[0014] A host cell comprises the above expression vector, or the above nucleic acid molecule is integrated into its genome.

[0015] A method for preparing chimeric antigen receptor T cells against cisplatin-resistant non-small cell lung cancer comprises the following steps:

[0016] CD3+T cells were isolated from human peripheral blood mononuclear cells;

[0017] The CD3+T cells are transfected with a lentiviral vector containing the chimeric antigen receptor encoding gene to obtain the CAR-T cells.

[0018] The chimeric antigen receptor T cells against cisplatin-resistant non-small cell lung cancer are prepared by the above method.

[0019] The use of the chimeric antigen receptor T cells for cisplatin-resistant non-small cell lung cancer in the preparation of a drug for treating cisplatin-resistant non-small cell lung cancer.

[0020] A pharmaceutical composition for treating cisplatin-resistant non-small cell lung cancer comprises the above-mentioned chimeric antigen receptor T cells for cisplatin-resistant non-small cell lung cancer and a pharmaceutically acceptable carrier.

[0021] A primer pair for amplifying the nucleic acid molecule encoding the chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer, wherein the nucleotide sequence of the forward primer is shown in Sequence 3, and the nucleotide sequence of the reverse primer is shown in Sequence 4.

[0022] A kit for detecting the expression of the chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer, comprising an antibody or a nucleic acid probe that can specifically recognize the CAR.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The CAR of the present invention can facilitate the distribution of CAR-T cells in tumor tissues and enhance the killing effect on drug-resistant non-small cell solid tumor clones. It is expected to provide a more effective treatment plan for cisplatin-resistant NSCLC patients in clinical practice, and has important clinical application prospects and transformation value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a schematic diagram of the CDDP drug sensitivity experiment of the present invention;

[0026] Figure 2 This is a schematic diagram of the transcription of CCL5 in tumor resistant strains of the present invention;

[0027] Figure 3 This is a schematic diagram of the process of the CDDP-resistant EGFRCART cell plasmid of the present invention;

[0028] Figure 4 This is a tumor inhibition curve diagram of the CDDP resistance of the CAR-T with CCR5 fragment of the present invention;

[0029] Figure 5 This is a schematic diagram of the intratumoral enrichment of the CAR fragment of the present invention. DETAILED DESCRIPTION

[0030] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] Example 1: Construction of non-small cell lung cancer cell H460 and A549CDDP resistant clones and detection of CCL5 transcription level

[0032] 1.1 Construction of CDDP-resistant strains of H460 and A549

[0033] CDDP-resistant non-small cell lung cancer cell lines H460 and A549 were treated with CDDP 1 μM for 6 months and 5 μM for 12 months. In addition, specific drug sensitivity experiments such as Figure 1 The results showed that compared with the clones derived from the wild strain, the sensitivity of the resistant clones to CDDP was greatly reduced.

[0034] 1.2 Detection of CCL5 transcription level in drug-resistant tumor strains

[0035] According to Example 1, mRNA of each clone was extracted and reverse transcribed into cDNA. Figure 2 The primer sequences shown were used to detect the expression levels of chemokine ligands by fluorescence quantitative PCR. The results showed that the expression level of CDDP-resistant clone CCL5 was significantly increased compared with the wild-type clone.

[0036] Primer name Primer sequence (5' to 3') CCL5 forward primer TCGCTGTCATCCTCATTGCTACT CCL5 reverse primer CATCTCCAAAGAGTTGATGTACTCCCG

[0037] In this embodiment, cisplatin (CDDP) is a commonly used chemotherapy drug. When treating a variety of cancers (including non-small cell lung cancer, NSCLC), it will induce drug resistance or multidrug resistance due to drug pressure, resulting in limited treatment effects. The present invention provides a coping strategy for this problem. By adding specific fragments to the chimeric antigen receptor (CAR), new ideas and methods are provided to solve the CDDP resistance problem, which helps to overcome the treatment dilemma caused by traditional chemotherapy drug resistance. At present, CDDP resistance is mainly overcome by combined medication, but the present invention provides a way based on immune cell therapy, enriches the treatment methods, and provides more treatment options for patients with drug-resistant tumors.

[0038] Example 2: Preparation of EGFR CAR-T cells synchronously expressing chemokine receptors

[0039] 2.1 Construction of EGFR CAR plasmid

[0040] like Figure 3 As shown, the obtained EGFRscFv fragment, the specific sequence is as shown in sequence 1, and the MYC tag, EGFR-scFv, CD8a transmembrane region, CD28, and CD3z subunit are sequentially transferred into the lentiviral plasmid sequence from 5' to 3' end. The MYC tag is used to detect the positive rate. In addition, another plasmid needs to be inserted with the CCR5 receptor sequence connected with 2A, sequence 2 information.

[0041] 2.2 Lentivirus packaging and concentration

[0042] After sequencing and identification, 293T cells were first plated at 5 million / 100 mm. According to the instructions of the lentivirus packaging kit, the transfection reagent, packaging plasmid and transfer plasmid were packaged into lentivirus. After 3 days of packaging, the supernatant was collected and filtered with a 0.45 μM filter. The virus concentrate was added at a ratio of 1:3 (virus concentrate: virus supernatant). After standing overnight, it was centrifuged at 1500 g at 4 degrees for 1 hour. The lentivirus was re-dissolved with T cell complete culture medium and frozen in a -80 degree refrigerator.

[0043] 2.3 Transfected cells

[0044] Take 10 million PBMCs frozen in liquid nitrogen, loosen the bottle cap slightly, tighten it again and quickly thaw it in a 37-degree water bath, transfer the liquid to 4 ml sorting buffer, centrifuge at 350g at room temperature for 10 minutes, remove the supernatant and magnetically sort T cells according to the CD3+T cell negative selection kit, add CD3 and CD28 to 1 million sorted target cells, and after 24 hours of stimulation, add EGFR-CAR lentivirus to infect cells. The entire process of CART cell construction requires the addition of 100 IU hIL2 for amplification. After 8 days, harvest the cells and use anti-Myc antibody for flow cytometry detection. Add all CAR-positive cells to Mock T cells to adjust to 40% and freeze them in liquid nitrogen.

[0045] In this embodiment, it is found that chemokines and their receptors play an important role in the progression of tumor cells. There is high expression of CCL5 in CDDP-resistant NSCLC cell lines, which recruits regulatory T cells (Treg) to form an immunosuppressive environment. The present invention utilizes the CCL5-CCR5 signal axis and inserts a CCR5 receptor fragment into CAR, so that CAR-T cells can be more targeted and recruited into tumor tissues, accurately acting on the tumor microenvironment, and improving the specificity and effectiveness of treatment. By integrating CCR5 into the CAR fragment, transforming CD8+ toxic T cells, and increasing the enrichment of CAR-T in the tumor, it is helpful to break the immunosuppressive environment formed by tumor cells, enhance the body's immune system's ability to recognize and kill tumor cells, thereby improving the killing effect of cells on tumors.

[0046] Example 3: In vivo anti-tumor experiment and fluorescence quantitative PCR detection of intratumoral CAR sequence expression

[0047] 3.1 In vivo antitumor experiment

[0048] H460 was injected subcutaneously into nude mice at a concentration of 0.2 million / mouse and randomly divided into 3 groups. Tumors began to appear on the 6th day, with a diameter of about 2 mm. The frozen T cells were removed for tail vein injection, and 1 million CAR-positive T cells were injected into each mouse, and 2.5 million were injected into the MOCKT group to ensure that the number of T cells injected was consistent. After the T cell infusion, the tumor volume was measured with a vernier caliper every two days. The second CAR-T infusion was performed on the 12th day, and a dose of 2.5ug / mouse hIL2 was injected through the tail vein. Tumor proliferation was recorded every 2 days.

[0049] 3.2 Detection of intratumoral CAR sequence expression by fluorescence quantitative PCR

[0050] 14 days after CAR-T was infused into A549 tumor-bearing mice and 16 days after H460 tumor-bearing mice, tumor tissues of tumor-bearing mice were taken and the same volume of tumor tissues were taken with a sleeve to extract DNA. Figure 4-5 As shown, primers were designed according to the sequence information of CAR, equal amounts of DNA and other amplification buffers were added, and real-time fluorescence quantitative PCR was used for amplification to compare the difference in expression abundance between CCR5-EGFR-CAR and EGFR-CAR. The results showed that the addition of CCR5 CAR fragments was more conducive to enrichment of T cells.

[0051]

[0052]

[0053] In this implementation, it was found in the in vivo anti-tumor experiment that inserting the CCR5 receptor into the CAR fragment is beneficial to controlling the tumor volume of cisplatin-resistant strains, and higher copies of the CAR fragment can be obtained in the tumor. This shows that the present invention can enhance the killing ability of CAR-T cells against drug-resistant non-small cell solid tumor clones, and provides a new direction for the application of CAR-T cell therapy in the treatment of solid tumors. Although CAR-T cell therapy has achieved great success in hematological tumors, its potential in solid tumors needs to be further explored. By optimizing the CAR structure, the present invention provides new ideas and methods for the application of CAR-T cell therapy in the treatment of solid tumors, which helps to further explore the potential of CAR-T therapy in the treatment of solid tumors and bring more treatment hope to patients with solid tumors.

[0054] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0055] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer, characterized in that: include: A single-chain antibody fragment targeting epidermal growth factor receptor of non-small cell lung cancer, the nucleotide sequence of which is shown in sequence 1; CD3z signaling region; CD28 co-stimulatory region; The chemokine receptor CCR5 fragment, the nucleotide sequence of which is shown in SEQ ID NO:

2.

2. A nucleic acid molecule encoding the chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer according to claim 1.

3. An expression vector, characterized in that: Comprising the nucleic acid molecule of claim 2.

4. A host cell, characterized in that The invention comprises the expression vector of claim 3, or the nucleic acid molecule of claim 2 is integrated into its genome.

5. A method for preparing chimeric antigen receptor T cells against cisplatin-resistant non-small cell lung cancer, characterized in that: The following steps are involved: CD3+T cells were isolated from human peripheral blood mononuclear cells; The CD3+T cells are transfected with a lentiviral vector comprising the chimeric antigen receptor encoding gene of claim 1 to obtain the CAR-T cells.

6. Chimeric antigen receptor T cells against cisplatin-resistant non-small cell lung cancer prepared according to the method of claim 5.

7. Use of the chimeric antigen receptor T cell against cisplatin-resistant non-small cell lung cancer according to claim 6 in the preparation of a drug for treating cisplatin-resistant non-small cell lung cancer.

8. A pharmaceutical composition for treating cisplatin-resistant non-small cell lung cancer, characterized in that: It comprises the chimeric antigen receptor T cell for cisplatin-resistant non-small cell lung cancer as described in claim 6 and a pharmaceutically acceptable carrier.

9. A primer pair for amplifying a nucleic acid molecule encoding a chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer according to claim 1, characterized in that: The nucleotide sequence of the forward primer is shown in Sequence 3, and the nucleotide sequence of the reverse primer is shown in Sequence 4.

10. A kit for detecting the expression of chimeric antigen receptor for cisplatin-resistant non-small cell lung cancer according to claim 1, characterized in that: It comprises an antibody or a nucleic acid probe that can specifically recognize the chimeric antigen receptor.

Images