A core-shell microneedle patch and a portable device for rapid detection of food hazards

By combining core-shell microneedle patches with fluorescence sensing technology, the problems of accuracy and portability in food sample detection in existing technologies have been solved, enabling rapid and efficient detection of various chemical hazards in food.

CN119708655BActive Publication Date: 2025-11-21NANKAI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411668913.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-21
Publication Date
2025-11-21
Estimated Expiration
2044-11-21

AI Technical Summary

Technical Problem

Existing rapid detection technologies have low tolerance for chemical hazards in food, poor stability, and insufficient scalability, failing to meet diverse on-site testing needs, especially for multi-target detection in different sample matrices.

Method used

A core-shell microneedle patch is used, with an inner microneedle patch modified with a fluorescent probe and an outer HAMA

Benefits of technology

It enables rapid removal of impurities from food samples, improves detection accuracy and portability, and can perform sensitive and accurate qualitative and quantitative detection of 10 chemical hazards within 20 minutes, simplifying sample pretreatment steps.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119708655B_ABST
    Figure CN119708655B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of core-shell microneedle patch and food hazard fast detection portable device, core-shell microneedle patch includes inner layer microneedle patch and outer layer composite hydrogel shell, inner layer microneedle is modified with fluorescent probe, can be used to detect the hazard in sample to be measured, outer layer composite hydrogel shell can quickly absorb the grease, pigment and organic acid impurities in sample, remove most types of impurities in food sample, so as to ensure the accuracy of hazard detection;Microneedle patch after processing in sample to be measured can be checked by the fluorescence intensity of food hazard fast detection portable device, to determine whether the sample to be measured contains hazard, and the content of hazard.Based on the food hazard on-site rapid detection portable device of microneedle sensing realizes the integration of sample pretreatment, hazard detection, data collection and analysis;Realize the rapid, sensitive, accurate detection of hazard.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of food safety testing, and in particular relates to a core-shell microneedle patch and a portable device for rapid detection of food hazards. Background Technology

[0002] Food contamination causes more than 200 diseases, resulting in illness and death for millions worldwide. Most health problems stem from natural toxins and environmental pollutants, including heavy metals, natural toxins, pesticide and veterinary drug residues, as well as food additives and food allergens, which can lead to acute poisoning or long-term illness. To ensure food safety, it is necessary to develop rapid, convenient, accurate, and sensitive analytical techniques for timely and comprehensive detection of chemical hazards in the food supply. Current rapid detection technologies include paper-based smart sensors, microfluidic immunosensors integrating machine learning, and electrochemical-based wireless sensors, enabling rapid detection of food hazards. However, these methods suffer from low tolerance to different sample matrices, poor stability, and insufficient scalability, failing to meet diverse on-site detection needs, including application scenarios, sample types, and multi-target detection. These shortcomings hinder the effective application of rapid detection in food safety enforcement and represent a major weakness in food safety assurance. Therefore, to overcome these challenges, developing on-site detection technologies integrating sample pretreatment and sensing is a key approach to improving the current weaknesses in rapid detection of chemical hazards.

[0003] Microneedle-based biosensors have demonstrated great potential in on-site food safety analysis. Microneedle arrays, made of polymers, possess numerous nanoscale conical structures. Their three-dimensional curved surfaces reduce barriers to molecular migration, enhance specific reactions, and enable rapid enrichment of trace targets within seconds. The large surface area of ​​microneedles also allows them to carry a large number of recognition elements, achieving ultrasensitive biosensing. With their portability, high payload capacity, and rapid enrichment capabilities, microneedle-based biosensors eliminate the cumbersome, time-consuming, and inefficient processes of sample pretreatment, further extracting and sensitively analyzing trace targets. Various microneedle-based electrochemical technologies, integrated with wireless transmission, have been widely applied to the real-time monitoring of disease biomarkers in human interstitial fluid. While microneedle-based biosensors have proven effective in extracting targets (such as endotoxins, allergen DNA, and bacteria) from food samples, they still face challenges in on-site detection of chemical hazards. Most chemical hazards, such as pesticides and veterinary drugs, react complexly with food tissues, leading to low target extraction efficiency and poor accuracy for microneedle-based sensors. Furthermore, the rapid screening of multiple targets in batches of food samples in different application scenarios poses challenges to the cost and portability of existing microneedle sensors. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a core-shell microneedle patch and a portable device for rapid detection of hazardous substances in food.

[0005] The technical solution adopted in this invention is: a HAMA<P hydrogel composite membrane, wherein HAMA is mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium diatomaceous earth (LP), tannic acid (TA) and PSA to form a composite hydrogel HAMA<P; after photocrosslinking, the HAMA<P hydrogel composite membrane is obtained.

[0006] A core-shell microneedle patch includes an inner microneedle patch and an outer HAMA<P hydrogel composite film, wherein the outer HAMA<P hydrogel composite film encapsulates the inner microneedle patch; the inner microneedle patch includes a substrate and a fluorescent probe modified on the substrate.

[0007] Preferably, the fluorescent probe comprises a fluorescent cluster BSA-ICG, a target recognition element, and a fluorescence quencher Cu. 2+ ;

[0008] Preferably, the target recognition element is a nanobody or an aptamer.

[0009] The method for preparing a core-shell microneedle patch involves preparing an inner microneedle patch substrate, modifying the substrate with a fluorescent probe, and forming a HAMA<P hydrogel composite film on the outside of the inner microneedle patch to obtain the core-shell microneedle patch.

[0010] Preferably, the specific steps are as follows:

[0011] Step 1: Mix the crosslinking agent and photoinitiator, place them in a PDMS negative mold, and demold after photocuring to obtain a cone-shaped substrate; immerse it in a solution containing fluorescent probes so that the fluorescent probes are modified onto the substrate to form an inner microneedle patch;

[0012] Step 2: Prepare the composite hydrogel HAMA<P, place it in a PDMS negative mold, press the inner microneedle patch into the composite hydrogel HAMA<P, and after photo-crosslinking and curing, demold to obtain the core-shell microneedle patch.

[0013] Preferably, the substrate is obtained by mixing trimethylpropane ethoxylate (ETPTA) and 2-hydroxy-2-methylphenylacetone (HMPP) in a volume ratio of 100:1 and then curing it under light.

[0014] A portable device for rapid detection of food hazards, comprising,

[0015] A reading device used to read fluorescence intensity;

[0016] The darkroom shell forms the darkroom structure, and the reading device is located at the opening at the top of the darkroom shell.

[0017] The microneedle loading platform, wherein the core-shell microneedle patch of claim 2 or 3 can be loaded onto the microneedle loading platform and is disposed at the lower opening of the darkroom shell;

[0018] An optical transmission system excites the fluorescence information of the microneedles on the microneedle loading platform and feeds it back to the camera module in the reading device.

[0019] Preferably, the optical transmission system includes a fluorescent excitation source, a filter, and a camera module; the fluorescent excitation source is positioned obliquely above the microneedle loading platform, and the emitted light can illuminate the microneedle loading platform; the filter is positioned above the microneedle loading platform; and the camera of the camera module is positioned above the filter.

[0020] Preferably, the fluorescence excitation light source is a 780nm LED light-emitting diode bead;

[0021] Preferably, the filter is an 810nm narrowband filter.

[0022] Application of portable rapid detection devices for food hazards in the detection of food hazards;

[0023] Preferably, the food hazard is one or a combination of pesticides, veterinary drugs, and allergens;

[0024] Preferably, the pesticide is acetamiprid, malathion, profenofos, or thiamethoxam; the veterinary drug is kanamycin, tetracycline, ampicillin, or chloramphenicol; and the allergen is β-lactoglobulin or macadamia nuts.

[0025] Preferably, the specific steps are as follows:

[0026] Step 1: Food sample collection. The food sample is treated and eluted with water or organic solvent to obtain the sample to be tested.

[0027] Step 2: Immerse the core-shell microneedles in the sample to be tested, and remove impurities from the sample by the outer composite film layer;

[0028] Step 3: Peel off the outer composite membrane layer in the core-shell structure and immerse the inner microneedles into the sample to be tested;

[0029] Step 4: Place the inner microneedle patch on the microneedle loading platform of the portable device for rapid detection of food hazards, and detect the fluorescence information on the microneedle patch.

[0030] The advantages and positive effects of this invention are: the HAMA<P composite membrane can quickly and efficiently remove impurities such as oils, pigments and organic acids; in the pretreatment process of food test samples, it can adsorb most of the interfering impurities; the inner microneedles have high sensitivity and can efficiently identify food hazards.

[0031] The core-shell microneedle design integrates pretreatment and fluorescence sensing, making the detection medium more portable and the detection process faster. Portable devices for rapid on-site detection of food hazards based on microneedle sensing achieve integrated sample pretreatment, hazard detection, data collection, and analysis. They have been successfully applied to the rapid (20 min), sensitive (pg / mL), and accurate detection of 10 chemical hazards (allergens, pesticides, and veterinary drugs). This helps users accurately and quickly identify potential hazards in different food samples, providing strong protection for food quality and safety. Attached Figure Description

[0032] Figure 1 In one embodiment of the present invention, the morphology of the inner layer microneedle patch is shown.

[0033] Figure 2 In one embodiment of the present invention, the morphology of the core-shell microneedle patch is shown.

[0034] Figure 3 The morphology of the cross-section of the core-shell microneedle patch in one embodiment of the present invention;

[0035] Figure 4 Oil removal efficiency of composite hydrogel membrane;

[0036] Figure 5 Pigment adsorption effect and efficiency of composite hydrogel;

[0037] Figure 6 Citric acid adsorption kinetics of the composite hydrogel;

[0038] Figure 7 A schematic diagram of off-on fluorescence sensing based on microneedles in one embodiment of the present invention;

[0039] Figure 8 A schematic diagram of the structure of a portable hazardous substance detection device based on microneedle sensing according to an embodiment of the present invention;

[0040] Figure 9 A schematic diagram of the internal structure and optical path transmission of a portable hazardous substance detection device based on microneedle sensing according to an embodiment of the present invention; wherein, 1, reading device, 2, darkroom shell, 3, optical transmission system, 4, microneedle loading platform, 5, fluorescent excitation light source, 6, filter, 7, camera system, 8, microneedle;

[0041] Figure 10Standard curve diagram for pesticide detection in Example 5;

[0042] Figure 11 Standard curve diagram for veterinary drug detection in Example 5;

[0043] Figure 12 The standard curve for allergen detection in Example 5;

[0044] Figure 13 Example 5 shows the detection results using portable devices; A is a diagram of the rapid on-site detection results for 4 pesticides; B is a diagram of the rapid on-site detection results for 4 veterinary drugs; C is a diagram of the rapid on-site detection results for 2 allergens. Detailed Implementation

[0045] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0046] This invention relates to a core-shell microneedle patch and a portable device for rapid detection of hazardous substances in food. One aspect of the invention provides a core-shell microneedle patch comprising an inner microneedle patch and an outer composite hydrogel shell. The inner microneedles are modified with fluorescent probes, enabling the detection of the presence and content of hazardous substances in a sample. To avoid the influence of impurities in the sample, the outer composite hydrogel shell rapidly adsorbs oils, pigments, and organic acids, removing most types of impurities from food samples, thereby ensuring the accuracy of hazardous substance detection.

[0047] In some embodiments of the present invention, a composite hydrogel HAMA<P is provided. This hydrogel is formed by mixing HAMA with a photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium diatomaceous earth (LP), tannic acid (TA), and PSA in a mass ratio of 8-10:1:2:1:8-10. After photoinitiated crosslinking, a HAMA<P composite membrane is obtained. The HAMA<P composite membrane can adsorb oily impurities, such as soybean oil, sunflower seed oil, fish oil, lard, and butter; pigment impurities, such as β-carotene, anthocyanins, and chlorophyll; and organic acid impurities.

[0048] The inner microneedle layer comprises a substrate and fluorescent probes modified on the substrate. Trimethylpropane ethoxylate (ETPTA) and 2-hydroxy-2-methylphenylacetone (HMPP) were mixed at a volume ratio of 100:1. The prepared mixture was placed in a PDMS negative mold, cured under UV light, and then demolded to form the cone-shaped inner microneedle substrate. The prepared substrate was then immersed in an antibody / aptamer solution containing the fluorescent probes to modify the substrate.

[0049] The fluorescent probe consists of a fluorescent cluster BSA-ICG, a target recognition element (nanobody or aptamer), and a fluorescence quencher Cu. 2+ Composition. First, dopamine-modified microneedles were immersed tip-down in a fluorescent solution of BSA-ICG (5 μg / mL, 50 μL) and coated overnight at 4°C. After washing three times with PBST, the microneedles were blocked in 3% BSA solution at room temperature for 30 min to prevent residual protein binding sites. Next, the microneedle patch was sequentially placed in CuCl2 and a solution of the target recognition element Nb / Aptamer-DTPAA. The chelating agent DTPAA chelates with CuCl2 via a chelation reaction. 2+ Chelation forms Cu-Nb / Apt modifiers on the microneedle surface, quenching the fluorescence of BSA-ICG and placing the fluorescence of the inner microneedle surface in an Off state. ImageJ software was used for grayscale analysis to statistically analyze the fluorescence value (F0) when the microneedle fluorescence signal was in the Off state. Subsequently, the microneedles were immersed in the target analyte solution. The target analyte binds to the corresponding Nb / Apt specific recognition element, causing Cu-Nb / Apt to be pulled away from the BSA-ICG fluorescent cluster surface, triggering the recovery of the fluorescence signal of the inner microneedle, placing it in the On state. The inner microneedles were washed three times with PBST, and the fluorescence value of the microneedles at this time was recorded using a portable device (F1). Quantitative detection of the target analyte was achieved based on the difference between the fluorescence signal recovery (Off-on) and F0, thus constructing an Off-on fluorescence sensing detection method. The entire sensing process is as follows: Figure 7 As shown.

[0050] In preparing the core-shell microneedle patch, a fluorescent probe-modified microneedle patch is first prepared. Uncrosslinked composite hydrogel HAMA<P is cast into a PDMS negative mold, and then the modified microneedle patch is pressed into a mold filled with hydrogel material, ensuring full adhesion. The mold is irradiated under 365nm UV for 5 minutes until the hydrogel shell is fully crosslinked. The patch is then demolded to obtain the core-shell microneedle patch. In use, the core-shell microneedle patch is immersed in the sample. During immersion, the outer composite hydrogel membrane layer loosens and detaches, achieving core-shell separation. The fluorescent probe modified on the exposed microneedle patch comes into contact with the hazardous substance in the sample, activating the fluorescence (turning it on). The presence of the hazardous substance in the sample can be determined by detecting the fluorescence intensity.

[0051] The outer composite hydrogel HAMA<P is used for sample pretreatment, shielding against interference from impurities such as oils, pigments, and organic acids, enabling rapid pretreatment of food samples. The inner microneedle patch is used to detect hazardous substances. The microneedle patch is modified with a specific fluorescent probe, achieving highly sensitive and specific detection of hazardous molecule based on fluorescence sensing. This allows a single core-shell microneedle to simultaneously perform pretreatment and detection steps, simplifying the cumbersome pretreatment steps in traditional methods and efficiently completing the sample pretreatment process, improving portability and detection speed. It integrates food sample pretreatment steps with target analyte fluorescence sensing into one unit.

[0052] In some embodiments of the present invention, a portable device for rapid detection of food hazards is provided. The portable detection device includes a reading device 1, a darkroom housing 2, an optical transmission system 3, and a microneedle loading platform 4. The reading device 1 is located at the upper opening of the darkroom housing 2, and the microneedle loading platform 4 is located at the lower opening of the darkroom housing. The reading device 1, the darkroom housing 2, and the microneedle loading platform 4 form a darkroom structure, and the optical transmission system 3 is located within the darkroom structure. The optical transmission system 3 includes a fluorescence excitation light source 5, a filter 6, and a camera module 7 of the reading device. When reading the detection results, the fluorescent probe on the microneedle 8 is also included in the optical transmission system. The fluorescence excitation light source is located diagonally above the microneedle loading platform. The fluorescence excitation light source 5 illuminates the tip of the microneedle 8, causing the fluorescent probe to emit fluorescence. The fluorescence signal passes through the filter 6 located directly above it and enters the camera module 7. The reading device 1 collects and analyzes the fluorescence signal. The reading device can be a smartphone, the camera module can be a smartphone camera system, and the smartphone can be equipped with an app to calculate the data and analyze the hazard concentration online. The main functions of the app include device parameter setting and control, microneedle fluorescence image acquisition, automatic fluorescence signal collection, machine learning, and data transmission.

[0053] The core-shell microneedle patch was prepared using a three-step molding method. A mixture of trimethylpropane ethoxylate (ETPTA) and 2-hydroxy-2-methylphenylacetone (HMPP) was placed in an inner microneedle PDMS negative mold. After vacuum and UV curing, the inner microneedle patch was demolded. HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium diatomaceous earth (LP), tannic acid (TA), and PSA, and then subjected to ultrasonic reaction to form a composite hydrogel HAMA<P. The inner microneedle patch, modified with a fluorescent probe, was pressed into an outer microneedle PDMS negative mold containing the composite hydrogel solution (HAMA<P). After hydrogel cross-linking under UV light, the patch was demolded to obtain the core-shell microneedle patch.

[0054] The specific steps for rapid on-site detection of hazardous substances in food are as follows:

[0055] Step 1: On-site collection of food samples; after collection, vegetables and fruits are ground into a pulp using a food processor and then simply extracted with an extraction solution;

[0056] Step Two: Pretreatment and Sensing; The core-shell microneedle patch is immersed in the sample to be tested. Interfering impurities in the sample are adsorbed onto the outer composite hydrogel layer. The outer hydrogel patch adsorbs impurities from the food sample, undergoing morphological changes such as swelling, and can be directly peeled off, thus completing the pretreatment process for the sample. After the outer shell of the core-shell microneedles detaches, the inner microneedles modified with corresponding fluorescent probes are exposed. Upon contact with hazardous substances in the sample, fluorescence is excited, realizing the detection process.

[0057] Step 3: Qualitative and quantitative analysis of hazardous substances; The treated inner layer microneedles are placed into a portable device for rapid detection of food hazardous substances. The App in the device is used to collect and read data. The read data is automatically analyzed by the software, and the results are output and transmitted.

[0058] Core-shell microneedles and the aforementioned detection methods can be used for highly sensitive and rapid detection of various hazards (allergens, pesticides, and veterinary drugs) in complex matrix foods. Portable devices for rapid on-site detection of food hazards based on microneedle sensing integrate sample pretreatment, hazard detection, data collection, and analysis; they have been successfully applied to the rapid (20 min), sensitive (pg / mL), and accurate detection of 10 chemical hazards (allergens, pesticides, and veterinary drugs); helping users accurately and quickly identify potential hazards in different food samples, providing strong protection for food quality and safety.

[0059] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described in terms of operation steps are performed in accordance with the corresponding product manuals. Unless otherwise specified, the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies.

[0060] The standards for acetamiprid, malathion, profenofos, thiamethoxam, kanamycin, tetracycline, ampicillin, and chloramphenicol involved in the embodiments of this invention were obtained from Tianjin Alta Technology Co., Ltd.; the aptamers for acetamiprid, malathion, profenofos, thiamethoxam, kanamycin, tetracycline, ampicillin, and chloramphenicol were all synthesized from Qingke Biotechnology Co., Ltd.; the β-lactoglobulin and macadamia nut protein nanobodies were prepared in the laboratory; ETPTA, HAMA, Irgacure 2959, tannic acid, LAP, lithium diatomaceous earth, chlorophyll, β-carotene, anthocyanins, and citric acid were purchased from Aladdin Reagent (Shanghai) Co., Ltd.; the BSA, PBS, EDTA2Na, choline chloride, and citric acid content kits were purchased from Beijing Solarbio Biotechnology Co., Ltd.; the fluorescent dye ICG was purchased from Xi'an Ruixi Biotechnology Co., Ltd.; and the microneedle PDMS negative mold was purchased from Taizhou Microchip Medical Technology Co., Ltd.

[0061] The 780nm LED beads and 810nm narrowband filter involved in this embodiment of the invention were purchased from Shenzhen Nahong Optoelectronic Technology Co., Ltd.; the smartphone was a realme 11; the gel imaging instrument was a ChemiDoc MP (Bio-Rad, USA); the TOC analyzer was a Multi N / C 2100 (Analytik Jena, Germany); and the microplate reader was a Spark (Tecan, Switzerland).

[0062] Example 1: Preparation of composite hydrogel HAMA<P

[0063] HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure2959), lithium diatomaceous earth (LP), tannic acid (TA), and PSA in a mass ratio of 10:1:2:1:10, and then subjected to ultrasonic reaction to form a composite hydrogel HAMA<P.

[0064] Example 2: Adsorption effect of composite hydrogel HAMA<P

[0065] Using a coating rod, 1 mL of the HAMA<P solution prepared in Example 1 was uniformly coated onto the surface of glass fiber paper (5×5 cm), and then exposed to ultraviolet light for crosslinking for 5 min. The crosslinked HAMA<P composite film was then freeze-dried to obtain the HAMA<P composite film.

[0066] 2.1 Grease Removal

[0067] 20 mL of deionized water, 10 mL of oil (soybean oil, sunflower oil, fish oil, lard, and butter), and 0.2 wt% Tween 80 were mixed thoroughly and stirred at 5000 rpm / min for 2 hours. Under the action of the surfactant, a series of stable emulsified oils were formed. An effective filtration area of ​​13.85 cm² was used. 2 The HAMA<P composite membrane was used in a laboratory filtration apparatus to separate an oil-water emulsion. The filtrate was collected, and the oil content was determined using a TOC analyzer. The oil removal efficiency of the HAMA<P composite membrane was as follows: Figure 4 As shown in the figure, the HAMA<P composite membrane exhibits highly efficient adsorption and removal of various types of oils.

[0068] 2.2 Pigment Removal

[0069] Three pigment solutions were prepared by dissolving β-carotene and chlorophyll in hexane and anthocyanins in deionized water, respectively. 50 mg of the lyophilized HAMA<P composite membrane prepared in Example 1 was added to 1 mL of each pigment solution (pigment concentration 1 mg / mL), and stirred for 10 min, followed by centrifugation at 7000 rpm for 5 min at room temperature. 200 μL of the supernatant was taken, and the absorbance was measured at 457 nm (β-carotene), 646 nm, and 663 nm (chlorophyll) using a microplate reader. β-carotene could be directly detected, and the separation efficiency of β-carotene was calculated.

[0070] Chlorophyll concentration can be calculated using the Arnon formula, and chlorophyll separation efficiency can be further calculated.

[0071] Chlorophyll concentration (μg / mL) = (20.2A646 + 8.02A663);

[0072] To determine the separation efficiency of anthocyanins, the separation efficiency was calculated based on the anthocyanin concentration. 1.4 mL of potassium chloride buffer (0.025 M, pH = 1.0) and sodium acetate buffer (0.4 M, pH = 4.5) were added to 100 μL of centrifuged anthocyanin supernatant, respectively. After standing for 15 min, the absorbance of the two solutions was measured at 525 and 700 nm, respectively. The anthocyanin content was calculated using the following formula:

[0073] Anthocyanin content (g / 100g) = (ΔA×M×f×V×1000)×100 / (m×ξ×L)

[0074] Among them: ΔA=(A 520 -A 700 pH 1.0 -(A 520 -A 700 pH4.5

[0075] M: 449.2 mg / mol, relative molecular mass of cornflower-3-glucoside;

[0076] f: Dilution factor;

[0077] V: The volume of the buffer solution after dilution;

[0078] m: Mass of anthocyanins in the original anthocyanin solution

[0079] ξ: 26900, extinction coefficient of cornflower-3-glucosimole;

[0080] L: Optical path length, cm.

[0081] The removal effects and efficiency of three pigments: β-carotene, chlorophyll, and anthocyanin are as follows: Figure 5 As shown, the composite hydrogel (HAMA<P) exhibits excellent adsorption and removal capabilities for all three pigments.

[0082] 2.3 Removal of organic acids

[0083] Citric acid (CA) was used to evaluate the adsorption efficiency of the composite hydrogel HAMA<P for organic acids, and the CA content was determined using a citric acid content assay kit.

[0084] 20 mg of lyophilized HAMA<P composite membrane was added to CA solution (2 μmol / mL), and the mixture was stirred for 1, 3, 5, 10, 20, 30, 60, 90, and 120 min, respectively, followed by centrifugation at 7000 rpm for 10 min at room temperature. 20 μL of the supernatant was collected after each reaction time, and subsequent reactions were performed according to the instructions of the citric acid content assay kit. Finally, the optical density (OD) at 545 nm was measured. 545 The concentration of citric acid was quantified using nm, and the adsorption efficiency of organic acids at different adsorption times was calculated as follows: HAMA < P. Figure 6 As shown.

[0085] Example 3: Preparation of core-shell microneedle patches

[0086] Trimethylpropane ethoxylate (ETPTA) and 2-hydroxy-2-methylphenylacetone (HMPP) were mixed at a volume ratio of 100:1. 500 μL of the mixture was placed in a PDMS negative mold, and vacuum treatment was performed to remove air bubbles and excess solution. The mold was then irradiated under a UV lamp for 1 min, cured, and demolded to form an inner layer microneedle patch, with the morphology as shown. Figure 1 As shown, the prepared inner layer microneedle patch was immersed in a fluorescent sensing probe solution containing 5 μg / mL BSA-ICG antibody / aptamer for 20 min for modification, and then rinsed three times before use.

[0087] The fluorescent probe consists of a fluorescent cluster BSA-ICG, a target recognition element (nanobody or aptamer), and a fluorescence quencher Cu. 2+ Composition. First, dopamine-modified microneedles were immersed tip-down in a fluorescent solution of BSA-ICG (5 μg / mL, 50 μL) and coated overnight at 4°C. After washing three times with PBST, the microneedles were blocked in 3% BSA solution at room temperature for 30 min to prevent residual protein binding sites. Next, the microneedle patch was sequentially placed in CuCl2 and a solution of the target recognition element Nb / Aptamer-DTPAA. The chelating agent DTPAA chelates with CuCl2 via a chelation reaction. 2+ Chelation forms Cu-Nb / Aptamer modification on the surface of the microneedles, which quenches the fluorescence of BSA-ICG and keeps the fluorescence of the inner microneedle surface in the Off state.

[0088] HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium diatomaceous earth (LP), tannic acid (TA), and PSA in a mass ratio of 10:1:2:1:10, and then subjected to ultrasonic reaction to prepare composite hydrogel HAMA<P.

[0089] 500 μL of the composite hydrogel solution was poured into a PDMS negative mold and vacuum-treated to fill the pinhole cavities. Then, the inner shell microneedles containing the fluorescent probe were pressed into the mold filled with hydrogel material, ensuring full adhesion before removing excess solution. The mold was irradiated under 365 nm UV light for 5 min until the hydrogel shell was fully cross-linked, at which point it was demolded to obtain the core-shell microneedle patch. The morphology of the core-shell microneedle patch is shown in the figure below. Figure 2-3 As shown. From Figure 3 It is evident that the cross-linked outer layer of composite hydrogel HAMA<P can coat the inner layer of microneedle patch.

[0090] Example 4: Portable Hazard Detection Device Based on Microneedle Sensing

[0091] like Figure 8 Figure 9 As shown, the portable testing device consists of a reading device 1 (smartphone), a 3D-printed darkroom housing 2, an optical transmission system 3, and a microneedle loading platform 4. The internal structure of the device is as follows: Figure 9As shown, the optical transmission system 3 includes a fluorescence excitation source 5 (780nm LED light-emitting diode beads), an 810nm narrowband filter 6, and microneedles 8 mounted on a microneedle loading platform. The fluorescence excitation source 5 provides light of a specific excitation wavelength for each detection point; the specially designed microneedle loading platform 4 is a black acrylic sample cell with three grooves that matches the size of the microneedle patch, capable of holding a total of six microneedles. The black darkroom casing provides a sealed space for the entire device, and a smartphone camera is used to collect and receive fluorescence images of the microneedles. The type and content of hazardous substances can be determined based on the type of microneedles and the fluorescence intensity.

[0092] In some embodiments of the present invention, an additional detection app can be developed for controlling device operation and analyzing and transmitting detection data.

[0093] Due to the focal length limitations of smartphone cameras, the ratio of the distance between the fluorescence excitation light sources to the distance between the specially designed microneedle patch sample cell is 1:3. The distance between the three LED light-emitting diode beads is 1cm, and the excitation wavelength is 780nm. The 810nm narrowband filter has a 5nm bandpass and an out-of-pass cutoff of 0.1%. The distance between the specially designed microneedle patch housing and the smartphone is 7cm. To avoid focal length changes caused by autofocus, the camera's autofocus setting is turned off during shooting, and manual focus mode is used with an ISO of 4000-6000 and an exposure time of 15s. The smartphone obtains a clear fluorescence image of the microneedle patch through a portable fluorescence imaging device. By uploading the initial and final fluorescence images to a dedicated image computing app, the images are analyzed to obtain the corresponding fluorescence recovery values, and the detection results are automatically generated.

[0094] The signal processing software includes four major modules: pesticide, veterinary drug, allergen, and multi-target detection, which can meet the needs of different detection items in on-site supervision.

[0095] Example 5: Application of portable devices for rapid on-site detection of pesticide and veterinary drug residues and allergens in food 5.1 Determination of sensitivity for detection of pesticide and veterinary drug residues and allergens

[0096] Microneedles modified with hazard-specific recognition elements were prepared according to the method in Example 3. The aptamers corresponding to different hazards are shown below.

[0097] Acetamiprid aptamer sequence:

[0098] SEQ ID No.1: C6NH2-TGTAATTTGTCTGCAGCGGTTCTTGATCGCTGA CACCATATTATGAAGA

[0099] Thiamethoxam aptamer sequence:

[0100] SEQ ID No.2: C6NH2-GACGGATCCACCGACATGCAAAGATGCACAA AAACG

[0101] Malathion aptamer sequence:

[0102] SEQ ID No.3: C6NH2-ATCCGTCACAACCTGCTTCTTATACACAATTGTTTTTCTCTTAACTTCTTGA

[0103] Profenofos aptamer sequence:

[0104] SEQ ID No.4: C6NH2-TTAGCGAGCTGCACACACAATGGACTCGTCAT ACCGTGCTGTTT

[0105] Tetracycline aptamer sequence:

[0106] SEQ ID No.5: C6NH2-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCA CGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG

[0107] Kanamycin aptamer sequence:

[0108] SEQ ID No.6: C6NH2-AGATGGGGGTTGAGGCTAAGCCGA

[0109] Chloramphenicol aptamer sequence:

[0110] SEQ ID No.7: C6NH2-ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTC GGTGGTAG

[0111] Ampicillin aptamer sequence:

[0112] SEQ ID No.8: C6NH2-CACGGCATGGTGGGCGTCGTG

[0113] The microneedle patch was modified by adding the appropriate aptamer to the fluorescent probe solution. In addition, β-lactoglobulin (preparation method as disclosed by Hu Y, Wang Y, Nie L, et al. Exploration of Specific Nanobodies As Immunological Reagents to Detect Milk Allergen of β-Lactogl obulin without Interference of Hydrolytic Peptides[J]. Journal of Agricultural and Food Chemistry, 2022, 70(48): 15271-15282) and macadamia protein nanobodies (preparation method as disclosed by Hu Y, Wu S, Wang Y, et al. Unbiased immunization strategy yielding specific nanobodies against macadamia allergen of vicilin-like protein for immunoassay development[J]. Journal of Agricultural and Food Chemistry, 2021, 69(17): 5178-5188) were added to a fluorescent probe solution to modify the microneedle patch for the detection of lactoglobulin and macadamia nuts. The patch was then assembled into a portable detection device according to the method in Example 4.

[0114] Prepare pesticide and veterinary drug test samples of different concentrations, as well as allergen test samples, and prepare a series of standard dilution solutions; specifically including:

[0115] Pesticides: Acetamiprid (0, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000, 20000, 50000 ng / mL), Thiamethoxam (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000 ng / mL), Malathion (0, 0.00... 0.005, 0.0001, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL), profenofos (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL);

[0116] Veterinary drugs: Tetracycline (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000 ng / mL), Kanamycin (0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000 ng / mL), Chlorpyrifos 0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL and ampicillin (0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL);

[0117] Allergens: β-lactoglobulin (0, 0.001, 0.005, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000, 20000, 100000 ng / mL), macadamia nuts (0, 0.01, 0.05, 0.1, 0.5, 1, 2.5, 5, 7.5, 10, 50, 100, 500, 1000, 2000, 5000, 10000, 20000, 50000 ng / mL).

[0118] After immersing various modified microneedle patches in their respective standard dilution solutions for 10 minutes, the outer hydrogel layer of the core-shell microneedles was peeled off and placed in a portable detection device. The portable device recorded the fluorescence recovery signal, and a standard curve was plotted using the concentration of the hazardous substance as the X-axis and the fluorescence recovery signal value (F1-F0) as the Y-axis. This curve was then integrated into the allergen detection module of the app. Figure 10-12 These are quantitative standard curves for pesticides, veterinary drugs, and allergens, respectively.

[0119] 5.2 Detection of pesticide residues in actual samples

[0120] Mix 100 ng / mL of acetamiprid (ACE), malathion (mala), profenofos (PFF), and thiamethoxam (TMX), and add them to 5 g spinach and 5 g apple samples, respectively. Then, homogenize the mixture in 10 mL of pesticide extraction buffer (1 mL methanol and 9 mL PBS buffer) and extract for 5 min. After standing, react the core-shell microneedles of the recognition probes, modified with the four pesticide aptamers, with the collected supernatant for 10 min. Separate the outer shell from the inner layer of the microneedle. After washing the inner microneedles three times with PBST, the detection results are directly output using a portable device. The pesticide residue detection results are as follows: Figure 13 As shown in Figure A, this demonstrates that portable testing equipment can effectively detect the residues of various pesticide hazards.

[0121] 5.3 Detection of Hazardous Substances in Actual Samples of Veterinary Drugs

[0122] 200 ng of kanamycin, tetracycline, ampicillin, and chloramphenicol were added to 5.0 g samples of fresh pork and milk, respectively. The samples were then extracted by soaking in 20.0 mL of 0.1 M Mellvaine-Na2EDTA buffer. After standing, the core-shell microneedles containing the four modified veterinary drug aptamer recognition probes were reacted with the collected supernatant for 10 min. The outer shell of the microneedle separated from the inner layer. After washing the inner microneedles three times with PBST, the detection results were directly output using a portable device. The veterinary drug residue detection results are as follows: Figure 13 As shown in B, this demonstrates that the portable testing device can effectively detect the residues of various veterinary drug hazards.

[0123] 5.4 Detection of residual allergens in actual samples

[0124] 5000 ng of β-lactoglobulin (β-LG) and macadamia nut (Mac) allergen protein were added to 500 mg of hypoallergenic milk powder and biscuits. Then, 1.6 g of DES and 2 mL of K₂HPO₄ solution (0.60 g / mL) were added and stirred for 5 min to ensure that the allergen in the sample was enriched in the top phase of the DES. The upper phase DES solution was collected after standing and diluted 5-fold with PBS (10 mM, pH 7.4). A microneedle patch modified with β-lactoglobulin and macadamia nut allergen recognition probe (Nb-DTPAA) was simultaneously reacted with the diluted DES solution for 10 min, and detection was performed using a portable device. Allergen test results are as follows: Figure 13 As shown in C, this demonstrates that portable testing devices can effectively detect the residue of various allergen-related hazards.

[0125] The embodiments of the present invention have been described in detail above, but the content described is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. A core-shell microneedle patch, characterized in that: The device comprises an inner microneedle patch and an outer HAMA<P hydrogel composite film, with the outer HAMA<P hydrogel composite film encapsulating the inner microneedle patch. HAMA is mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone, lithium diatomaceous earth, tannic acid, and PSA to form the composite hydrogel HAMA<P. After photocrosslinking, the HAMA<P hydrogel composite film is obtained. The inner microneedle patch includes a substrate and a fluorescent probe modified on the substrate.

2. The core-shell microneedle patch according to claim 1, characterized in that: The fluorescent probe includes the fluorescent cluster BSA-ICG, the target recognition element, and the fluorescence quencher Cu. 2+ .

3. The core-shell microneedle patch according to claim 2, characterized in that: The target recognition element is a nanobody or aptamer.

4. The method for preparing the core-shell microneedle patch according to claim 1, characterized in that: An inner microneedle patch substrate was prepared, and a fluorescent probe was modified onto the substrate. A HAMA<P hydrogel composite film was formed on the outside of the inner microneedle patch to obtain a core-shell microneedle patch.

5. The method for preparing the core-shell microneedle patch according to claim 4, characterized in that: The specific steps are as follows: Step 1: Mix the crosslinking agent and photoinitiator, place them in a PDMS negative mold, and demold after photocuring to obtain a cone-shaped substrate; immerse it in a solution containing fluorescent probes so that the fluorescent probes are modified onto the substrate to form an inner microneedle patch; Step 2: Prepare the composite hydrogel HAMA<P, place it in a PDMS negative mold, press the inner microneedle patch into the composite hydrogel HAMA<P, and after photo-crosslinking and curing, demold to obtain the core-shell microneedle patch.

6. The method for preparing the core-shell microneedle patch according to claim 5, characterized in that: The substrate is obtained by mixing trimethylpropane ethoxylate and 2-hydroxy-2-methylphenylacetone in a volume ratio of 100:1 and then curing it under light.

7. A portable device for rapid detection of hazardous substances in food, characterized in that: include, A reading device used to read fluorescence intensity; The darkroom shell forms a darkroom structure, and the reading device is disposed at the upper opening of the darkroom shell; A microneedle loading platform, wherein the core-shell microneedle patch as described in any one of claims 1-3 is loaded onto the microneedle loading platform and disposed at the lower end opening of the darkroom shell; An optical transmission system excites the fluorescence information of the microneedles on the microneedle loading platform and feeds it back to the camera module in the reading device.

8. The portable device for rapid detection of hazardous substances in food according to claim 7, characterized in that: The optical transmission system includes a fluorescent excitation light source, a filter, and a camera module; the fluorescent excitation light source is positioned obliquely above the microneedle loading platform, and the emitted light can illuminate the microneedle loading platform; the filter is positioned above the microneedle loading platform; and the camera of the camera module is positioned above the filter. The fluorescence excitation source is a 780 nm LED light-emitting diode bead; The filter is an 810 nm narrowband filter.

9. The application of the portable rapid detection device for food hazards as described in claim 7 or 8 in the detection of food hazards.

10. The application according to claim 9, characterized in that: Food hazards are one or more of pesticides, veterinary drugs, and allergens; The pesticides are acetamiprid, malathion, profenofos, or thiamethoxam; the veterinary drugs are kanamycin, tetracycline, ampicillin, or chloramphenicol; the allergens are β-lactoglobulin or macadamia nuts.

11. The application according to claim 10, characterized in that: The specific steps are as follows: Step 1: Food sample collection. The food sample is treated and eluted with water or organic solvent to obtain the sample to be tested. Step 2: Immerse the core-shell microneedles in the sample to be tested, and remove impurities from the sample by the outer composite film layer; Step 3: Peel off the outer composite membrane layer in the core-shell structure and immerse the inner microneedles into the sample to be tested; Step 4: Place the inner microneedle patch on the microneedle loading platform of the portable device for rapid detection of food hazards, and detect the fluorescence information on the microneedle patch.

Citation Information

Patent Citations

  • Herb tea pesticide multi-residue detection method and adsorption and purification combined agent used by same

    CN116183766A

  • Microscopic analysis detector for solid-phase micro-sensing probe

    CN221745868U