A strain of sparassis crispa suitable for factory cultivation and a cultivation method thereof
By selecting and breeding the *Hydrangea macrophylla* strain FJSXQJ-01 and its industrialized cultivation method, the problems of single variety and scarcity of *Hydrangea macrophylla* have been solved, achieving the production of *Hydrangea macrophylla* with high fruiting rate and rich nutrients, thus promoting the development of the *Hydrangea macrophylla* industry.
Patent Information
- Application Number
- CN202411938391.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-12-26
AI Technical Summary
The limited variety and homogeneity of *Hydrangea macrophylla* species restrict its cultivation scale and production capacity. Wild resources are scarce, and genetic breeding materials are lacking, hindering the development of the industry.
A suitable *Hydrangea* strain, FJSXQJ-01, for industrial cultivation was selected and identified as a different species of the *Hydrangea* genus through ITS sequence alignment. Based on the characteristic DNA sequence, suitable cultivation methods were provided, including formulas and management conditions for mother culture, primary culture, and cultivar.
It improves the fruiting rate and resistance to contaminating bacteria of *Hydrangea macrophylla*, and the fruiting bodies are rich in nutrients. It solves the problems of long cultivation cycle and low yield of *Hydrangea macrophylla* in existing technologies, and promotes the development of the *Hydrangea macrophylla* industry.
Smart Images

Figure CN119709429B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a strain of Sparassis suitable for factory cultivation and a cultivation method thereof, and belongs to the technical field of edible fungus breeding. BACKGROUND
[0002] Sparassis belongs to Basidiomycota, Agaricomycetes, Polyporales, Sparassidaceae and Sparassis, and has not only delicious taste but also multiple nutritional and health functions. Research shows that the content of β-glucan in Sparassis is very rich and has great development value. At present, the research on Sparassis mainly focuses on biological characteristics of strains, nutritional components and medicinal value, and is still weak in genetic breeding, cultivation technology, wild resource excavation and liquid fermentation of Sparassis. There are problems such as long cultivation period, non-uniform fruiting time, low yield, serious strain degeneration and the like. At present, only two Sparassis varieties are recognized in China, namely "Minxie No. 1" and "Minxie No. 2", both of which are Sparassis latifolia. The single variety and serious homogenization of Sparassis lead to great hindrance to the cultivation scale, production capacity and industrial development of Sparassis. Wild Sparassis resources are extremely scarce, which leads to lack of genetic breeding materials of Sparassis and insufficient research, and seriously restricts the development of Sparassis industry. Therefore, it is of great significance to excavate local resources, domesticate and cultivate new species of Sparassis genus and breed excellent strains.
[0003] Most of the cultivated Sparassis in China is Sparassis latifolia, with a fruiting body up to 30 cm high and 10-40 cm in diameter. The flesh is odorless and tasteless, and the fruiting body is orbicular, with leaf-like branches and numerous wavy petal pieces at the branch ends. The initial color is white to cream, and the old color is dirty white to light brownish white. The flesh is flesh-colored, and the mycelium is colorless, with thin to slightly thick walls and mostly lock-like joint. The stipe is mostly born in the host body, up to 35 cm long. The spores are colorless, smooth and oval to spherical. The fruiting body contains very rich polysaccharides and is a large fungus for medicinal and edible use.
[0004] At present, the strains of Sparassis on the market are mostly Sparassis latifolia, which are single, homogenized and seriously degenerated, leading to great hindrance to the cultivation scale, production capacity and industrial development of Sparassis. Wild Sparassis resources are extremely scarce, and there is lack of development and utilization of local wild Sparassis resources. There is lack of genetic breeding materials and insufficient research, which seriously restricts the development of Sparassis industry. Therefore, the breeding of new varieties of Sparassis is imminent. SUMMARY
[0005] The technical problems to be solved by the present application are to provide a Sparassis sp. strain suitable for factory cultivation and a cultivation method thereof, so as to solve the technical problems in the prior art.
[0006] The technical scheme adopted by the present application is as follows: a Sparassis sp. strain suitable for cultivation, with a preservation number of GDMCC65276, preserved in the Guangdong Microbial Culture Collection Center, the strain is FJSXQJ-01, classified and named as Sparassis sp., and the ITS sequence is shown as SEQ ID NO: 1; through ITS sequence comparison, the strain belongs to the species of the order Polyporales, the Sparassis sp. family, and the Sparassis sp. genus, and is the same Sparassis sp. genus as the widely planted Sparassis latifolia on the market, but is a different species.
[0007] Preferably, the Sparassis sp. strain has a characteristic DNA sequence different from other strains, and the characteristic DNA sequence fragment is shown as SEQ ID NO: 2.
[0008] Preferably, the described Sparassis sp. strain has an ellipsoidal to nearly spherical stroma, is similar to a blooming ball, is fleshy, has a short stem, is single, and is composed of many closely arranged fan-shaped structures; most of the fan blades extend from the central stem structure; is grayish white when fresh, soft, becomes light gray to light orange after aging, is leathery, is cream white to light brown after drying, is relatively brittle, is about 1 mm thick, has a full edge or slightly wavy, slightly cracked top edge, has a darker top color, has the same color on the front and back, and has obvious mushroom aroma; the basidiospores are ellipsoidal to nearly spherical, with a diameter of about 4.5-7.5x3.5-4(5.0)μm, are transparent, and have thin walls; the basidia are narrow and nearly cylindrical (49-66x5-7μm), and the top is spore-bearing, transparent.
[0009] Preferably, the Sparassis sp. strain has white mycelium in the mother culture medium, a small amount of aerial mycelium, fast mycelium growth, and good colony morphology consistency, and the colony occasionally has regular concentric ring ornamentation.
[0010] The factory cultivation method of the Sparassis sp. is as follows:
[0011] (1) Mother culture preparation: the weight component formula of the mother culture medium is 80%-85% of potatoes, 7%-9% of glucose, 1%-1.5% of protein peptone, 0.5%-1% of potassium dihydrogen phosphate, 0.2%-0.5% of magnesium sulfate, and 5%-10% of agar, and then pure water is added to (potato gram number / 200) liters, sterilized, divided, and cooled for standby. The purified Sparassis sp. mycelium is inoculated into the above-mentioned medium and placed in a dark culture at 22±1℃;
[0012] (2) Master culture: the weight component formula is 70%-73% of mixed sawdust, 8%-20% of corn flour, 3%-15% of bran, 0.1%-2% of sucrose, 0.1%-2% of protein peptone, 0.01%-1% of potassium dihydrogen phosphate, and 0.01%-0.2% of magnesium sulfate. The above components are stirred uniformly, and water is added in the stirring process to make the water content 60%-62%. The culture medium prepared according to the above formula is filled into the strain bottles, sterilized at high temperature and high pressure, and cooled for standby. The mother strain prepared above is inoculated into the master culture medium, and dark culture is carried out at 22±1℃ for 25-30 days.
[0013] (3) Cultivation formula: the weight component formula is 0-73% of pine sawdust, 0-80% of mixed sawdust, 0-16% of corn flour, 0-12% of bran, 0-12% of flour, 1-2% of sucrose, 0-1% of protein peptone, 0-0.2% of potassium dihydrogen phosphate, and 0-0.2% of magnesium sulfate, and 0-2% of CaCO3. The above components are stirred uniformly, and water is added in the stirring process to make the water content 60%-62%.
[0014] The culture medium prepared according to the above formula is filled into the 170mm×330mm strain bags, sterilized at high temperature and high pressure, and cooled for standby. The master strain prepared above is inoculated into the cultivation medium, and dark culture is carried out at 22±1℃ for 50-60 days, and the carbon dioxide concentration in the culture room is not more than 2800ppm.
[0015] Preferably, the cultivation formula is that the weight component formula is 78% of mixed sawdust, 10% of flour, 10% of corn flour, 1% of sucrose, and 1% of CaCO3. The above components are stirred uniformly, and water is added in the stirring process to make the water content 60%.
[0016] Preferably, the cultivation formula is that the weight component formula is 71.8% of mixed sawdust, 13% of corn flour, 5% of bran, 8% of flour, 1.5% of sucrose, 0.5% of protein peptone, 0.1% of potassium dihydrogen phosphate, and 0.1% of magnesium sulfate. The above components are stirred uniformly, and water is added in the stirring process to make the water content 60%.
[0017] The preferred cultivation medium is composed of 20% pine sawdust, 52.8% mixed wood sawdust, 15% corn powder, 10% wheat bran, 1.5% sucrose, 0.5% protein peptone, 0.1% potassium dihydrogen phosphate and 0.1% magnesium sulfate, wherein the above components are stirred uniformly and water is added during the stirring process to make the water content 60%.
[0018] The preferred cultivation medium is composed of 40% pine sawdust, 32.8% mixed wood sawdust, 15% corn powder, 10% wheat bran, 1.5% sucrose, 0.5% protein peptone, 0.1% potassium dihydrogen phosphate and 0.1% magnesium sulfate, wherein the above components are stirred uniformly and water is added during the stirring process to make the water content 60%.
[0019] The preferred cultivation medium is composed of 60% pine sawdust, 12.8% mixed wood sawdust, 15% corn powder, 10% wheat bran, 1.5% sucrose, 0.5% protein peptone, 0.1% potassium dihydrogen phosphate and 0.1% magnesium sulfate, wherein the above components are stirred uniformly and water is added during the stirring process to make the water content 60%.
[0020] The preferred cultivation medium is composed of 72.8% pine sawdust, 15% corn powder, 10% wheat bran, 1.5% sucrose, 0.5% protein peptone, 0.1% potassium dihydrogen phosphate and 0.1% magnesium sulfate, wherein the above components are stirred uniformly and water is added during the stirring process to make the water content 60%.
[0021] The present application has the following advantages: compared with the prior art, the present application provides a suitable cultivation strain of Sparassis, which has grayish white to light orange fruiting body, beautiful flower type, and rich nutrients, and is different from all the existing artificially cultivated Sparassis strains; the suitable artificially cultivated Sparassis strain provided by the present application has a characteristic DNA fragment and morphological characteristics different from other strains; the suitable artificially cultivated Sparassis strain and the matching cultivation method provided by the present application have fast mycelium growth, strong anti-bacterial ability, self-color and strong primordium, and a mushrooming rate of 90% or above.
[0022] The present application selects a suitable artificially cultivated Sparassis variety through wild resource collection and systematic domestication and breeding, provides rich materials for the development and genetic breeding of the Sparassis industry, and promotes the rapid development of the Sparassis industry.
[0023] The strain of Sparassis sp. in the present application has a larger appearance difference compared with the market Sparassis latifolia strain. The primordium of the strain FJSXQJ-1 is white, the fruit body is grayish white when fresh, soft, becomes light gray to light orange after aging, has good leather type, is spherical, has a whole edge or slightly wavy top edge, has a mushroom aroma, has strong resistance to impurities, has low cultivation bag pollution rate, and has good mushroom consistency. In addition, compared with the market Sparassis latifolia nutritional component determination, the fruit body cultured by the strain of the present application has more abundant nutritional components than the market Sparassis latifolia, the crude polysaccharide content can reach 657.33 mg / g, which is approximately 2 times (329.30 mg / g) of the Sparassis latifolia, the crude protein content is 334.95 mg / g, while the Sparassis latifolia is only 85.55 mg / g; the crude fat content is 3.33%, and the Sparassis latifolia is only 1.90%. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 is a morphological characteristic diagram of a wild strain of Sparassis sp.
[0025] Figure 2 is a mycelium diagram of the Sparassis sp. strain of the present application.
[0026] Figure 3 is a primordium diagram of the Sparassis sp. strain of the present application.
[0027] Figure 4 is a primordium differentiation diagram of the Sparassis sp. strain of the present application.
[0028] Figure 5 is a morphological diagram of the Sparassis latifolia strain.
[0029] Figure 6 is a morphological diagram of the Sparassis sp. strain of the present application.
[0030] Figure 7 is a mushrooming diagram of the Sparassis sp. strain of the present application. DETAILED DESCRIPTION
[0031] The present application will be further described below in combination with the drawings and specific examples.
[0032] Example 1:
[0033] A Sparassis sp. strain suitable for factory cultivation, the strain has a preservation number of GDMCC 65276, is preserved in the Guangdong Microbial Culture Collection Center, is FJSXQJ-1, and is classified and named as Sparassis sp.
[0034] The strain parent of the present application is a wild Sparassis subsistence body collected from a national nature reserve of Guizhou province in October 2022, and the pure culture mycelium is obtained through tissue separation, purification and identification. The strain is a Sparassis species through ITS sequence phylogenetic analysis. The strain is a species belonging to Polyporales, Sparassidaceae and Sparassis, and the ITS sequence is shown as SEQ ID NO: 1.
[0035] GTATTGGTACGACGGCAGTGTCTGAGGCTCGCTGCAGACCTGAAGCTTGATATCGAATTCGCGTGTCGCCCTTTCCTCCGCTTATTGATATGCTTAAGTTCGGCGGGTAGTCCTACCTGATTTGAGGTCAGACGGTCAGAAAGCTGTCCCGACAAAGGGACGATTGGAAGCCGACCCGCAGAGCGTCACGACCGCGGCGTAGACGATTATTATATCACACCGACGGCCGATCCGCAAAAGGTTCGCGCTAATGCGTTCCAGAGGAGCCGACTGACCAGAGCCGGCAGAAGCCTCCAAAGTCCAAGCTTCAAGCCCCGACAAAGGAGATGAAGTTGATGATTCCACGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAAATCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAGGTGCGTTACAAACGCGAGCGCATTCTATTAAGACATTCCTCCAGTGTGCGTGCCGAAGCCTTCCATCACCACATGATGACTCCAGCTATAGGGCAAATTCCCGTCCTCCCGCGCGAACCCCTGGGCAAACTGCCCCTGCTAAGCAGCAGTAGTGACAGAACCCCTGGGGCTAAGGATACTAAGGATTCAATCAGGCCCCAAGCAAGTGCTTAAACCTGCTCAGCAAGGCAGTGACACAACACCACCCCCCCAGGATCCTGGAGCTACACATCCCAGTCATAAAAGCTTTCATCACCACCATGTCGTACGAGGGCAGCAACGACAACACACATTCTCTGGTTCGTATATGAGGCCGGAAGGCACCGAGCCACGGCCCCTCTCGAGGCCGACCCGAAACCGACTTACCAAAAGGTTCACAGGTGTAAGAAGATGGAAGATGGATGGAGCGGGGCGTGCACATGCCTCCGTCAACGACGAAGAGGCCAGCGACAGCCCGGTTTCAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACAATTTTACTTCCAGGGGGACCGCGAATTCAATTC
[0036] The strain has a characteristic DNA sequence that is different from other strains, and the characteristic DNA sequence fragment is shown in SEQ ID NO: 2.
[0037] The sequence information of the characteristic DNA fragment of the strain is as follows:
[0038] GCTGCCTAGGCTTCTTCACGGACCTCCACGCCTGCCTACTCGTCGGCGCGTCACTTCAACGCCGACGGTGAGGTATGGGTAACACGCTTGAGCGCCATCCATTTTCAGGGCTGGTTCATTCGGCAGGTGAGTTGTTACACACTCCTTGGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTAGATGAACCAACACCTTTTGTGGTGTCTGATGAGCGTGCATTCCGGCACCTTAACCTCACGTTCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTAGAAACTCTCAATCGCCGAGCGGTCCAATCGAGGGACGGCCCGTTCTTACATATTTAAAGTTTGAGAATAGGTTGAGGTCGTTTCGACCCCAAGGCCTCTAATCATTCGCTTTACCACATAAATCTGATACGAGTTTCTGCTATCCTGAGGGAAACTTCGGCAGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAAATTCGACGATCGATTTGCACGTCAGAATCGCTACGAGCCTCCACCAGAGTTTCCTCTGGCTTCACCCTATTCAGGCATAGTTCACCATCTTTCGGGTCCCAACATGCACGCTCCACCGCAGAGCCGTCACAGCAGTTCAGGTCCGGGCGTCGATGCTCCCCACGACGGGGATCTCGACCTTTCACTTTCGTTGCGCGCTCGGGTTTTCCACCCAAACACTCGCGGGCATGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGTCGTTTAAAGCCATTACGCCAGCATCCTAAGCACGAGCGTGGGCGAACCCCGACCGTAAAGGCGTGCTGAGTTCCTCGATCCCCACCGCCGTATGCGACCGAGGGCTATAACACACCGTGATGATGGTGCCACGTTCCCTCGACCTTTATCCGGCGGTCGAAATCGATGCTGGCCCGTCGACCGGAAAGTGCACCGAGCGAAAGAGCAAGGCTGACTTCCGGCCAACGCGACTGACTTCAAGCGTTTCCCTTTCAGCAATTTCACGTACTGTTTAACTCTCTTTCCAAAGTTCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCGTTTTGAGCTGCATTCCCAAACAACTCGACTCATCGAGAGCGCATCACAAAGCACCGGCGGTCCGTGTCAAAGACGGGATTCTCACCCTCTACGACGCTCTGTTCCAAGAGACTTGTACACGGTCCGGCGCGGAAGGCGCTTCTCCAGATTACAACTCGGACGGCGGTGAAACCGTCAGATTTTAAATTTGAGCTCTTCCCGCTTCACTCGCAGTTACTAGGGGA
[0039] The cultivation method of the suitable factory cultivation of the strain of the ball fungus is as follows:
[0040] (1) Mother seed preparation
[0041] The mother seed culture formula is potato 200g, glucose 20g, peptone 3g, potassium dihydrogen phosphate 1.5g, magnesium sulfate 1g, agar 20g, and pure water is added to 1 liter, sterilized, divided, and cooled for standby. The purified ball fungus mycelium is inoculated in the above culture medium and cultured in the dark at 20-22℃. The mycelium in the mother seed culture medium is white with a small amount of aerial mycelium, the mycelium grows fast, and the colony morphology is consistent.
[0042] (2) Original seed preparation culture
[0043] The original seed culture formula is mixed wood chips 72.8%, corn flour 15%, bran 10%, sucrose 1.5%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, and magnesium sulfate 0.1%. The above components are stirred uniformly, and water is added during stirring to make the water content 60%-62%. The culture medium is prepared according to the above formula, and after preparation, it is loaded into the seed bottle, high-temperature high-pressure sterilized, and cooled for standby. The mother seed prepared above is inoculated in the original seed culture medium and cultured in the dark at 20-22℃ for 25-30 days.
[0044] (3) Cultivation seed preparation culture
[0045] The cultivation seed formula:
[0046] Formula 1: Sawdust 78%, flour 10%, corn meal 10%, sucrose 1%, CaCO3 1%, the above components are mixed uniformly, and water is added during the mixing process to make the water content 60%.
[0047] Formula 2: Sawdust 71.8%, corn meal 13%, bran 5%, flour 8%, sucrose 1.5%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.1%, the above components are mixed uniformly, and water is added during the mixing process to make the water content 60%.
[0048] Formula 3: Pine sawdust 20%, sawdust 52.8%, corn meal 15%, bran 10%, sucrose 1.5%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.1%, the above components are mixed uniformly, and water is added during the mixing process to make the water content 60%.
[0049] Formula 4: Pine sawdust 40%, sawdust 32.8%, corn meal 15%, bran 10%, sucrose 1.5%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.1%, the above components are mixed uniformly, and water is added during the mixing process to make the water content 60%.
[0050] Formula 5: Pine sawdust 60%, sawdust 12.8%, corn meal 15%, bran 10%, sucrose 1.5%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.1%, the above components are mixed uniformly, and water is added during the mixing process to make the water content 60%.
[0051] Formula 6: Pine sawdust 72.8%, corn meal 15%, bran 10%, sucrose 1.5%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.1%, the above components are mixed uniformly, and water is added during the mixing process to make the water content 60%.
[0052] The culture media are prepared according to the above formulas, and after preparation, they are filled into 170mm x 330mm bags, and sterilized by high temperature and high pressure, and then cooled for standby. The prepared original strain is inoculated into the cultivation medium, and placed in a dark culture room at 22±1°C for 50-60 days, and the carbon dioxide concentration in the culture room is not more than 2800ppm.
[0053] (4) Primordium induction and fruiting management
[0054] During the primordium induction stage, the induction temperature is controlled at 18°C for 12 days, the light intensity is 500-2000Lx, the light intensity per day is not less than 8 hours, the carbon dioxide concentration in the induction room is not more than 1800ppm, and the air humidity is about 70%. During the fruit body development stage, the temperature is controlled at 18-22°C, the culture is carried out for 18-25 days, the carbon dioxide concentration in the room is not more than 1000ppm, and the air humidity is not less than 92%. The whole growth and development cycle is about 110 days.
[0055] The production status data of the 6 cultivation formulas are shown in Table 1:
[0056] Table 1 Production status data
[0057]
[0058] As shown in Table 1, the 6 cultivation formulas can all grow mushrooms, but there are obvious differences among the different formulas, wherein the comprehensive yield of the No. 1 formula is the highest, reaches 112.32 g / bag, and the pollution rate is relatively low, and the culture period is moderate, which is the optimal production formula for the strain. The No. 5 formula is the second, the yield is slightly lower than that of the No. 1 formula, but the mushroom yield is the highest and the pollution rate is the lowest. The No. 3 formula has the worst effect, the yield is the lowest, and the mushroom yield is the lowest, and should be eliminated in production.
[0059] The comparison of nutritional components of the FJSXQJ-1 strain of the Sparassis and the Sparassis crispa is shown in Table 2:
[0060] Table 2 Comparison of nutritional components of the FJSXQJ-1 strain of the Sparassis and the Sparassis crispa
[0061]
[0062] Note: All determination results are completed by Sanjiaosheng Biological Co., Ltd.
[0063] As shown in Table 2, the nutritional components of the fruiting body cultured by the strain of the application are more abundant than those of the commercially available Sparassis crispa, the crude polysaccharide content can reach 657.33 mg / g, which is approximately 2 times (329.30 mg / g) of the Sparassis crispa (329.30 mg / g), the crude protein content is 334.95 mg / g, while the Sparassis crispa is only 85.55 mg / g; the crude fat content is 3.33%, while the Sparassis crispa is only 1.90%, which comprehensively shows that the Sparassis produced by the strain has more abundant nutritional components and has great cultivation value.
[0064] As shown in the drawings, the mycelium in the embodiment grows fast, has strong anti-bacterial ability, the primordium is white and robust, the mushroom consistency is good, and the mushroom yield reaches 90%.
[0065] The above is only a specific implementation of the application, but the protection scope of the application is not limited thereto, any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the application, which should be covered in the protection scope of the application, therefore, the protection scope of the application should be subject to the protection scope of the claims.
Claims
1. A type of *Hydrangea macrophylla* suitable for industrialized cultivation (Sparassis sp.) strain FJSXQJ-01, characterized by: The strain has the accession number GDMCC 65276 and is deposited at the Guangdong Provincial Microbial Culture Collection Center. Its ITS sequence is shown in SEQ ID NO:
1. The strain was obtained by tissue isolation, purification and identification of wild Hydrangea macrophylla fruiting bodies collected from the Fanjingshan National Nature Reserve in Tongren City, Guizhou Province.
2. A type of *Hydrangea macrophylla* suitable for industrialized cultivation according to claim 1. (Sparassis sp.) The cultivation method of strain FJSXQJ-01 is characterized by: The method is as follows: Mother culture preparation: The mother culture composition is 80%-85% potato, 7%-9% glucose, 1%-1.5% peptone, 0.5%-1% potassium dihydrogen phosphate, 0.2%-0.5% magnesium sulfate, and 5%-10% agar. Then, dilute with pure water to a volume of (g / 200) liters, sterilize, dispense, and cool before use. Inoculate the purified *Hydrangea hydrangea* mycelium into the above culture medium and incubate in the dark at 22±1℃. Primary culture: The formula by weight is 70%-73% hardwood sawdust, 8%-20% corn flour, 3%-15% wheat bran, 0.1%-2% sucrose, 0.1%-2% peptone, 0.01%-1% potassium dihydrogen phosphate, and 0.01%-0.2% magnesium sulfate. Mix the above components evenly, adding water during the mixing process to achieve a moisture content of 60%-62%. Prepare the culture medium according to the above formula, and after preparation, pour it into inoculum bottles, sterilize by high temperature and high pressure, and cool it for later use. Inoculate the prepared mother culture into the primary culture medium and incubate it in the dark at 22±1℃ for 25-30 days. Cultivation formula: The weight component formula is one of the following: Formula 1: 78% hardwood sawdust, 10% flour, 10% corn flour, 1% sucrose, 1% CaCO3. Mix the above components evenly, adding water during the mixing process to make the moisture content 60%. Formula 2: 71.8% hardwood sawdust, 13% corn flour, 5% wheat bran, 8% wheat flour, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Mix the above components evenly, adding water during the mixing process to bring the moisture content to 60%. Formula 3: 71.8% hardwood sawdust, 13% corn flour, 5% wheat bran, 8% wheat flour, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Mix the above components evenly, adding water during the mixing process to bring the moisture content to 60%. Formula 4: 40% pine sawdust, 32.8% hardwood sawdust, 15% corn flour, 10% wheat bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Mix the above components thoroughly, adding water during the mixing process to achieve a moisture content of 60%. Formula 5: 60% pine sawdust, 12.8% hardwood sawdust, 15% corn flour, 10% wheat bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Mix the above components thoroughly, adding water during the mixing process to achieve a moisture content of 60%. Formula 6: 72.8% pine sawdust, 15% corn flour, 10% wheat bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Mix the above components evenly, adding water during the mixing process to bring the moisture content to 60%. Stir the above components thoroughly, adding water during the stirring process to bring the moisture content to 60%-62%; Prepare the culture medium according to the above formula, and after preparation, put it into a 170mm×330mm inoculum bag, sterilize it under high temperature and high pressure, and cool it for later use; inoculate the original culture prepared above into the culture medium, and place it in the dark at 22±1℃ for 50-60 days, with the carbon dioxide concentration in the culture room not exceeding 2800ppm. Primordial induction and fruiting management: During the primordial induction stage, control the induction temperature at 18℃ for 12 days, with a light intensity of 500-2000 Lx and a daily light intensity of no less than 8 hours. The carbon dioxide concentration in the induction room should not exceed 1800 ppm, and the air humidity should be 70%. During the fruiting body development stage, control the temperature at 18-22℃ for 18-25 days, with the indoor carbon dioxide concentration not exceeding 1000 ppm and the air humidity not lower than 90-95%. The entire growth and development cycle is 95-110 days.
Citation Information
Patent Citations
Sparassis crispa culture method, Sparassis crispa dry powder, solvent extract of Sparassis crispa dry powder, and application of Sparassis crispa dry powder
CN111718857A
Sparassis crispa high-yield strain, molecular marker and identification and industrial cultivation method
CN117487670A
Sparassis crispa strain suitable for industrial cultivation and cultivation method of sparassis crispa strain
CN117487671A
Sparassis crispa strain and high-yield cultivation method thereof
CN119060863A