Aspergillus tubingensis and its application in preparing meal condiments

Abstract

The invention relates to the field of microorganisms, and discloses an Aspergillus tubingensis strain and application thereof in preparing meal condiments. The Aspergillus tubingensis strain has not been subjected to mutation training, has the ability to produce high amounts of glutaminase, ferulic acid esterase, glucosidase, pectinase and protease, and is applied to soy sauce brewing, thereby achieving high-value utilization of meal raw materials, increasing the amino acid content in soy sauce, and enhancing the flavor and nutritional value of soy sauce.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to Aspergillus tubingensis and application thereof in preparing meal seasonings. Background Art

[0002] Soy sauce, as a traditional Chinese condiment with a long history, has a unique flavor derived from a complex fermentation process. This process relies on enzymes produced by a variety of microorganisms, which convert macromolecules and medium-molecular substances in the raw materials into small molecules through biological metabolism. Aspergillus tubingensis ) is taxonomically similar to Aspergillus niger, both belonging to the genus Aspergillus Aspergillus nigricans Branch. The application of Aspergillus tubingensis in the prior art mainly focuses on using Aspergillus tubingensis to degrade plastics. CN118497003A found that Aspergillus tubingensis has the potential to convert ethanol into acetic acid, and Aspergillus tubingensis is used in vinegar fermentation. There is currently no report on the application of Aspergillus tubingensis in soy sauce fermentation. In addition, there are few related studies on fermenting meal soy sauce solely by natural microorganisms. It is difficult to increase the amino acid content in meal soy sauce by fermenting with natural wild strains. Summary of the invention

[0003] The purpose of the present invention is to overcome the problems existing in the prior art and provide a strain of Aspergillus tubingensis and application thereof.

[0004] In order to achieve the above object, the present invention provides a strain of Aspergillus tubingensis in a first aspect. The deposit number of the Aspergillus tubingensis is CGMCC No.41728.

[0005] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising Aspergillus tubingensis and koji material as described above.

[0006] A third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: inoculating the aforementioned Aspergillus tubingensis into koji material for culturing.

[0007] A fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method comprises: mixing soy sauce koji with salt water for fermentation.

[0008] The fifth aspect of the present invention provides use of the aforementioned Aspergillus tubingensis or the aforementioned composition in the preparation of condiments.

[0009] Through the above technical scheme, the Aspergillus tubingensis has not been subjected to mutagenesis training, has the ability to produce high glutaminase, ferulic acid esterase, glucosidase, pectinase and protease, and the Aspergillus tubingensis is applied to soy sauce brewing, which can achieve high-value utilization of meal raw materials, increase the amino acid content in soy sauce, and enhance the flavor and nutritional value of soy sauce. According to a preferred embodiment of the present invention, the koji material contains meal raw materials, and the pectinase activity of the obtained soy sauce koji is particularly high.

[0010] Biological Deposit

[0011] The strain provided by the present invention is classified and named as Aspergillus tubingensis Aspergillus tubingensis , was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (abbreviated as CGMCC) on December 23, 2024. Its deposit number is CGMCC No.41728, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is the colony morphology of Aspergillus tubingensis CCNH058 of the present invention on the Chaga agar medium. DETAILED DESCRIPTION

[0013] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0014] The first aspect of the present invention provides a strain of Aspergillus tubingensis, the deposit number of the Aspergillus tubingensis is CGMCC No. 41728, and it is numbered as CCNH058 in the present invention.

[0015] The Aspergillus tubingensis of the present invention is cultured on cha-agar at 28-30° C. for 7 days, and has a diameter of 65-70 mm, is flat, and has a velvety texture; the hyphae are white when they are first born, gradually turn into brown and black, have no exudate, and the back of the colony is yellow-brown. Figure 1 The conidia head is spherical and brown-black; the apical capsule is swollen, and two rounds of small stalks are densely distributed on the apical capsule in a radial pattern; the conidia are spherical, about 3-4 μm in diameter, with an uneven surface, small thorns, and often in a string.

[0016] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising Aspergillus tubingensis and koji material as described above.

[0017] According to the present invention, preferably, the content of Aspergillus tubingensis is 0.5-1 wt % of the dry weight of the koji material calculated as spore content.

[0018] Furthermore, the koji material is a mixture of meal raw materials, bran and water.

[0019] A third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: inoculating the aforementioned Aspergillus tubingensis into koji material for culturing.

[0020] According to the present invention, preferably, the culture conditions include: a culture temperature of 28-32° C., a culture environment humidity of 80-90%, and a culture time of 48-96 h.

[0021] Furthermore, the culture conditions include: a culture temperature of 28-30°C, a culture environment humidity of 85-90%, and a culture time of 48-72h.

[0022] Furthermore, the koji material is a mixture of meal raw materials, bran and water.

[0023] According to the present invention, preferably, the mass ratio of meal raw material, water and bran is 2-4:1-3:1.

[0024] Furthermore, the mass ratio of meal raw materials, water and bran is 3-4:2-3:1.

[0025] According to the present invention, the meal raw material may be a byproduct remaining after common seed oils and fats are extracted in the art. Preferably, the meal raw material is at least one of flax meal, rapeseed meal and peanut meal.

[0026] A fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method comprises: mixing soy sauce koji with salt water for fermentation;

[0027] Preferably, the fermentation method is low-salt solid-state fermentation or high-salt dilute-state fermentation.

[0028] According to the present invention, the method of mixing the soy sauce koji and the brine can refer to the conventional mixing method in the art, as long as the purpose of the present invention can be achieved.

[0029] According to the present invention, preferably, the conditions of the low-salt solid-state fermentation include: the mass ratio of soy sauce koji to brine is 1:1-2;

[0030] and / or, the concentration of the brine is 10-17wt%;

[0031] And / or, the fermentation conditions include: fermentation temperature of 40-50° C., and fermentation time of 15-25 days.

[0032] In the present invention, low-salt solid-state fermentation is adopted to have high comprehensive enzyme activity, and the contents of glutamic acid, tyrosine and lysine are significantly improved. The obtained soy sauce product has the advantages of enhanced umami taste, moderate saltiness and reduced bitterness.

[0033] According to the present invention, preferably, the conditions of high-salt dilute fermentation include: the mass ratio of soy sauce koji to brine is 1:1.5-2.5;

[0034] and / or, the concentration of the brine is 20-22wt%;

[0035] And / or, the fermentation conditions include: fermentation temperature of 28-30° C., and fermentation time of 100-180 days.

[0036] In the present invention, high-salt dilute fermentation is adopted to have higher comprehensive enzyme activity and significantly improve the total amino acid content, and the obtained soy sauce product has the characteristics of strong salty and fresh taste and mellow sauce aroma.

[0037] The fifth aspect of the present invention provides use of the aforementioned Aspergillus tubingensis or the aforementioned composition in the preparation of condiments.

[0038] According to the present invention, the condiments include but are not limited to soy sauce, soybean paste, bean paste and fermented black beans.

[0039] According to the present invention, the method for preparing the seasoning can be a conventional method in the art, and those skilled in the art can select one according to their needs.

[0040] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention, and are not intended to limit the present invention.

[0041] Unless otherwise specified, the reagents and materials used in the following examples were purchased from regular chemical reagent suppliers and were of analytical grade.

[0042] In the following embodiments:

[0043] The activity of glutaminase is defined as: one unit of enzyme activity is defined as the amount of glutamine produced by one gram of soy sauce koji per minute at 37°C and pH 7.0. Glutamine is hydrolyzed into L-glutamic acid and ammonia by glutaminase. The rate of ammonia increase is detected by Nessler's reagent, and the absorbance at 420 nm is detected by an enzyme reader or a visible spectrophotometer, and quantification is performed by the standard curve method.

[0044] The activity of pectinase is defined as: under the conditions of 50°C and pH 3.5, one unit of enzyme activity is the amount of galacturonic acid produced by decomposing pectin per gram of soy sauce koji per hour. Pectinase hydrolyzes pectin to produce galacturonic acid, which has a reducing aldehyde group and reacts with DNS reagent to produce a reddish-brown substance. The absorbance at 540 nm is detected by an ELISA reader or a visible light spectrophotometer, and quantification is performed by the standard curve method.

[0045] The activity of ferulic acid esterase is defined as: at 40℃, pH 6.0, one unit of enzyme activity is defined as the hydrolysis of p-nitrophenyl ferulate per gram of soy sauce koji per minute to generate 1 nmol of p-nitrophenol. Ferulic acid esterase catalyzes the decomposition of the substrate p-nitrophenyl ferulate to generate p-nitrophenol, which has a maximum absorption peak at 405nm. The activity of ferulic acid esterase is calculated by measuring the rate of increase of absorbance.

[0046] The activity of glucosidase is defined as: at 37°C and pH 5.0, one unit of enzyme activity is defined as the production of 1 nmol of p-nitrophenol per minute per gram of soy sauce koji. α-Glucosidase decomposes p-nitrophenyl-α-D-pyranoglucoside to generate p-nitrophenol, and β-glucosidase decomposes p-nitrophenyl-β-D-pyranoglucoside to generate p-nitrophenol. p-Nitrophenol has a maximum absorption peak at 400nm. The activity of glucosidase is calculated by measuring the rate of increase of absorbance.

[0047] The definition of protease activity is: under the condition of 30℃, 1 unit of enzyme activity is the catalytic hydrolysis of 1 nmol tyrosine per minute per gram of soy sauce koji. Protease hydrolyzes casein to produce tyrosine; tyrosine reduces phosphomolybdic acid to produce tungsten blue; tungsten blue has a characteristic absorption peak at 680nm, and the rate of increase of absorbance at 680nm is measured to calculate the protease activity. The results measured under alkaline (pH=10.5), acidic (pH=3.0) and neutral (pH=7.5) conditions are added together as the protease activity.

[0048] The test methods for amino acid nitrogen and total nitrogen refer to GBT18186-2000.

[0049] The test methods for total acid and pH refer to GB 12456-2021.

[0050] The culture medium formula used in the following examples is as follows:

[0051] Truffle agar medium: 3 g sodium nitrate, 1 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate, 0.01 g ferrous sulfate, 0.5 g potassium chloride, 30 g sucrose, 15 g agar, and 1 L distilled water.

[0052] PDA medium: 200 g peeled potatoes, 20 g glucose, 18 g agar, and 1 L distilled water.

[0053] The reference strain Huniang 3.042 (Aspergillus oryzae) was purchased from the Chinese Institute of Food Fermentation Industries, and the collection number of the strain is CICC 2339.

[0054] Example 1

[0055] This example is used to illustrate the screening and identification of Aspergillus tubingensis CCNH058 described in the present invention.

[0056] (1) Screening of strains: The Aspergillus tubingensis described in the present invention was isolated from the fermented food manufacturing process. The sample dilution was applied to a PDA solid culture medium using a gradient dilution method and cultured at 30°C for 5 days. After the colonies grew, the colonies were picked and streaked on the plate to obtain single colonies. A filamentous fungus with a high comprehensive enzyme activity was obtained by rapid detection and screening using a protease and cellulase activity plate, and was numbered CCNH058.

[0057] (2) Morphological identification: It grows rapidly on chaga agar medium. After culturing for 7 days at 30°C, the diameter can reach 65-70 mm. It is flat and has a velvety texture. The mycelium is white when it is first born, gradually turning into brown and black. There is no exudate. The back of the colony is yellow-brown. Figure 1 The conidia head is spherical and brown-black; the apical capsule is swollen, and two rounds of small stalks are densely distributed on the apical capsule in a radial pattern; the conidia are spherical, about 3-4μm in diameter, with an uneven surface, small thorns, and often in a string.

[0058] (3) Molecular identification: The ITS sequence of the above single strain was sequenced, and its ITS sequence is shown in SEQ ID NO.1.

[0059] SEQ ID NO.1:

[0060] CCTTCCGTAGGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。

[0061] The β-tubulin gene sequence of the above single strain was sequenced, and its β-tubulin gene sequence is shown in SEQ ID NO.2.

[0062] SEQ ID NO.2:

[0063] ATTACCCTCAAGTTAGTGACCCTTGGCCCAGTTGTTACCAGCACCGGACTGGCCGAAGACGAAGTTGTCGGGGCGGAAGAGCTGGCCGAAGGGACCGGCACGGACGGCGTCCATGGTACCGGGCTCGAGATCGACGAGGACGGCACGGGGGACATACTTGTTACCGCTAGCCTGCTGAAGTGGTCAGGACATTGATGATATTGTCGTGAAAAAACTCAGGGACGGTGTGATCTAACCTCGTTGAAGTAGACGTTCATGCGCTCCAGCTGGAGGTCGGAGGTGCCATTGTAACTATCCTGCGCGTCAGGAAACCCAATCCTTTCCACATTGTTGACCAATTGAGAGGTGTGAAAAAGTTGTACTTACACACCGGAGCCGTCAAGGCCGTGCTCGCCAGAGATGGTCTGCCTGTTGAGTTGTTAGACGTGTTCTTAACCCGATAGCTATATACCCGATGGATAACATCTGAACTCAAGCTAAGATAGCTTGAGAGATGATGTTCCATCCCCAATCCAGTGGCAGTGAATACGTACCAGAAAGCAGCACCGTTTTTGGTTACCA。

[0064] The calmodulin gene sequence of the above single strain was sequenced, and its calmodulin gene sequence is shown in SEQ ID NO.3.

[0065] SEQ ID NO.3:

[0066] .

[0067] The obtained ITS sequences were compared with the NCBI database, and strain CCNH058 had the highest homology with Aspergillus tubingensis (GenBank: MK636652.1), with a sequence identity of 99.9%.

[0068] The obtained β-tubulin sequence was compared with the NCBI database, and CCNH058 had the highest homology with Aspergillus tubingensis (GenBank: MG991381.1), with a sequence identity of 100%.

[0069] The obtained calmodulin sequence was compared with the NCBI database, and CCNH058 had the highest homology with Aspergillus tubingensis (GenBank: MG832135.1), with a sequence identity of 100%.

[0070] Based on the above morphological and molecular identification results, it was finally determined that strain CCNH058 belonged to Aspergillus tubingensis ( Aspergillus tubingensis ), the Aspergillus tubingensis CCNH058 was sent to a depository for preservation with the deposit number CGMCC No.41728.

[0071] Example 2

[0072] This example is used to illustrate the preparation process of soy sauce koji and the enzyme activity in soy sauce koji.

[0073] (1) Crush the large block and cake-like meal materials (Table 1) to a particle size of 2 mm and a powder amount of 10 wt%. Mix the meal materials with bran (mass ratio of 7:3) and add distilled water to reach a water content of 45 wt%. Steam the resulting koji material at 120 °C for 20 min and cool to about 30 °C for use.

[0074] (2) PDA medium was used to purify and propagate the strain. After culturing at 30°C for 72 hours, mature Aspergillus tubingensis CCNH058 spores were collected and inoculated into the koji material with 0.06wt% of the spores. The koji material was inoculated in a constant temperature and humidity incubator at 30°C and 90% humidity for 72 hours in the dark to obtain Aspergillus tubingensis CCNH058 soy sauce koji. According to the same method, spores of Shanghai Niang 3.042 were inoculated into the koji material to obtain Shanghai Niang 3.042 soy sauce koji as a reference. The enzyme activities of glutaminase, ferulic acid esterase, protease, glucosidase and pectinase in the soy sauce koji were measured.

[0075] (3) The results are shown in Table 1. The parameters of Shanghai Niang 3.042 soy sauce koji were used as the standard, expressed as 1.00, and the parameters of Aspergillus tubingensis CCNH058 soy sauce koji were converted into corresponding ratios. The activities of glutaminase, ferulic acid esterase, glucosidase, and pectinase in Aspergillus tubingensis CCNH058 soy sauce koji were significantly higher than those in Shanghai Niang 3.042 soy sauce koji, and the protease activity was equivalent to that in Shanghai Niang 3.042 soy sauce koji.

[0076] Table 1

[0077]

[0078] Example 3

[0079] This example is used to illustrate the application of Aspergillus tubingensis CCNH058 in salt-reduced fermented soy sauce.

[0080] (1) Aspergillus tubingensis CCNH058 and Shanghai Niang 3.042 as a reference were made into koji according to the method of Example 2 to obtain finished koji. The finished koji and 11wt% brine were mixed evenly in a mass ratio of 1:1.3, and fermented at 45°C for 20 days to obtain sauce mash. During the fermentation, water was added and stirred once every 48 hours to keep the moisture content of the sauce mash constant. After the fermentation was completed, 11wt% brine with a mass of 70% of the finished koji mass was added to the sauce mash, and the crude oil was obtained by pouring oil twice, and the amino acid nitrogen, total acid, total nitrogen and amino acid content in the crude oil were determined.

[0081] (2) The amino acid nitrogen content of crude soy sauce from peanut meal prepared by fermentation strain Aspergillus tubingensis CCNH058 reached 0.79 g / 100 mL; the amino acid nitrogen content of crude soy sauce from rapeseed meal reached 0.71 g / 100 mL; and the amino acid nitrogen content of crude soy sauce from flax meal reached 0.75 g / 100 mL.

[0082] (3) The parameters of Shanghai Brewing 3.042 crude oil were expressed as 1.00 as the standard, and the parameters of Aspergillus tubingensis CCNH058 crude oil were converted into corresponding ratios. The contents of amino acid nitrogen, total nitrogen and glutamic acid in Aspergillus tubingensis CCNH058 crude oil were significantly higher than those in the crude oil produced from Shanghai Brewing 3.042, and both reached the first-class level.

[0083] (4) The contents of glutamic acid, glycine, lysine and total amino acids in the three types of crude soy sauce meal prepared by Aspergillus tubingensis CCNH058 were higher than those in the crude soy sauce meal prepared by the reference strain Shanghai Niang 3.042, which may be an important indicator for improving the umami taste of soy sauce. The contents of aspartic acid, threonine, glutamic acid, glycine, tyrosine and lysine in the flax cake crude soy sauce prepared by Aspergillus tubingensis CCNH058 were significantly higher than those in the crude soy sauce prepared by the reference strain Shanghai Niang 3.042; the contents of aspartic acid, threonine, serine, glutamic acid, proline, glycine, alanine, valine, leucine, tyrosine, lysine, phenylalanine and arginine in the rapeseed meal crude soy sauce prepared by Aspergillus tubingensis CCNH058 were significantly higher than those in the crude soy sauce prepared by the reference strain Shanghai Niang 3.042; the contents of aspartic acid, glutamic acid, proline, tyrosine, lysine, phenylalanine, lysine and arginine in the peanut meal soy sauce prepared by Aspergillus tubingensis CCNH058 were significantly higher than those in the crude soy sauce prepared by the reference strain Shanghai Niang 3.042. Compared with the reference strain Shanghai Brewing 3.042, Aspergillus tubingensis CCNH058 significantly increased the content of glutamic acid, tyrosine and lysine in meal soy sauce, which has a positive effect on the formation of the umami flavor of soy sauce and is beneficial for supplementing essential amino acids for the human body.

[0084] The measurement results are shown in Tables 2 and 3.

[0085] Table 2

[0086]

[0087] Table 3

[0088]

[0089] Example 4

[0090] This example is used to illustrate the sensory evaluation of soy sauce fermented by Aspergillus tubingensis CCNH058.

[0091] The color, flavor and state of Shanghai Brewing 3.042 fermented soy sauce and Aspergillus tubingensis CCNH058 fermented soy sauce (prepared according to the method of Example 3) were blindly evaluated. The test results are shown in Table 4.

[0092] Table 4

[0093]

[0094] As shown in Table 4, compared with the soy sauce fermented by Shanghai Brewing 3.042, the soy sauce fermented by Aspergillus tubingensis CCNH058 has enhanced umami taste, moderate saltiness, and reduced bitterness, which is related to the relatively higher content of glutamic acid, aspartic acid, glycine, lysine, etc. In summary, compared with Shanghai Brewing 3.042, Aspergillus tubingensis CCNH058 is more suitable for low-salt solid soy sauce fermentation.

[0095] Example 5

[0096] The present invention is used to illustrate the application of Aspergillus tubingensis CCNH058 in condiments.

[0097] According to the same method as in Example 2, Aspergillus tubingensis CCNH058 was made into koji to obtain finished koji, and the finished koji and 11wt% brine were mixed evenly in a mass ratio of 1:1.3, and fermented at 45°C for 20 days to obtain sauce mash, during which water was replenished and stirred once every 48 hours to keep the moisture content of the sauce mash constant. Add brine with a salt concentration of 15-20% twice the weight of the sauce mash, and separate the brine after salting for 22 days. The solid sauce mash was sprinkled with salt and pressed on a plate, and matured at room temperature to obtain the sauce mash. After the sauce mash was blended and sterilized, the soybean paste was obtained. The amino acid nitrogen content of peanut meal paste prepared by Aspergillus tubingensis CCNH058 is 0.88g / 100g, and the total nitrogen content is 1.65g / 100g; the amino acid nitrogen content of flax cake meal paste is 0.84g / 100g, and the total nitrogen content is 1.64g / 100g; the amino acid nitrogen content of rapeseed meal paste is 0.84g / 100g, and the total nitrogen content is 1.64g / 100g.

[0098] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A tubingensis Aspergillus tubingensis ), characterized in that, The deposit number of the Aspergillus tubingensis is CGMCC No.41728.

2. A composition for preparing soy sauce koji, characterized in that: The composition comprises the Aspergillus tubingensis according to claim 1 and koji material.

3. The composition according to claim 2, wherein The content of Aspergillus tubingensis is 0.5-1wt% of the dry weight of the koji material in terms of spore content; And / or, the koji material is a mixture of meal raw materials, bran and water.

4. A method for preparing soy sauce koji, characterized in that: The method comprises: inoculating the Aspergillus tubingensis described in claim 1 into koji material for culturing.

5. The preparation method according to claim 4, wherein The culture conditions include: a culture temperature of 28-32°C, a culture humidity of 80-90%, and a culture time of 48-96h; And / or, the koji material is a mixture of meal raw materials, bran and water.

6. The preparation method according to claim 5, wherein: The mass ratio of meal raw materials, water and bran is 2-4:1-3:

1.

7. A method for brewing soy sauce, characterized in that: The method comprises: preparing soy sauce koji according to the preparation method according to any one of claims 4 to 6, and mixing the soy sauce koji with salt water for fermentation; The fermentation method is low-salt solid-state fermentation or high-salt dilute-state fermentation.

8. The brewing method according to claim 7, wherein: The conditions of the low-salt solid-state fermentation include: the mass ratio of soy sauce koji to salt water is 1:1-2; and / or, the concentration of the brine is 10-17wt%; And / or, the fermentation conditions include: fermentation temperature of 40-50° C., and fermentation time of 15-25 days.

9. The brewing method according to claim 7, wherein: The conditions of high-salt dilute fermentation include: the mass ratio of soy sauce koji to salt water is 1:1.5-2.5; and / or, the concentration of the brine is 20-22wt%; And / or, the fermentation conditions include: fermentation temperature of 28-30° C., and fermentation time of 100-180 days.

10. Use of the Aspergillus tubingensis according to claim 1 or the composition according to claim 2 or 3 in preparing condiments.

Images