Engineering strain for fermentation production of citric acid as well as construction method and application of engineering strain

Abstract

The invention belongs to the technical field of gene engineering and fermentation engineering, and particularly relates to an engineering strain for fermentation production of citric acid and a construction method and application thereof. According to the invention, a saccharifying enzyme gene expression cassette for efficiently expressing a saccharifying enzyme gene mutant glaA is used for site-specific substitution of specific genes on an aspergillus niger industrial strain for fermentation production of citric acid, and the saccharifying enzyme gene mutant glaA is knocked in while the genes are knocked out, so that an engineering strain capable of effectively reducing the residual sugar content of fermentation liquor can be constructed. When the engineering strain is used for fermentation production of citric acid, the utilization rate of saccharides and the yield of citric acid can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and fermentation engineering, and specifically relates to an engineering strain for producing citric acid by fermentation, and a construction method and application thereof. Background Art

[0002] Citric acid is an important organic acid, widely used in food, medicine, daily chemical and other industries, and is the world's second largest fermentation product. my country is the main producer and exporter of citric acid. At present, 99% of citric acid is produced by using Aspergillus niger liquid deep fermentation. The unit grain consumption of citric acid fermentation is still around 1.75 t, the residual sugar in fermentation is about 2%-3%, the sugar-acid conversion rate is around 95%, and the residual sugar formed by fermentation in one year is at least about 190,000 tons. This production method not only causes a waste of raw materials, but also, because the fermentation broth contains a large amount of residual sugar, when the fermentation waste liquid is discharged into the environment, the chemical oxygen demand increases, which will bring great pressure to environmental protection requirements. Therefore, it is necessary to reduce the residual sugar content in the fermentation broth. Summary of the invention

[0003] In view of the above problems, the present invention provides an engineered strain for producing citric acid by fermentation, and a construction method and application thereof. glaA The expression cassette replaced the specific gene in Aspergillus niger, which significantly reduced the residual sugar content in the fermentation broth for citric acid production and improved the sugar utilization rate and citric acid yield.

[0004] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical scheme: The first aspect of the present invention provides an engineered strain for producing citric acid by fermentation: the engineered strain is constructed by replacing a gene to be knocked out in a citric acid industrial strain with a saccharifying enzyme gene expression cassette; the citric acid industrial strain is Aspergillus niger; the gene to be knocked out includes at least one of gene 52452, gene 50927, gene 50055, gene 49940 and gene 40261 whose nucleotide sequences are respectively shown in SEQ ID NO.1 to SEQ ID NO.5; the saccharifying enzyme gene expression cassette comprises a filamentous fungus promoter, a saccharifying enzyme gene mutant glaA gene and a terminator, the saccharifying enzyme gene mutant glaA Encodes the amino acid sequence shown in SEQ ID NO.6.

[0005] The present invention analyzes the residual sugar content and residual sugar composition in the fermentation broth of large-scale fermentation to produce citric acid and finds that the main component of the residual sugar in the fermentation broth is non-fermentable isomaltose, accounting for about 69%, and the remaining residual sugar components are α-D-pyranose and other non-fermentable isomaltotriose and sucrose.

[0006] The present invention first discovered that the gene with the nucleotide sequence shown in SEQ ID NO.1 to SEQ ID NO.5 in Aspergillus niger can encode an α-glucosidase with transglycosidic activity, which can transfer the free glucose residue to another sugar substrate to form an α-1,6 glycosidic bond. After knocking it out, it can prevent or reduce the formation of non-fermentable oligosaccharides (mainly including isomaltose, panose, isomaltotriose, etc.). The function of the above gene and its relationship with residual sugar formation during citric acid fermentation have not been reported.

[0007] Filamentous fungus promoter, saccharifying enzyme gene mutant glaA The saccharifying enzyme gene expression cassette constructed by the gene and terminator can efficiently express the saccharifying enzyme gene mutant glaA , the saccharifying enzyme gene mutant glaA The present invention utilizes the saccharifying enzyme gene expression cassette to site-specifically replace the genes with nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.5 on the industrial strain of Aspergillus niger used for fermentation and production of citric acid, and knocks in the saccharifying enzyme gene mutant while knocking out these genes. glaA , thus being able to construct an engineered strain that can effectively reduce the residual sugar content in the fermentation broth. Using the engineered strain to ferment and produce citric acid can improve sugar utilization and citric acid production.

[0008] Preferably, the gene to be knocked out includes at least one of gene 50927, gene 50055 and gene 40261 whose nucleotide sequences are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.5 respectively. The above three genes are replaced with a highly efficient saccharifying enzyme gene mutant glaA After adding the saccharifying enzyme gene expression cassette, the effect of reducing the residual sugar content is more prominent.

[0009] Preferably, the saccharifying enzyme gene mutant glaA The nucleotide sequence is shown in SEQ ID NO.7.

[0010] Preferably, the nucleotide sequence of the filamentous fungus promoter is as shown in SEQ ID NO.8 or SEQ ID NO.9, both of which have high activity.

[0011] Preferably, the terminator is the terminator Tglucan.

[0012] Preferably, the citric acid industrial strain is Aspergillus niger An.YX0607 .

[0013] Further preferably, the gene to be knocked out is gene 50927, gene 50055 or gene 40261.

[0014] Further preferably, the nucleotide sequence of the filamentous fungus promoter is shown as SEQ ID NO.8.

[0015] In the present invention, the method of replacing the above-mentioned gene with the saccharifying enzyme gene expression cassette can adopt conventional means in the art.

[0016] The second aspect of the present invention provides a method for constructing the above-mentioned engineered strain, which specifically comprises the following operations: The filamentous fungus promoter, saccharifying enzyme gene mutant were cloned and expressed by overlapping extension PCR. glaA and terminator to construct a saccharifying enzyme expression cassette; constructing a donor DNA fragment containing the saccharifying enzyme gene expression cassette and a targeted knockout plasmid containing the target sequence of the corresponding gene to be knocked out according to CRISPR-Cas9 technology; The targeted knockout plasmid and the donor DNA fragment containing the saccharifying enzyme expression box are transferred into the citric acid industrial strain, and the engineered strain for producing citric acid by fermentation is obtained by screening.

[0017] This construction method does not limit the order of preparing the targeted knockout plasmid and the donor DNA fragment containing the saccharifying enzyme expression cassette.

[0018] The above construction method can transform the mutant containing the saccharifying enzyme gene glaA The expression cassette was used to site-specifically replace the gene to be knocked out on Aspergillus niger, and the resulting engineered strain could effectively reduce the residual sugar content in the fermentation broth, and improve the sugar utilization rate and citric acid yield.

[0019] Exemplarily, the method for constructing a donor DNA fragment containing the saccharifying enzyme gene expression cassette according to CRISPR-Cas9 technology can be performed as follows: Add at the 5' end of the saccharifying enzyme expression cassette Bgl II restriction site, added at the 3' end BamH I restriction site; amplify the upstream homology arm LB and downstream homology arm RB of the gene to be knocked out by PCR technology, and add Xho I restriction site, added at the 3' end Bgl II restriction site, add a restriction endonuclease II restriction site at the 5' end of the downstream homology arm RB sequence BamH I restriction site, added at the 3' end Hind III restriction site; the upstream homology arm LB and the downstream homology arm RB are respectively connected to the saccharifying enzyme expression box to obtain the donor DNA fragment.

[0020] Preferably, the reaction system of the above PCR is:

[0021] The PCR reaction conditions were as follows: denaturation at 98°C for 2 min; then denaturation at 98°C for 30 sec, annealing at 58°C for 30 sec, and extension at 72°C for 30 sec for 35 cycles; and then extension at 72°C for 2 min.

[0022] Exemplarily, the method for constructing a targeted knockout plasmid containing the corresponding gene to be knocked out according to CRISPR-Cas9 technology can be performed as follows: pass Bbs I digested the target sequence of the gene to be knocked out and connected it to the pUC57-sgRNA plasmid to construct an intermediate knockout plasmid containing a single target; Xho Ⅰ and BamH Ⅰ digest the target sequence to obtain a sgRNA expression cassette containing a single target, and use Xho Ⅰ and Bgl IⅠ enzyme digestion of the intermediate knockout plasmid containing a single target site, BamH Ⅰ and Bgl IⅠ and tail enzyme ligation were used to construct an intermediate knockout plasmid containing dual targets. Bgl II and Pac I enzyme digestion to obtain the dual-target sgRNA expression cassette fragment, and the resulting fragment was ligated to Bgl II and Pac The targeted knockout plasmid was constructed on the pFC332 plasmid digested with I.

[0023] Preferably, the method for constructing an intermediate knockout plasmid containing dual targets can be performed as follows: Add using the 5´ end Xho The upstream primer SGF and the 3' end of the restriction site were added BamH The target sequence expression cassette was amplified by PCR using the downstream primer SGR of the restriction site I. Xho Ⅰ and BamH Ⅰ, respectively, to obtain a sgRNA expression cassette containing a single target; Xho Ⅰ and Bgl IⅠ enzyme digestion of the intermediate knockout plasmid containing a single target site to recover the connection vector; use BamH Ⅰ and Bgl The sgRNA expression cassette containing a single target site is connected to the recovered connection vector by IⅠ homozygote to construct an intermediate knockout plasmid containing dual targets; the sequence (5′→3′) of the upstream primer SGF is CTCGAGAACTGCTGAGATCTCACATAC; the sequence (5′→3′) of the downstream primer SGR is GGATCCTCAAAAAAGCACCGACTCGGT.

[0024] Further preferably, the reaction system of the above enzyme cleavage is:

[0025] The reaction conditions of the enzyme digestion are: 37°C for 3h and 65°C for inactivation.

[0026] The reaction system of the above connection is:

[0027] The ligation reaction conditions are: ligation at 37°C for 30 min.

[0028] Preferably, the transformation method used to transfer the targeted knockout plasmid and the donor DNA fragment containing the saccharifying enzyme expression cassette into the starting strain of Aspergillus niger is a PEG-mediated protoplast transformation method.

[0029] The third aspect of the present invention provides the use of the above-mentioned engineered strain in the fermentation production of citric acid.

[0030] The fourth aspect of the present invention provides a method for reducing the residual sugar content in a fermentation broth for producing citric acid by fermentation, wherein the engineered strain is used to produce citric acid by fermentation.

[0031] Preferably, after activating and culturing the engineered strain, the conidia are washed with YPD liquid culture medium to prepare a spore suspension, which is then inoculated into a fermentation medium to produce citric acid by fermentation.

[0032] Further preferably, the fermentation medium is a corn paste fermentation medium, which is a medium prepared by enzymatic hydrolysis of corn flour with α-amylase.

[0033] Optionally, the preparation method of the corn paste fermentation medium is: corn flour is liquefied at 90° C. for 1 hour with a thermostable α-amylase, and the turbid liquid and the clear liquid are filtered and mixed in a ratio of 1:4 to obtain the corn paste fermentation medium.

[0034] The beneficial effects of the present invention are as follows: the present invention utilizes a filamentous fungus promoter and a high-activity saccharifying enzyme gene mutant having no transglycosidation activity. glaA Constructing efficient expression glaA The expression cassette is used to site-specifically replace at least one of gene 52452, gene 50927, gene 50055, gene 49940 and gene 40261 on the genome of the citric acid production strain, and knock in the saccharifying enzyme gene mutant while knocking out the above genes. glaA. The knockout gene prevents the formation of isomaltose, and the knock-in saccharifying enzyme gene mutant glaA It can improve the hydrolysis efficiency of sugars, thereby reducing the residual sugar content in the fermentation broth, improving sugar utilization, and increasing citric acid yield.

[0035] The present invention proves through experiments that the use of Aspergillus niger An.YX0607The engineered strain obtained by the above genetic modification as the starting strain produced citric acid by fermentation. After 96 h of fermentation, An.YX0607 In contrast, engineered strains An52452、An50927、An50055、An49940、An40261 The content of isomaltose in the fermentation broth was reduced by 5.75%, 33.32%, 34.24%, 10.82% and 32% respectively, and the citric acid production was increased by 4.55%, 5.63%, 1.37%, 6.75% and 3.79% respectively, which has a significant invention effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Aspergillus niger is used in Example 2 of the present invention An.YX0607 Figure 2. Determination of isomaltose content after 96 h of fermentation with different mutant strains; Figure 2 Aspergillus niger is used in Example 2 of the present invention An.YX0607 Citric acid content determination diagram after 96 h of fermentation with different mutant strains. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0038] The production of citric acid by Aspergillus niger liquid deep fermentation method produces a large amount of residual sugar, and the sugar utilization rate is low. The present invention has found through research that the main component of the above residual sugar is non-fermentable isomaltose, and the rest is α-D-pyranose glucose and other non-fermentable isomaltotriose and sucrose. The generation of a large amount of residual sugar not only wastes raw materials, but also increases the chemical oxygen demand in the fermentation wastewater, which brings great pressure to environmental protection requirements.

[0039] The formation of non-fermentable isomaltose, isomaltotriose and panose is related to α-glucosidase, but different α-glucosidases have different functions. For example, some α-glucosidases can cleave α-1,4 glycosidic bonds from the non-reducing ends of oligosaccharide or polysaccharide substrates to release glucose (hydrolysis activity); under certain conditions, they can also transfer the free glucose residues to another carbohydrate substrate to form α-1,6 glycosidic bonds (transglycosylation activity), thereby forming non-fermentable oligosaccharides (mainly including isomaltose, panose, isomaltotriose, etc.); some α-glucosidases can hydrolyze α-1,2 and / or α-1,3 glycosidic bonds and catalyze the formation of α-1,3 and / or α-1,2 glycosidic bonds through transglycosylation, so that these α-glucosidases participate in the N-glycosylation modification of proteins and form a variety of physiological functions. Therefore, not all α-glucosidases can be used to regulate the production of non-fermentable oligosaccharides.

[0040] To address this problem, the present invention has discovered for the first time a gene that can encode an α-glucosidase with transglycosidation activity, namely a gene whose nucleotide sequence is shown in SEQ ID NO.1 to SEQ ID NO.5, and has determined for the first time its relationship with residual sugar formation during citric acid fermentation.

[0041] Based on this, the embodiment provides an engineered strain for fermentation production of citric acid: the engineered strain is constructed by replacing the gene to be knocked out in the citric acid industrial strain with a saccharifying enzyme gene expression cassette; the citric acid industrial strain is Aspergillus niger; the gene to be knocked out includes at least one of gene 52452, gene 50927, gene 50055, gene 49940 and gene 40261 whose nucleotide sequences are respectively shown in SEQ ID NO.1 to SEQ ID NO.5; the saccharifying enzyme gene expression cassette includes a filamentous fungus promoter, a saccharifying enzyme gene mutant glaA gene and a terminator, the saccharifying enzyme gene mutant glaA Encodes the amino acid sequence shown in SEQ ID NO.6.

[0042] The embodiment of the present invention also provides a method for constructing the engineered strain.

[0043] The embodiment of the present invention also provides the use of the engineered strain in the fermentation production of citric acid.

[0044] The embodiment of the present invention also provides a method for reducing the residual sugar content in the fermentation broth for producing citric acid by fermentation.

[0045] The scheme of the present invention is described below through specific embodiments.

[0046] The components and preparation methods of the culture medium and reagents used in the following examples are as follows: PDA solid medium (g / L): 200 g of potato, cut into small pieces, add appropriate amount of distilled water and boil for 30 min, filter the filtrate with gauze, 20 g of glucose, 15 g of agar powder. Sterilization conditions are 115 ℃, 20 min; Aspergillus niger liquid medium (g / L): 20 g glucose, 10 g yeast extract, 1 g potassium dihydrogen phosphate, 1 g magnesium sulfate heptahydrate, pH adjusted to 4. Sterilization conditions are 115 °C, 20 min; YPD medium (g / L): 20 g glucose, 5 g yeast extract, 20 g peptone, sterilization conditions: 115 °C, 20 min; MMS medium (g / L): 325.2 g sucrose, 6 g agar powder on the upper layer of MMS, 12 g agar powder on the lower layer of MMS, sterilization conditions are 115 °C, 20 min. When using, add 20 mL 50 × ASPA + N, 2 mL 1 M magnesium sulfate, 1 mL 1000 × trace elements, 1 mL hygromycin B; Corn paste fermentation medium: corn flour was liquefied with thermostable α-amylase at 90°C for 1 hour, and the turbid liquid and the clear liquid were filtered and mixed in a ratio of 1:4 to obtain corn paste fermentation medium.

[0047] SMC: D-sorbitol 242.3 g, anhydrous calcium chloride 5.5 g, MES 2-ethanesulfonic acid hydrate 3.9 g, add 800 mL of deionized water, adjust the pH to 5.8, then add deionized water to 1 L, sterilize at 121 °C for 20 min, and store at 4 °C; Mix lyase solution: Yatalase 0.04 g, β-glucuronidase 54 μL, cellulase 0.1 g, snail enzyme 0.1 g, lyase 0.1 g, lysozyme 0.05 g, dissolved in 10 mL SMC; STC: 242.3 g of D-sorbitol, add 800 mL of deionized water, adjust the pH to 5.8, and then add deionized water to make up to 1 L; PEG Buffer: 2.5 g PEG6000 was dissolved in 10 mL TC and sterilized by filtration using a 0.22 μm water filter membrane; 50 × ASPA + N: Add 297.5 g sodium nitrate, 26.1 g potassium chloride, and 74.8 g potassium dihydrogen phosphate to 800 mL deionized water, adjust the pH to 5.5, and then add deionized water to 1 L, sterilize at 121 °C for 20 min, and store at 4 °C; 1 M MgSO 4:246.5 g of magnesium sulfate heptahydrate was diluted to 1 L, sterilized at 121°C for 20 min, and stored at 4°C; 1000 × trace elements: EDTA 10 g, zinc sulfate heptahydrate 4.4 g, manganese chloride tetrahydrate 1.01 g, cobalt chloride hexahydrate 0.32 g, copper sulfate pentahydrate 0.315 g, ammonium molybdate tetrahydrate 0.22 g, calcium chloride 1.11 g, ferrous sulfate heptahydrate 1 g, add 800 mL deionized water, adjust pH to 4, then add deionized water to 1 L, sterilize at 121 °C for 20 min, and store at 4 °C; Hygromycin stock solution: Dissolve 1 g of hygromycin in 10 mL of deionized water and filter through a 0.22 μm water filter to sterilize.

[0048] Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the materials, reagents, etc. used in the following examples can be obtained from commercial channels.

[0049] Example 1 This embodiment provides an engineered strain for reducing the residual sugar content in fermentation broth and a method for constructing the same.

[0050] 1. Aspergillus niger An.YX0607 Genomic DNA extraction (1) Inoculation of Aspergillus niger An.YX0607 Incubate in PDA medium at 35°C until mature spores grow; (2) Prepare spore suspension, inoculate into YPD liquid medium, and shake at 35°C until spores grow into small balls; (3) Collect the mycelium by filtering through six layers of gauze, wash it three times with sterile ultrapure water, and drain the water; (4) Rapidly freeze with liquid nitrogen and grind into powder; (5) Dispense the bacterial powder into 1.5 mL EP tubes, add 900 μL of lysis buffer, mix well, and centrifuge at 12,000 rpm for 5 min. (6) Transfer the supernatant to another EP tube, add 20 μL of proteinase K (20 mg / mL), and incubate in a 56°C water bath for 2-6 h; (7) Add 30 μL RNase (20 mg / mL) to the EP tube and incubate at 37°C for 1-2 h. (8) Add an equal volume of phenolform (1:1) to the EP tube, shake thoroughly to mix, and centrifuge at 12,000 rpm for 5 min. (9) Repeat step (8) 1-2 times; (10) Transfer the supernatant to a new EP tube, add an equal volume of chloroform, shake thoroughly to mix, and centrifuge at 12,000 rpm for 5 min. (11) Transfer the supernatant to a new EP tube, add 2 BV of anhydrous ethanol, mix by inverting, and place at -80 °C for 20 min. (12) Centrifuge at 12000 r / min for 10 min, discard the supernatant, and wash twice with 600 μL 75% ethanol; (13) Centrifuge at 12000 r / min for 5 min, discard the supernatant, dry it, and add 30 μL of preheated ddH 2 O, and stored at -20℃ for future use.

[0051] 2. Aspergillus niger An.YX0607 Knockout vector construction 2.1 Construction of single target vector Design knockout genes using the online software CRISPOR (http: / / crispor.tefor.net) 52452、50927、 50055、49940、40261 The target sequence is 20 bp long (as shown in Table 1). Bbs The restriction site I has a total of 24 bp and was sent to BGI for gene synthesis. After annealing into double strands, Bbs Ⅰ digest pUC57-sgRNA and connect the synthesized target sequence to the plasmid to construct pUC57-sgRNA-52452-1, pUC57-sgRNA-52452-2; pUC57-sgRNA-50927-1, pUC57-sgRNA-50927-2, pUC57-sgRNA-50055-1, pUC57-sgRNA-50055-2, pUC57-sgRNA-49940-1, pUC57-sgRNA-49940-2, pUC57-sgRNA-40261-1, pUC57-sgRNA-40261-2 targeting plasmids. The annealing program was: 98°C, 10 min, and then naturally cooled to room temperature.

[0052] Table 1 Gene knockout targets

[0053] 2.2 Construction of multi-target vectors Use the 5´ end to add Xho The upstream primer SGF and the 3' end of the restriction site were added BamHThe downstream primer SGR of the restriction site I was used to amplify the expression cassettes of sgRNA-52452-1, sgRNA-50927-1, sgRNA-50055-1, sgRNA-49940-1, and sgRNA-40261-1 by PCR. Xho Ⅰ and BamH Ⅰ Respectively cut the expression cassettes of sgRNA-52452-1, sgRNA-50927-1, sgRNA-50055-1, sgRNA-49940-1, and sgRNA-40261-1, and Xho Ⅰ and Bgl pUC57-sgRNA-52452-2, pUC57-sgRNA-50927-2, pUC57-sgRNA-50055-2, pUC57-sgRNA-49940-2, and pUC57-sgRNA-40261-2 were digested with IⅠ and DNA ligase was used BamH Ⅰ and Bgl The sgRNA expression cassette was connected to the plasmid by IⅠ homozygote to construct the intermediate knockout plasmids pUC57-sgRNA-52452-1-sgRNA-52452-2, pUC57-sgRNA-50927-1-sgRNA-50927-2, pUC57-sgRNA-50055-1-sgRNA-50055-2, pUC57-sgRNA-49940-1-sgRNA-49940-2, and pUC57-sgRNA-40261-1-sgRNA-40261-2. Bgl II and Pac I digested the above intermediate knockout plasmid, recovered sgRNA-52452-1-sgRNA-52452-2, sgRNA-50927-1-sgRNA-50927-2, sgRNA-50055-1-sgRNA-50055-2, sgRNA-49940-1-sgRNA-49940-2, sgRNA-40261-1-sgRNA-40261-2 fragments, and ligated them to the same Bgl II and Pac On the pFC332 plasmid digested with I, pFC332-target-50927-sgRNA, pFC332-target-50055-sgRNA, pFC332-target-49940-sgRNA, pFC332-target-40261-sgRNA, and pFC332-target-52452-sgRNA targeted knockout vectors were constructed, which were connected in series with two sgRNA expression cassettes containing different targets. The enzyme digestion system and ligation system are shown in Tables 3 and 4, respectively.

[0054] Table 2 Primer sequences

[0055] Table 3 Enzyme digestion system

[0056] The reaction conditions of enzyme digestion were: 37 °C for 3 h and inactivation at 65 °C.

[0057] Table 4 Connection system

[0058] The ligation reaction conditions were: ligation at 37°C for 30 min.

[0059] 3. Knock-in of saccharifying enzyme gene mutants glaA Construction of the donor DNA fragment of the gene 3.1 The high-activity filamentous fungus promoter Pglucan720 (nucleotide sequence as shown in SEQ ID NO.8) and the saccharifying enzyme gene mutant were cloned by overlapping extension PCR using primers Pglu720-F, Pglu720-R, GluM13-F, GluM13-R, Tglucan-F, and Tglucan-R (as shown in Table 5). glaA and terminator Tglucan to construct a saccharifying enzyme expression cassette, and at the 5' end of the saccharifying enzyme expression cassette, add Bgl II restriction site, added at the 3' end BamH I restriction enzyme cutting site.

[0060] Table 5 Primer sequences for constructing the saccharifying enzyme expression cassette

[0061] 3.2 PCR technology to Aspergillus niger An.YX0607 The genome was used as a template to amplify the upstream homology arm LB and downstream homology arm RB of the gene shown in nucleotide sequence SEQ ID NO.1 to SEQ ID NO.5 (primer sequences are shown in Table 6), and the 5' end of the LB sequence was added Xho I restriction site, added at the 3' end Bgl II restriction site. Add RB sequence to the 5' end BamH I restriction site, added at the 3' end Hind III restriction site; LB and RB were connected to the saccharifying enzyme expression cassette respectively to obtain the donor DNA fragment.

[0062] Table 6 Primer sequences for amplifying homology arms

[0063] The above PCR reaction system is shown in Table 7.

[0064] Table 7 PCR reaction system

[0065] Reaction conditions: denaturation at 98°C for 2 min; then denaturation at 98°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 30 sec, for 35 cycles; then extension at 72°C for 2 min; finally storage at 4°C and recovery.

[0066] Take 2.5 μL of PCR product for agarose gel electrophoresis to verify the band size.

[0067] 4. Protoplast-mediated transformation of Aspergillus niger with knockout vector and donor DNA fragment 4.1 Aspergillus niger An.YX0607 Cultivation of spores and preparation of spore suspension (1) Aspergillus niger An.YX0607 Spores were inoculated on PDA slant medium and cultured in a 35°C incubator for 2-4 days; (2) Wash the conidia with fresh YPD liquid medium, count them using a hemocytometer, and dilute the spore suspension to a certain concentration for later use.

[0068] 4.2 Protoplast preparation (1) Take 1×10 8 / mL spore suspension was inoculated into 100 ml Aspergillus niger liquid culture medium and cultured at 35℃ for 2 days.

[0069] (2) Collect the mycelium using a sterile four-layer lens paper, wash once with SMC, take less than 0.5 g of mycelium and add it to the mixed enzyme lysis solution. Place it in a 32°C water bath shaker at 120 rpm. After 1 hour, observe the protoplasts under a microscope every 30 minutes until a large number of protoplasts appear in the field of view and lysis stops.

[0070] (3) Filter the mycelium through four layers of sterile lens paper and collect the protoplast filtrate in a 50 mL centrifuge tube (the following operations are performed on ice). After balancing, centrifuge at 2000 × g in a 4°C centrifuge for 10 min and discard the supernatant.

[0071] (4) Gently resuspend the spheroplasts in 1 mL of STC wash buffer and centrifuge at 3000 × g for 5 min at 4°C. Discard the supernatant and repeat the process once.

[0072] (5) Resuspend in appropriate amount of STC to 1×10 6 -1×10 7 / mL.

[0073] 4.3 Protoplast transformation (1) In a new 50 mL centrifuge tube, add 2 μg of α-glucosidase gene knockout plasmid (i.e., the targeted knockout vector obtained in Section 2.2) and 6 μg of the donor DNA fragment LB-gla A-RB containing the glucoamylase expression cassette, 100 μL of protoplasts, and 25 μL of PEG Buffer. Mix gently and incubate on ice for 20 min.

[0074] (2) Add 1 mL of PEG Buffer and mix gently. Incubate at room temperature for 5 min. Add 2 mL of STC and mix gently. Add 20 mL of MMS top layer medium and pour on a 15 cm plate. Incubate in a 30°C incubator until transformant colonies grow.

[0075] (3) Pick a single colony for subculture and use the upstream primers LB- Xho The transformants were verified by IF and saccharifying enzyme primer M13-R (5′ → 3′: AGGTCTAGATCACTGCCAACTATCGTCAAGAATGG), and the results showed that the two generations of verification were correct, indicating that the Aspergillus niger with genes 52452, 50927, 50055, 49940 and 40261 successfully knocked out in this example, and the strain was named An52452 ( ∆52452::glaA )、 An50927 ( ∆50927::glaA )、 An50055 ( ∆50055::glaA )、 An49940 ( ∆49940::glaA )、 An40261 ( ∆ 40261::glaA ).

[0076] Example 2 This example investigates the performance of the Aspergillus niger engineered strain constructed in Example 1 in producing citric acid through fermentation.

[0077] Aspergillus niger An.YX0607 The engineered strains constructed in Example 1 were inoculated into PDA slant medium, cultured in a 35°C incubator for 5 days, and conidia were washed with fresh YPD liquid medium to prepare a spore suspension. 5 The inoculum size was inoculated into corn paste fermentation medium at 35°C and 220 r / min for 96 h. Sampling began at 24 h and was performed every 12 h.

[0078] (1) Determination of isomaltose content Take 10 mg of isomaltose standard and dissolve it in 5 mL of mobile phase, dilute to 10 mL to prepare 1 mg / mL stock solution, add mobile phase to dilute to 0.1 mg / mL-0.5 mg / mL, add it into the liquid phase vial through a 0.22μm membrane, and set aside. Isomaltose was detected using an Agent 1620 high performance liquid chromatograph (with evaporative light detector ELSD6100), and the detection conditions were: PrevailCarbohydrate ES (4.6×250 mm, 5 μm) chromatographic column, 75% acetonitrile aqueous solution as mobile phase, flow rate 0.8 mL / min, column temperature 35°C, injection volume 10 μL. The results showed that at the end of 96 h fermentation, An.YX0607 The isomaltose content of the fermentation broth was 5.31 g / L. The engineered strain constructed in Example 1 An52452、An50927、An50055、An49940、An40261 The isomaltose contents were 4.94 g / L, 3.54 g / L, 3.49 g / L, 4.73 g / L, and 3.60 g / L, respectively. Compared with the original strain fermentation for 96 h, the isomaltose contents decreased by 5.75%, 33.32%, 34.24%, 10.82%, and 32%, respectively. Figure 1 shown.

[0079] (2) Determination of citric acid content Take 100 mg of citric acid standard and dissolve it in 5 mL of mobile phase, make it up to 10 mL to prepare 10 mg / mL stock solution, add mobile phase to dilute to 1 mg / mL-5 mg / mL, add it into the liquid phase vial through a 0.22μm membrane, and set aside. Citric acid was detected using an Agentent 1620 high performance liquid chromatograph (with a RID differential refractive index detector G7162A). The detection conditions were: Aminex HPX-87H Column (300×7.8 mm) chromatographic column, 5 mM sulfuric acid as mobile phase, flow rate 0.6 mL / min, column temperature 55°C, injection volume 10 μL. The results showed that at the end of 96 h of fermentation, An.YX0607 The citric acid content of the fermentation broth was 30.56 g / L. The engineered strain constructed in Example 1 An52452、An50927、An50055、An49940、An40261 The citric acid contents were 31.95 g / L, 32.29 g / L, 30.98 g / L, 32.63 g / L, and 31.72 g / L, respectively. Compared with the original strain fermentation for 96 h, the citric acid contents increased by 4.55%, 5.63%, 1.37%, 6.75%, and 3.79%, respectively. Figure 2 shown.

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An engineered strain for fermenting and producing citric acid, characterized in that: The engineered strain is constructed by replacing the gene to be knocked out in the citric acid industrial strain with a saccharifying enzyme gene expression cassette; the citric acid industrial strain is Aspergillus niger; the gene to be knocked out includes at least one of gene 52452, gene 50927, gene 50055, gene 49940 and gene 40261 whose nucleotide sequences are respectively shown in SEQ ID NO.1 to SEQ ID NO.5; the saccharifying enzyme gene expression cassette includes a filamentous fungus promoter, a saccharifying enzyme gene mutant glaA gene and a terminator, the saccharifying enzyme gene mutant glaA Encodes the amino acid sequence shown in SEQ ID NO.

6.

2. The engineered strain according to claim 1, characterized in that The gene to be knocked out includes at least one of the gene 50927, the gene 50055 and the gene 40261; and / or The saccharifying enzyme gene mutant glaA The nucleotide sequence is shown in SEQ ID NO.7; and / or The citric acid industrial strain is Aspergillus niger An.YX0607 ; and / or The nucleotide sequence of the filamentous fungus promoter is shown in SEQ ID NO.8 or SEQ ID NO.9; and / or The terminator is the terminator Tglucan.

3. The engineered strain according to claim 1 or 2, characterized in that The gene to be knocked out is gene 50927, gene 50055 or gene 40261; and / or The nucleotide sequence of the filamentous fungus promoter is shown in SEQ ID NO.

8.

4. The method for constructing an engineered strain according to any one of claims 1 to 3, characterized in that: The specific operations include: The filamentous fungus promoter, saccharifying enzyme gene mutant were cloned and expressed by overlapping extension PCR. glaA and terminator to construct a saccharifying enzyme expression cassette; constructing a donor DNA fragment containing the saccharifying enzyme gene expression cassette and a targeted knockout plasmid containing the target sequence of the corresponding gene to be knocked out according to CRISPR-Cas9 technology; The targeted knockout plasmid and the donor DNA fragment containing the saccharifying enzyme expression box are transferred into the citric acid industrial strain, and the engineered strain for producing citric acid by fermentation is obtained by screening.

5. Use of the engineered strain according to any one of claims 1 to 3 in the fermentation production of citric acid.

6. A method for reducing the residual sugar content in a fermentation broth for producing citric acid by fermentation, characterized in that: The engineered strain according to any one of claims 1 to 3 is used to ferment and produce citric acid.

7. The method according to claim 6, characterized in that After activating and culturing the engineered strain, the conidia are washed with YPD liquid culture medium to prepare a spore suspension, which is then inoculated into a fermentation medium to produce citric acid by fermentation.

8. The method according to claim 7, characterized in that The fermentation medium is a corn paste fermentation medium, and the corn paste fermentation medium is a medium prepared by enzymolysis of corn powder with α-amylase.

Images