Method for constructing low-modification psoriasis mouse model based on dihydroxyisobutyrylation of ACTR3 42-site lysine

Abstract

A construction method of a low-modification psoriasis mouse model based on dihydroxyisobutyrylation of ACTR3 42-site lysine comprises the following steps: step 1, obtaining Cas9mRNA and guideRNA in an in-vitro transcription mode, and obtaining oligo donor DNA through synthesis; step 2, carrying out micro-injection on the Cas9mRNA, guideRNA and oligo donor DNA obtained in the step 1 into a fertilized egg male pronucleus of a C57BL / 6J mouse, transplanting the fertilized egg after injection into the uterus of a pseudopregnant female mouse, taking the mouse born for about 20 days as an F0-generation mouse, and carrying out genotype identification on the F0-generation mouse through PCR (Polymerase Chain Reaction) amplification and sequencing; thirdly, the identified F0-generation positive mice are mated with C57BL / 6J mice, F1-generation mice are obtained through breeding, genotype identification is conducted on the F1-generation mice through PCR amplification and sequencing, and the F1-generation positive mice can be stably inherited heterozygous mice with ACTR3K42A point mutation; the F1-generation negative mouse can be used as a wild type mouse; and 4, carrying out imiquimod induction on the ACTR3K42A point mutation heterozygote mouse obtained in the step 3 to obtain the psoriasis mouse model.

Description

Technical Field

[0001] The present invention relates to a method for constructing a mouse model for psoriasis research, in particular to a method for constructing a mouse model for psoriasis research by combining gene editing technology with imiquimod induction, and specifically to a method for constructing a psoriasis mouse model based on low-modification of dihydroxyisobutyrylation of lysine at position ACTR342. Background Art

[0002] Psoriasis is a common and recurrent chronic inflammatory skin disease. Its typical clinical manifestations are red papules or plaques covered with thick scales. Its pathological features are mainly parakeratinization, hyperkeratinization, abnormal proliferation, angiogenesis and inflammatory cell infiltration of skin keratinocytes, which seriously affect the quality of life of patients. Currently, the number of patients worldwide is as high as 125 million, and the prevalence of psoriasis in China is as high as 0.47%, which is a huge challenge for my country's public health. Although current treatment measures are effective, they cannot achieve long-term relief.

[0003] Psoriasis is one of the diseases that are currently being studied in the field of dermatology, and the development of new drugs is particularly important. Animal models of psoriasis are important tools for the pathogenesis of psoriasis and the development of new drugs. Currently, the models used to study psoriasis include spontaneous mouse models, drug-induced models (such as mouse psoriasis models induced by topical application of imiquimod to the skin), genetically engineered mouse models, and allogeneic transplant mouse models.

[0004] Although there are many animal models of psoriasis, they all have shortcomings in fully simulating the characteristics of psoriasis:

[0005] ① Although spontaneous mouse models can show psoriasis skin manifestations in a relatively short period of time, such as acanthosis and increased vascular dilation in the dermis, they rarely show T cell and neutrophil infiltration, cannot reflect all the characteristics of psoriasis, and lack response to psoriasis treatment drugs. Therefore, this type of model is only suitable for the study of anti-proliferative drugs, and is not suitable for the pathogenesis of psoriasis and the study of new drugs;

[0006] ② The genetically engineered mouse model was constructed based on the psoriasis susceptibility gene, which is of great help in studying the pathogenesis of psoriasis. However, the manifestation of psoriasis lesions is greatly affected by later factors such as transcription and translation, and there are differences in the consistency of the lesion model, which limits the research on the progression and treatment of psoriasis.

[0007] ③ Xenograft animal models are skin transplants from psoriasis patients onto immunodeficient mice. This type of animal model can more completely simulate the complex immunological and histopathological changes of psoriasis and is a suitable tool for studying the pathogenesis of psoriasis T cells and drug development. However, due to severe immune defects, these mice are more susceptible to infection, so the cost of raising them is high, so the promotion and application of this type of model also has certain limitations. The construction time of drug-induced models needs to be further shortened, and the effect needs to be further improved. Summary of the invention

[0008] In view of the problems existing in the prior art, one of the purposes of the present invention is to provide a method for a psoriasis mouse model with shorter modeling time, more severe skin lesions and inflammatory cell infiltration, and skin appearance and inflammatory response that are more consistent with human psoriasis.

[0009] To achieve this object, the present invention adopts the following technical solutions:

[0010] A method for constructing a psoriasis mouse model based on low dihydroxyisobutyrylation of lysine at position 42 of ACTR3, comprising:

[0011] In the first step, Cas9 mRNA and guide RNA were obtained by in vitro transcription, and oligodonor DNA was obtained by synthesis;

[0012] In the second step, the Cas9 mRNA, guide RNA and oligo donor DNA obtained in the first step were microinjected into the male pronucleus of the fertilized eggs of C57BL / 6J mice. The injected fertilized eggs were transplanted into the uterus of pseudo-pregnant female mice. The mice born around 20 days old were F0 generation mice, and their genotypes were identified by PCR amplification and sequencing.

[0013] The third step is to mate the identified F0 generation positive mice with C57BL / 6J mice to obtain F1 generation mice, and to identify their genotypes through PCR amplification and sequencing to obtain F1 generation positive mice that can stably inherit ACTR3. K42A Heterozygous mice with point mutations; and the negative mice of the F1 generation can be used as wild-type mice;

[0014] Step 4: ACTR3 obtained in step 3 K42A The psoriasis mouse model was obtained by inducing imiquimod in heterozygous mice with the point mutation.

[0015] The method further comprises: obtaining Cas9 mRNA and guideRNA by in vitro transcription in the first step, and obtaining oligo donor DNA by synthesis; the specific method of the in vitro transcription is: synthesizing the DNA sequences of Cas9 and guide by PCR, and then transcribing them into Cas9 mRNA and guideRNA by a transcription kit; the guideRNA contains the bases before the ACTR3K42 site mutation; selecting a sequence of about 100 bases upstream and downstream of the ACTR3 K42 mutation site including the mutation base sequence as the oligo donor DNA.

[0016] It further includes: the F0 generation mice born in the second step are subjected to PCR amplification and sequencing for genotyping; the specific identification method is: cutting the 0.5 cm long tail end of the F0 generation mouse, then extracting DNA, using Cas9 / guideRNA to find the target gene mutation site and cut it, using upstream primer I and downstream primer II to PCR amplify the DNA of the F0 generation mouse, and then using sequencing primers to identify the genotype of the PCR amplification product.

[0017] Further comprising: the upstream primer I is:

[0018] Forward 5'-CACATGTGGTCAGAGTAGGGATAAT-3';

[0019] The downstream primer II is: Reverse 5'-ATATCCAGGTGGTTGAAACGTAAGA-3'.

[0020] Further comprising: the guideRNA gene sequence is SEQ ID NO: 2.

[0021] Further comprising: the oligo donor DNA sequence information is SEQ ID NO:3.

[0022] Further comprising: the F1 generation positive mouse comprises the mutated gene sequence SEQ ID NO:7.

[0023] Further comprising: the fourth step: the ACTR3 obtained in the third step K42A The psoriasis mouse model was obtained by imiquimod induction in heterozygous mice with point mutations. The specific induction method was as follows: in wild-type mice and ACTR3 K42A After hair removal on the back of heterozygous mice with point mutations, imiquimod cream was applied to the hair removal area on the back of the mice daily for 5 days. The application dosage was 62 mg per 4 square centimeters area per day.

[0024] Further comprising: wild-type mice induced by imiquimod and ACTR3 K42A The heterozygous mice with the point mutation were anesthetized and killed, and the local skin lesions were obtained and stained with HE to observe the pathological changes of skin tissue under a microscope.

[0025] Compared with the prior art solutions, the present invention has at least the following beneficial effects:

[0026] ① The present invention constructs a psoriasis mouse model based on the post-translational modification level, avoiding the influence of factors such as transcription and translation on the mouse phenotype, reducing the influence of non-experimental factors on the results to a certain extent, and ensuring the comparability of the results;

[0027] ② The present invention is the first to construct a psoriasis mouse model starting from dihydroxyisobutyrylation, which plays an important role in exploring the dihydroxyisobutyrylation modification of psoriasis;

[0028] ③ The modeling cycle of the construction method of the present invention is short, and obvious psoriasis skin manifestations can appear on the 5th day of imiquimod induction, while the modeling cycle reported in the literature previously lasted for about 2 weeks;

[0029] ④ The mouse model constructed in the present invention has more severe skin lesions and inflammatory cell infiltration, which is most consistent with the characteristics of skin lesions in patients with psoriasis and meets the requirements for animal models in the primary stage of psoriasis research. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Schematic diagram of the design strategy for constructing heterozygous mice with ACTR3 protein K42A point mutation.

[0031] Figure 2 : Schematic diagram of the PCR identification strategy for the F0 generation mouse genotype, where F0 is the generation number of mice.

[0032] Figure 3 : Electrophoresis diagram of PCR identification of homologous recombination-positive F0 generation mice, where F0 is the generation number of mice; WT is the wild-type control; M is the 1kb DNA molecular weight standard.

[0033] Figure 4 : Electrophoresis diagram of PCR identification of 5' homology arm and 3' homology arm of F1 generation mice, wherein F1 is the generation number of mice; WT is the wild-type control; M is the 1kb DNA molecular weight standard.

[0034] Figure 5: Wild-type mice and ACTR3 K42A Schematic diagram of skin lesion changes during imiquimod induction in mice heterozygous for the point mutation.

[0035] in, Figure 5-1 The skin manifestations of wild-type mice on the first day of imiquimod (IMQ) treatment; Figure 5-2ACTR3 K42A Skin manifestations of mice heterozygous for the point mutation on day 1 of IMQ treatment; Figure 5-3 This is the skin manifestation of wild-type mice on the 5th day of IMQ treatment; Figure 5-4 ACTR3 K42A Skin manifestations of mice heterozygous for the point mutation on day 5 of IMQ treatment.

[0036] Figure 6: Wild-type mice and ACTR3 K42A Schematic diagram of HE staining observation of imiquimod-induced tissue sections in heterozygous mice with point mutations.

[0037] in, Figure 6-1 Schematic diagram of HE observation of skin lesion tissue sections of wild-type mice on the 5th day after IMQ treatment; Figure 6-2 ACTR3 K42A Schematic diagram of HE observation of skin lesion tissue sections of heterozygous mice with point mutation on the 5th day of IMQ treatment.

[0038] Reference numerals: 1A, wild type allele; 1B, targeted allele; 1C, targeting vector; 1D, 5' homology arm; 1E, 3' homology arm; 1a, exon 1; 3, exon 3; 12, exon 12;

[0039] splice site; Homology arms; Coding region; Non-coding regions; Mutation point;

[0040] Primer position; PCR products; PCR sequencing region. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described below with reference to the accompanying drawings and through specific implementation methods.

[0042] In order to better illustrate the present invention and facilitate understanding of the technical solution of the present invention, the specific implementation methods of the present invention are as follows:

[0043] The inventor of this patent has devoted himself to research and found that the 42nd lysine of ACTR3 is lowly modified with dihydroxyisobutyryl in the skin lesions of patients with psoriasis, and found that the change in the modification level can promote the proliferation of keratinocytes, simulating the characteristics of psoriasis in many aspects such as cell proliferation and inflammatory infiltration. Based on the research results, in order to solve the problems existing in the prior art, the inventor of this patent obtained heterozygous mice in which the 42nd lysine (K) of the ACTR3 gene was mutated to alanine (A) through genetic engineering technology, and then combined with topical imiquimod induction, successfully constructed a psoriasis mouse model. The model of the present invention has a shorter modeling time, more severe skin lesions and inflammatory cell infiltration, and is more consistent with the characteristics of psoriasis in terms of skin appearance and inflammatory response.

[0044] The main invention concept is: first, using CRISPR / Cas9 technology and homologous recombination repair to introduce a target point mutation, mutating the 42nd lysine of mouse ACTR3 protein to alanine, so that the 42nd lysine of ACTR3 is modified with low dihydroxyisobutyrylation to obtain ACTR3 K42A point mutation heterozygous mice, and then imiquimod ointment was applied topically to the skin to further induce a psoriasis mouse model, see Figure 1 .

[0045] The specific implementation methods of this patent are further described in detail as follows:

[0046] In the first step, the DNA sequences of Cas9 and guide are synthesized by PCR, and then transcribed into Cas9mRNA and guideRNA by a transcription kit. The guideRNA contains the bases before the ACTR3 K42 site mutation; a sequence of about 42 bases upstream and downstream of the ACTR3 K42 mutation site including the mutant base sequence is selected as oligo donor DNA, and the oligodonor DNA is synthesized by the following method.

[0047] 1. Enzyme digestion experiment: Perform single enzyme digestion on the px330-T7-cas9 plasmid. The enzyme digestion system is as shown in Table 1:

[0048] Table 1

[0049]

[0050]

[0051] 2. Purification experiment:

[0052] (1) After the enzyme digestion reaction is completed, take 2 μl of the sample for gel electrophoresis to confirm whether the digestion is complete and use the circular plasmid as a control.

[0053] (2) DNA purification and recovery experiment:

[0054] ① Add 200ul of anhydrous ethanol and slowly invert for 30 seconds until flocculent suspension appears;

[0055] ② Centrifuge the EP tube with ethanol added at 13000 rpm for 5 minutes;

[0056] ③After centrifugation, pour out the liquid, add 75% ethanol to wash (do not wash away the sediment at the bottom of the tube), pour out the ethanol after washing, and repeat this step twice;

[0057] ④ Dry the residual ethanol in the tube, add 50ul ddH2O, dissolve the DNA at 56℃, and measure the concentration after it is fully dissolved.

[0058] 3. Transcription experiment:

[0059] This step is based on the ThermoFisher mMESSAGE mMACHINE TM The experiment was performed according to the instructions of T7 ULTRA transcription kit.

[0060] 4. RNA purification and recovery experiment:

[0061] This step is based on the ThermoFisher MEGAclear TM The experiment was performed according to the instructions of the transcript purification kit.

[0062] Finally, the transcribed Cas9 mRNA was obtained, and gel electrophoresis experiments were performed to observe the transcription quality and determine the concentration.

[0063] Basic information of the mutated gene:

[0064] The name of the gene mutated in the method of the present invention (Ensembl number) is ACTR3 (ENSMUSG00000026341).

[0065] Ensembl website link for mutation target gene:

[0066] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000026341;r=1:125320643-125363284;t=ENSMUST00000178474

[0067] Transcript targeted by mutation (Ensembl number): ACTR3-202 (ENSMUST00000178474.8)

[0068] Mutation site: K42

[0069] Target site of mutation: 42A

[0070] The wild-type genome sequence (i.e. before mutation) is SEQ ID NO: 1:

[0071]

[0072] The uppercase bases are exon 3 sequences, the underlined and bold bases AAA are bases to be mutated, and the underlined bases are guide RNA sequences.

[0073] That is, the guideRNA gene sequence is SEQ ID NO: 2:

[0074]

[0075] The oligo donor DNA sequence information is SEQ ID NO: 3:

[0076]

[0077] (The underlined and bold AGC is the mutated base)

[0078] In the second step, the Cas9 mRNA, guide RNA and donor DNA obtained in the first step were microinjected into the male pronucleus of the fertilized eggs of C57BL / 6J mice, and the injected fertilized eggs were transplanted into the uterus of pseudo-pregnant female mice. The mice born around 20 days later were F0 generation mice, and their genotypes were identified by PCR amplification and sequencing to obtain F0 generation positive mice. F0 generation mouse identification strategy (see Figure 2 ): Cas9 / guideRNA finds the mutation site of the target gene and cuts it, uses upstream primer I and downstream primer II to PCR amplify the DNA of F0 generation mice, and then uses sequencing primers to identify the genotype of the PCR amplification product (see Figure 3 ).

[0079] Cut 0.5 cm from the end of the mouse tail, extract DNA, and perform PCR identification as follows:

[0080] Primer information: Ⅰ (upstream primer) SEQ ID NO: 4:

[0081] Forward 5'-CACATGTGGTCAGAGTAGGGATAAT-3';

[0082] II (downstream primer) SEQ ID NO: 5:

[0083] Reverse 5'-ATATCCAGGTGGTTGAAACGTAAGA-3'

[0084] The PCR reactions are listed in Table 2 below.

[0085] Table 2

[0086] Reaction Component Volume (μl) Double deionized water (ddH2O) 8.05 2xPCR Buffer 10 Primer I (20 pmol / μl) 0.3 Primer II (20 pmol / μl) 0.3 KOD-Multi&Epi-* 0.35 Genomic DNA 1 Total volume 20

[0087] KOD-Multi&Epi-*(TOYOBO, Code No: KME-101)

[0088] The PCR reaction conditions are listed in Table 3 below.

[0089] Table 3

[0090] Reaction steps Temperature(℃) Time Note 1 94 3min - 2 98 20sec - 3 60 20sec - 4 68 4min Repeat steps 2-4 for a total of 35 cycles 5 68 5min - 6 12 - hold

[0091] The sequencing primer is: 5'-ACTGCCACCAGGTGTTCAAA-3'

[0092] The sequencing results before and after the mutation are compared as follows:

[0093] Query is the wild-type genome sequence: SEQ ID NO: 6

[0094] ACCTGATATGTGTAAAACCCTAGTAACACACATGCAGCCACATAATTGGAATCAAAATTTAATAGTT

[0095] GTTGGAAATGGAGCTGAAAATAATCCCATAGTAATACATTTGGGGGGTTGATACTTGAGGCCTGATCCCT

[0096] GAGATGAAGCTGAGGTATGGGTGTCTAGAAGGCATTTTGTCTATGGCTTTTGTTCATTAGTTGAGAGTT

[0097] TTAAGTATTCTGGATCATGCTTATTTGTTGTTTTTAGTAACATTTTACAATTGAAGAAGGCAAGTTAAAA

[0098] GTTGTTTCATTTGAAAGAGATAAAATTTTTAAGATGTCTAATTACTTTACTTCAAAGGTATTGCCATTAAA

[0099] GAGTCTGCAAAAGTGGGTGACCAAGCCCAGAGGAGGGTGATGAAAGGCGTGGATGACCTAGACTTC

[0100] TTCATTGGTGATGAAGCAATAGAAAAGCCCACATATGCAACAAAGGTATGTTTCTAAGAGGGCTCCAA

[0101] TCAGCCGGTGGCCGGTTTCACTCTGTCGTGGGCTTGTTGCTTTCTCACATTGAGTTTTCTGGTTTAAAA

[0102] TTTTCGAGACAGGAACTCACCTGGAACTGGCT

[0103] Subject is the actual sequencing result after mutation, SEQ ID NO:7

[0104] ACCTGATATGTGTAAAACCCTAGTAACACACATGCAGCCACATAATTGGAATCAAAATTTAATAGTT

[0105] GTTGGAAATGGAGCTGAAATAATCCCATAGTAATACATTTGGGGGGTTGATACTTGAGGCCTGATCCCT

[0106] GAGATGAAGCTGAGGTATGGGTGTCTAGAAGGCATTTTGTCTATGGCTTTTGTTCATTAGTTGAGAGTT

[0107] TTAAGTATTCTGGATCATGCTTATTTGTTGTTTTTAGTAACATTTTACAATTGAAGAAGGCAAGTTAAAA

[0108] GTTGTTTCATTTGAAGAGATAAAATTTTTAAGATGTCTAATTACTTTACTTCAAAGGTATTGCCATTAAA

[0109] GAGTCTGCAGCAGTGGGTGACCAAGCCCAGAGGAGGGTGATGAAAGGCGTGGATGACCTAGACTTC

[0110] TTCATTGGTGATGAAGCAATAGAAAAGCCCACATATGCAACAAAGGTATGTTTCTAAGAGGGCTCCAA

[0111] TCAGCCGGTGGCCGGTTTCACTCTGTCGTGGGCTTGTTGCTTTCTCACATTGAGTTTTCTGGTTTAAAA

[0112] TTTTCGAGACAGGAACTCACCTGGAACTGGCT

[0113] In the third step, since the cleavage rate of the fertilized egg is very fast in the early stage, the F0 generation mice obtained are chimeras and may not have stable genetic ability. It is necessary to mate the positive F0 generation mice screened in the second step with C57BL / 6J mice to breed F1 generation mice, and identify their genotypes by PCR amplification and sequencing (see Figure 4 ), the identification method is the same as the second step, and the positive F1 generation mice obtained are stable and heritable F1 generation mice, namely ACTR3 K42A point mutation heterozygous mice, and the negative F1 generation mice are regarded as wild-type mice.

[0114] Step 4: ACTR3 obtained in step 3 K42A The psoriasis mouse model was obtained by inducing imiquimod in heterozygous mice with the point mutation.

[0115] The specific induction method is: in wild-type mice and ACTR3 K42A After the back hair of heterozygous mice with point mutations was removed, vaseline and imiquimod cream were applied to the hair removal area on the back of the mice every day, 62 mg / (2×2 cm 2 ·d), continued to apply for 5 days, the changes of skin lesions during the modeling period are shown in Figure 6, and there was no obvious change in the hair loss areas on the backs of the two groups of mice two days before modeling (see Figure 5-1 and Figure 5-2 ), ACTR3 started on day 3 K42A The skin of heterozygous mice with point mutations was slightly red, while that of wild-type mice was unchanged. On the 4th day, the mutant mice developed obvious erythema, some lesions were covered with scales, and the lesions were moderately raised, while the skin of wild-type mice was slightly red. Figure 5-3 and Figure 5-4 As shown, on day 5, mice were compared with wild-type mice (see Figure 5-3 ) compared to mutant mice (see Figure 5-4 ) The erythema deepens, the surface is covered with thick scales, and the lesions are significantly thickened, which is consistent with psoriasis-like changes.

[0116] To further verify the similarity of mouse skin lesions in histopathological manifestations with psoriasis lesions, HE staining was used to identify mouse skin lesions. K42A The heterozygous mice with the point mutation were anesthetized and killed, and local skin lesions were taken for identification: the specimens were fixed and paraffin sections were made, and the paraffin specimens were stained with HE, and the pathological changes of skin tissue, especially the thickness of the epidermis, were observed under a microscope. The results are shown in Figure 6. The epidermis of the skin of wild-type mice is thinner (see Figure 6). Figure 6-1 ), while ACTR3 K42A Mice heterozygous for the point mutation (see Figure 6-2 ) The epidermis is significantly thickened, with parakeratosis and hyperkeratosis, an increase in the number of spinous cells, and epidermal processes extending downward, which are highly similar to the histopathological changes of skin lesions in patients with psoriasis.

[0117] Figure 5: Wild-type mice and ACTR3 K42A Schematic diagram of skin lesion changes during imiquimod induction in heterozygous mice with point mutations;

[0118] in, Figure 5-1 The skin manifestations of wild-type mice on the first day of imiquimod treatment; Figure 5-2 ACTR3 K42A Skin manifestations of mice heterozygous for the point mutation on day 1 of IMQ treatment; Figure 5-3 The skin manifestations of wild-type mice on the 5th day after imiquimod treatment; Figure 5-4 ACTR3 K42A Skin manifestations of mice heterozygous for the point mutation on day 5 of imiquimod treatment.

[0119] Figure 6: Wild-type mice and ACTR3 K42A Schematic diagram of HE staining observation of imiquimod-induced tissue sections of heterozygous mice with point mutations;

[0120] in, Figure 6-1 This is a schematic diagram of HE observation of skin lesion tissue sections of wild-type mice on the 5th day after imiquimod treatment; Figure 6-2 ACTR3 K42A Schematic diagram of HE observation of skin lesion tissue sections of heterozygous mice with point mutations on the 5th day of imiquimod treatment. HE staining showed that the epidermis of wild-type mice was thin, while the epidermis of mutant mice was significantly thickened, with parakeratosis and hyperkeratosis, an increase in the number of spinous cells, and epidermal processes extending downward.

[0121] Based on the previous research results, the present invention for the first time constructs a psoriasis mouse model based on the dihydroxyisobutyrylation modification level of the protein combined with imiquimod stimulation.

[0122] Compared with the prior art method for constructing a psoriasis mouse model, the present invention has the following advantages:

[0123] ① This technology constructs a psoriasis mouse model based on the post-translational modification level, avoiding the influence of factors such as transcription and translation on the mouse phenotype, and to a certain extent reducing the influence of non-experimental factors on the results, ensuring the comparability of the results;

[0124] ② This technology is the first to construct a psoriasis mouse model starting from dihydroxyisobutyrylation, which plays an important role in exploring the dihydroxyisobutyrylation modification of psoriasis;

[0125] ③ The modeling cycle of this technology is short. Obvious psoriasis skin manifestations can appear on the 5th day of imiquimod induction, while the modeling cycle in previous literature reports lasted about 2 weeks;

[0126] ④ The mouse model constructed in the present invention has more severe skin lesions and inflammatory cell infiltration, which is most consistent with the characteristics of skin lesions in patients with psoriasis and meets the requirements for animal models in the primary stage of psoriasis research.

[0127] The applicant declares that the present invention illustrates the detailed process of the present invention through the above-mentioned embodiments, especially the specific experimental steps, methods and conditions are all preferred implementations of the present invention, which can obtain unexpected technical effects such as high experimental success rate, high yield and high efficiency. However, the present invention is not limited to the above-mentioned detailed process, that is, it does not mean that the present invention must rely on the above-mentioned detailed process to be implemented. Those skilled in the art should understand that any improvement of the present invention, the equivalent replacement of the methods and steps selected by the present invention, the addition of auxiliary steps, the selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

[0128] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0129] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0130] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing a psoriasis mouse model based on low-modification of lysine at position 42 of ACTR3 by dihydroxyisobutyrylation, comprising: In the first step, Cas9 mRNA and guide RNA are obtained by in vitro transcription, and oligo donor DNA is obtained by synthesis; In the second step, the Cas9 mRNA, guide RNA and oligo donor DNA obtained in the first step were microinjected into the male pronucleus of the fertilized eggs of C57BL / 6J mice. The injected fertilized eggs were transplanted into the uterus of pseudo-pregnant female mice. The mice born around 20 days old were F0 generation mice, and their genotypes were identified by PCR amplification and sequencing. In the third step, the identified F0 generation positive mice were mated with C57BL / 6J mice to obtain F1 generation mice, and their genotypes were identified by PCR amplification and sequencing. The obtained F1 generation positive mice were ACTR3 that could be stably inherited. K42A Heterozygous mice with point mutations; and the negative mice of the F1 generation can be used as wild-type mice; Step 4: ACTR3 obtained in step 3 K42A The psoriasis mouse model was obtained by inducing imiquimod in heterozygous mice with the point mutation.

2. The method of claim 1, further comprising: In the first step, Cas9 mRNA and guide RNA are obtained by in vitro transcription, and oligo donor DNA is obtained by synthesis; the specific method of the in vitro transcription is: the DNA sequences of Cas9 and guide are synthesized by PCR, and then they are transcribed into Cas9 mRNA and guide RNA by a transcription kit; the guide RNA is a base before the ACTR3 K42 site mutation; a sequence of about 100 bases upstream and downstream of the ACTR3 K42 mutation site including the mutation base sequence is selected as the oligo donor DNA.

3. The method of claim 1, further comprising: The F0 generation mice born in the second step must undergo PCR amplification and sequencing to identify their genotype; the specific identification method is: cut the 0.5 cm long tail end of the F0 generation mouse, then extract the DNA, use Cas9 / guideRNA to find the mutation site of the target gene and cut it, use upstream primer I and downstream primer II to PCR amplify the DNA of the F0 generation mouse, and then use sequencing primers to identify the genotype of the PCR amplification product.

4. The method of claim 3, further comprising: The upstream primer I is: Forward 5'-CACATGTGGTCAGAGTAGGGATAAT-3'; The downstream primer II is: Reverse 5'-ATATCCAGGTGGTTGAAACGTAAGA-3'.

5. The method according to any one of claims 1 to 4, further comprising: The guideRNA gene sequence is SEQ ID NO:

2.

6. The method according to any one of claims 1 to 4, further comprising: The oligo donor DNA sequence information is SEQ ID NO:

3.

7. The method according to any one of claims 1 to 4, further comprising: The F1 generation positive mouse includes the mutated gene sequence SEQ ID NO:

7.

8. The method according to any one of claims 1 to 4, further comprising: Step 4: ACTR3 obtained in step 3 K42A The psoriasis mouse model was obtained by imiquimod induction in heterozygous mice with point mutations. The specific induction method was as follows: in wild-type mice and ACTR3 K42A After hair removal on the back of heterozygous mice with point mutations, imiquimod cream was applied to the hair removal area on the back of the mice daily for 5 days. The application dosage was 62 mg per 4 square centimeters area per day.

9. The method of claim 8, further comprising: Imiquimod-induced expression of wild-type mice and ACTR3 K42A The heterozygous mice with the point mutation were anesthetized and killed, and the local skin lesions were obtained and stained with HE to observe the pathological changes of skin tissue under a microscope.

Images