Fish circular RNA (Ribonucleic Acid) with bacterial infection resisting function as well as preparation method and application of fish circular RNA

Abstract

The invention relates to a fish circular RNA with a bacterial infection resisting function and a preparation method and application thereof, the circular RNA is circRNA-AntiB1, the nucleotide sequence of the circular RNA is shown as SEQ ID NO: 1, and the circular RNA is prepared by cyclizing linear circRNA-AntiB1 through T4 RNA ligase 1 and then removing residual linear RNA in a reaction system through RNase R enzyme. The circRNA-AntiB1 prepared by the invention can effectively inhibit vibrio infection, can be used for preparing fish vibrio vaccines, antibacterial drugs and other biological immune products in the field of aquaculture, and has good stability and good market application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a fish circular RNA with anti-bacterial infection function, and a preparation method and application thereof. Background Art

[0002] Fish pathogens mainly include Gram-negative bacteria widely distributed in the aquatic environment. These bacteria are common in inner bays, coastal areas, offshore waters, sediments and marine organisms. Diseases such as vibriosis cause huge economic losses to marine fisheries. These pathogens have high transmission speed and high mortality rate, such as Vibrio anguillarum, Vibrio harveyi, Vibrio parahaemolyticus, etc.

[0003] Vibrio anguillarum is an important conditional pathogen that is widely found in the marine environment, including inner bays, coastal and offshore waters, sediments and marine organisms. This Gram-negative bacterium is widely known for its opportunistic pathogenicity and can infect a variety of aquaculture animals, such as salmon, rainbow trout, eel, sweetfish, sea bass, cod, turbot, flounder, yellow croaker, etc., causing serious damage to the global marine aquaculture industry. Vibrio anguillarum has various infection routes, mainly including skin, gills, lateral line and intestines, which can cause systemic tissue lesions. Different fish will show different symptoms after being infected with Vibrio anguillarum, but the main symptom is bleeding on the body surface. For example, the most obvious symptom of infection in farmed flounder is severe bleeding in the fins and ulceration on the body surface.

[0004] In order to effectively control bacterial diseases, the fish farming industry currently has a variety of prevention and control strategies including antibiotic treatment, vaccination and biological control. In recent years, circular RNA (circRNA), as a new type of non-coding RNA molecule, has shown an important role in regulating gene expression and serving as a disease marker. circRNA has a unique closed circular structure and exhibits higher stability and longer half-life in cells compared to linear RNA. In the study of treating bacterial infections, the application of circular RNA technology provides a new perspective for understanding the interaction between bacteria and hosts, and may provide a potential tool for developing new therapeutic strategies. Summary of the invention

[0005] The present invention provides a fish circular RNA with anti-bacterial infection function and a preparation method and application thereof, so as to solve the problem of abuse of antibiotics caused by widespread use of large amounts of antibiotics for controlling bacterial diseases in fish farming.

[0006] The present invention adopts the following technical scheme: a fish circular RNA with anti-bacterial infection function, wherein the circular RNA is circRNA-AntiB1, and the nucleotide sequence is shown in SEQ ID NO:1.

[0007] A method for preparing fish circular RNA with anti-bacterial infection function comprises the following steps: (1) The differentially expressed circRNA sequences in the spleen tissue of croaker infected with Vibrio anguillarum were analyzed, and primers circRNA-AntiB1-F and circRNA-AntiB1-R were designed for PCR amplification to form a double-stranded DNA template. T7 RNA polymerase and the double-stranded DNA template were used for T7 RNA transcription to obtain linear RNA, which was purified by ethanol precipitation. (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R enzyme was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain circRNA-AntiB1.

[0008] Furthermore, the nucleotide sequence of the primer circRNA-AntiB1-F is shown in SEQ ID NO:2.

[0009] Furthermore, the nucleotide sequence of the primer circRNA-AntiB1-R is shown in SEQ ID NO:3.

[0010] The invention discloses an application of fish circular RNA with anti-bacterial infection function. The circular RNA is combined with a lipid nanocarrier, and the prepared circular RNA biological preparation can be used as an antibacterial drug and vaccine product for preventing fish bacterial infection.

[0011] Furthermore, the mass ratio of the circular RNA to the lipid nanocarrier is 1:10.

[0012] Furthermore, the lipid nanocarrier is prepared by mixing MC3, DSPC, cholesterol and DMG-PEG2000 in an ethanol solution at a mass ratio of 5:1:3.8:0.2.

[0013] The present invention has the beneficial effects: The circRNA-AntiB1 circular RNA prepared by the present invention has good stability and high purity. The circRNA-AntiB1 circular RNA can significantly reduce the number of Vibrio anguillarum invading cells, significantly reduce the number of Vibrio anguillarum colonized in fish liver and spleen, and increase the level of inflammatory factors. The circRNA-AntiB1 circular RNA can be used in fish Vibrio vaccines, antibacterial drugs and other biological immune products in aquaculture, can reduce the use of fish antibiotics, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a diagram showing the expression level of circRNA in the spleen tissue of croaker after stimulation with Vibrio anguillarum of the present invention.

[0015] Figure 2 Schematic diagram of the cyclization process of circRNA-AntiB1 of the present invention.

[0016] Figure 3 This is a gel electrophoresis analysis diagram of circRNA-AntiB1 and linear RNA of the present invention.

[0017] Figure 4 The activation status of the circRNA-AntiB1 circular RNA preparation of the present invention on the inflammatory factor reporter gene.

[0018] Figure 5 This is the effect of the circRNA-AntiB1 circular RNA preparation of the present invention on the expression level of cellular inflammatory factors under Vibrio anguillarum infection conditions.

[0019] Figure 6 The effect of the circRNA-AntiB1 circular RNA preparation of the present invention on the ability of Vibrio anguillarum to invade cells.

[0020] Figure 7 The effect of the circRNA-AntiB1 circular RNA preparation of the present invention on the colonization of Vibrio anguillarum in zebrafish tissues.

[0021] Figure 8 This is a stability test of the preparation of the circRNA-AntiB1 circular RNA of the present invention. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is only a part of the embodiment of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should fall within the scope of protection of the present invention.

[0023] The spleen cells of croaker (MSpC cells) were grown adherently in cell culture medium in a constant temperature incubator at 28°C.

[0024] L15 medium (HyClone) containing 15% fetal bovine serum, 100U / ml penicillin and 100mg / ml streptomycin was used as the cell culture medium for MSpC cells; L15 medium containing only 2% fetal bovine serum was used as the cell maintenance medium during bacterial culture; carp epithelial cells (MSPC cells) adhered to the cell culture medium and were cultured in a constant temperature incubator at 5% CO2 and 28°C. Medium 199 medium (Invitrogen) containing 10% fetal bovine serum, 100U / ml penicillin and 100mg / ml streptomycin was used as the cell culture medium for MSPC cells.

[0025] The Vibrio anguillarum in the present invention is stored in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs.

[0026] The total RNA extraction kit in the present invention was purchased from Kangwei Century.

[0027] The dual-luciferase reporter kit was purchased from Novozymes.

[0028] Full-length cDNA first-strand synthesis kit (Novozymes).

[0029] Example 1: Effect of Vibrio anguillarum stimulation on the expression level of circRNA in spleen tissue of croaker: Take a croaker weighing about 50g, inject 0.2ml of Vibrio anguillarum (OD600=0.5) into the abdominal cavity, set up a negative control at the same time, and culture it in a circulating aquaculture system at a temperature of 28℃.

[0030] After 7 days of culture of the croaker injected intraperitoneally, the spleen was taken out in a 1.5 ml centrifuge tube and a 1 mm diameter steel ball was added. Then 1 ml of Trizol lysis solution was added to each well and lysed at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit. The extracted total RNA was used to construct a cDNA library, and the cDNA library was sequenced using the Illumina HiSeq 2500 platform. The clean reads were aligned with the croaker reference genome using TopHat2 software, and the unmapped reads were extracted and further aligned with the croaker reference sequence using TopHat software. The junction reads with nonlinear sorting alignment on the same chromosome were regarded as candidate reverse splicing junction reads, and the reverse splicing junction reads were used to identify and analyze the expression level of circular RNA using CIRI software.

[0031] Depend on Figure 1It can be seen that the expression level of circRNA-AntiB1 in the spleen tissue of croaker infected with Vibrio anguillarum increased significantly, so it can be seen that circRNA-AntiB1 may have the potential to inhibit Vibrio anguillarum infection.

[0032] Example 2: Preparation of circRNA-AntiB1 circular RNA: The nucleotide sequence of circRNA-AntiB1 circular RNA is shown in SEQ ID NO:1.

[0033] The specific steps include: (1) First, PCR amplification was performed using primers circRNA-AntiB1-F, whose sequence was SEQ ID NO: 2, and primers circRNA-AntiB1-R, whose sequence was SEQ ID NO: 3, to form a double-stranded DNA template. The specific steps were as follows: circRNA-AntiB1-F 0.5 μL (10 μM), circRNA-AntiB1-R 0.5 μL (10 μM), Taq DNA polymerase Mix 5 μL (2×, Norvegian), and nuclease-free pure water was added to 10 μL. PCR amplification was performed according to the following procedure: pre-deformation at 95°C for 30 s, denaturation at 95°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 10 s, and complete extension at 72°C for 5 min. The denaturation to extension process was cycled 35 times and stored at 4°C. Transcription of linear RNA was performed using T7 RNA polymerase and the DNA template annealed above. The specific steps were as follows: DNA template 1 μg, T7 transcription buffer 2 μL, NTP 4 μL of the mixture (10 mM), 0.1 μL of T7 RNA polymerase (1 kU / μl), add nuclease-free pure water to 20 μL, and incubate at 37°C for 120 min; (2) After the reaction is completed, the transcribed linear RNA is purified by ethanol precipitation. The specific steps are as follows: first, add 160 μL of nuclease-free pure water to expand the reaction volume to 180 μL, then add 20 μL of 3M sodium acetate, pH 5.2 or 20 μL of 5M ammonium acetate, and mix thoroughly; add an equal volume of phenol / chloroform mixture with a volume ratio of 1:1 to extract once, vortex mix for 20-30 seconds, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant, and then extract with chloroform 1-2 times, vortex mix for 20-30 seconds each time, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant). Precipitate RNA with double volume of anhydrous ethanol, incubate at -20°C for at least 30 minutes, then centrifuge at 14000g for 5-10 minutes at 4°C to precipitate RNA, discard the supernatant, wash the precipitate with 500 μL of pre-cooled 70% ethanol, and resuspend and dissolve the RNA with 20 μL of nuclease-free pure water; (3) Use T4 RNA ligase 1 to circularize the purified linear RNA. The specific steps are as follows: take 20 µM linear RNA, 2 µL T4 RNA ligase buffer, 1 µL 1 mM ATP, and 1 µL T4 RNA ligase 1, add nuclease-free pure water to 20 µL, incubate at 37 °C for 1 hour, and purify the circularized RNA using the ethanol precipitation method described above; (4) Use RNase R enzyme to remove the residual linear RNA in the above reaction system. Take 20 μL of the above purified RNA and 3 μL of RNase R enzyme buffer, add nuclease-free pure water to 30 μL, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified circRNA-AntiB1.

[0034] The process of circRNA-AntiB1 from linear to circular Figure 2 As shown by Figure 2 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1, the nucleotide sequence of which is shown in SEQ ID NO:4 (UUACCACAUUAAAUAUGACGA) and the linker sequence 2 (AUGGAAGA). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 3 It can be seen from the gel electrophoresis diagram that after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after the RNase R treatment, and the concentration is similar to the RNA concentration before the RNase R treatment, indicating that the circular RNA has been successfully synthesized in the present invention.

[0035] The results are as follows Figure 2 and Figure 3 shown.

[0036] (5) Preparation of circular RNA preparations: MC3, DSPC, cholesterol, and DMG-PEG2000 were mixed in a ratio of 5:1:3.8:0.2 and added to an ethanol solution to prepare a lipid carrier. The lipid carrier and the circular RNA solution were mixed in a volume ratio of 1:4 through a microfluidic chip to prepare a circular RNA-LNP solution. The mass ratio of circular RNA to nanolipid material was 1:10. The ethanol was then removed through a tangential flow system to obtain a circular RNA lipid nanoparticle preparation, i.e., a circRNA-AntiB1 circular RNA preparation.

[0037] Example 3: Effects on the expression level of inflammatory factors under Vibrio anguillarum infection conditions: 1. Activation of inflammatory factor reporter genes by circRNA-AntiB1 circular RNA preparation. MSPC cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension, which was added into a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0038] After culturing the above cells for 24 hours, discard the supernatant in the above 12-well cell culture plate, rinse once with sterile PBS, and then add cell culture medium at 1 ml / well. Add the prepared circRNA-AntiB1 circular RNA preparation into the above MSPC cells. After 24 hours of transfection, discard the supernatant in the above cell culture plate, rinse once with sterile PBS, and then add cell culture medium at 1 ml / well. The IL-1β, TNFα and NF-κB inflammatory factor reporter gene plasmids were transfected into the above MSPC cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher). After culturing the above cells for 48 hours, the fluorescence value in each cell culture well was detected and recorded using the dual luciferase reporter kit. The results are as follows. Figure 4 shown.

[0039] Depend on Figure 4 It can be seen that circRNA-AntiB1 circular RNA preparation significantly promotes the activation of IL-1β, TNFα and NF-κB inflammatory factor reporter genes. The expression levels of IL-1β, TNFα and NF-κB inflammatory factor reporter genes in cells transfected with circRNA-AntiB1 circular RNA preparation increased by about 2 times compared with the control group.

[0040] 2. Effect of circRNA-AntiB1 circular RNA preparation on the expression level of cellular inflammatory factors under Vibrio anguillarum infection: MSpC cells in the logarithmic growth phase were digested with trypsin digestion solution and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension, which was added into a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator at 28°C.

[0041] After the cells were cultured for 24 hours, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then 1 ml / well of cell culture medium was added. The prepared circRNA-AntiB1 circular RNA preparation was added to the MSPC cells. After 24 hours of transfection, the supernatant in the cell culture plate was discarded, rinsed with sterile PBS, and then 1 ml / well of cell maintenance solution was added. Vibrio anguillarum OD600 = 0.5 was added to the cell culture plate with MSpC cells at 20 μl / well, and a negative control was set up at the same time. The cells were cultured in a cell culture incubator at 28 ° C. After 48 hours of culture, the supernatant in the cell culture plate was removed, and then 1 ml of Trizol lysis solution was added to each well for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit. The total RNA was reverse transcribed using an efficient second-generation full-length cDNA first-strand synthesis kit.

[0042] Then, a universal high-sensitivity dye-based quantitative PCR detection kit and primers were used to detect the mRNA levels of inflammatory factors IL-1β and TNFα.

[0043] IL-1β-RT-1F: 5′-TACGATGGCTAATAACTCC-3′, the nucleotide sequence of which is shown in SEQ ID NO: 5; IL-1β-RT-1R: 5'-CATTGACAAAGTGCTCCA-3'; the nucleotide sequence is shown in SEQ ID NO: 6; TNFα-RT-1F: 5′-GTTTGCTTGGTACTGGAATGG-3′, the nucleotide sequence of which is shown in SEQ ID NO: 7; TNFα-RT-1R: 5'-TGTGGGATGATGATCTGGTTG-3'; the nucleotide sequence is shown in SEQ ID NO: 8; The results are as follows Figure 5 shown.

[0044] To verify the inhibitory effect of circRNA-AntiB1 on Vibrio anguillarum infection, we first detected the activation of IL-1β, TNFα and NF-κB inflammatory factor reporter genes by circRNA-AntiB1. Figure 4 It can be seen that compared with the control group, the IL-1β, TNFα and NF-κB inflammatory factor reporter genes were significantly activated in cells transfected with circRNA-AntiB1 circular RNA preparation. In addition, the effect of circRNA-AntiB1 circular RNA preparation on cellular inflammatory factors after Vibrio anguillarum infection was detected. Figure 5It can be seen that compared with the control group, the expression levels of inflammatory factors in cells transfected with circRNA-AntiB1 circular RNA preparation increased significantly, with IL-1β increasing to about 2 times and TNFα increasing to about 1.8 times the original level.

[0045] In summary, circRNA-AntiB1 circular RNA preparation is suitable for the treatment of Vibrio anguillarum infection in fish, can significantly promote the expression of cellular inflammatory factors, and is conducive to the elimination of bacteria.

[0046] Example 4: Effect on the ability of Vibrio anguillarum to invade cells: Anguillarum in the logarithmic growth phase was washed three times with sterile LB medium, centrifuged and diluted with fresh LB medium containing 100 μM FITC-D-Lys. After incubation at 37°C for 30 minutes, the cells were centrifuged, washed three times with sterile PBS, and then resuspended in PBS.

[0047] MSpC cells in the logarithmic growth phase were obtained and digested with trypsin solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension, which was added into a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0048] After the cells were cultured for 24 hours, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well. The prepared circRNA-AntiB1 circular RNA preparation was added to the MSPC cells. After 24 hours of transfection, the supernatant in the cell culture plate was discarded, rinsed with sterile PBS, and then cell maintenance solution was added at 1 ml / well. FITC-labeled Vibrio anguillarum OD600=0.5 was added to the cell culture plate growing MSpC cells at 20ul / well, and a negative control was set up at the same time. The plates were cultured in a CO2 incubator with a CO2 volume content of 5% and a temperature of 28°C. After the cells were cultured for 48 hours, the infected cells were washed three times with PBS and fixed by incubation with 0.2% Triton X-100 in 4% paraformaldehyde for 30 minutes at room temperature. After DAPI staining (Beyotime), the number of cells invaded by Vibrio anguillarum was photographed and counted under a Leica DMiL8 fluorescence microscope. The results are shown in Figure 6 shown.

[0049] Depend on Figure 6It can be seen that after infection with Vibrio anguillarum, the circRNA-AntiB1 circular RNA preparation significantly reduced the number of cells invaded by Vibrio anguillarum. The number of Vibrio anguillarum in cells transfected with the circRNA-AntiB1 circular RNA preparation was reduced by about 90% compared with the control group.

[0050] Example 5: Effect of circRNA-AntiB1 circular RNA preparation on colonization of Vibrio anguillarum in zebrafish tissues: Take zebrafish of about 4 months old, inject the prepared circRNA-AntiB1 circular RNA preparation into the body of zebrafish by intraperitoneal injection, set up a negative control at the same time, and culture them in a circulating water aquaculture system at a temperature of 28°C. After 24 hours of culture, 20μl of Vibrio anguillarum (OD600=0.5) was injected intraperitoneally into the zebrafish and cultured in a circulating water aquaculture system at a temperature of 28°C.

[0051] After the zebrafish were cultured for 48 hours, liver and spleen tissue samples were collected and placed in different 1.5 ml centrifuge tubes. Sterile 1 mm diameter stainless steel beads were added. 1 ml of sterile PBS solution was added to each tube, followed by shaking. 1 , 10 2 , 10 3 and 10 4 The tissue fragments obtained in the previous step were serially diluted by 1-fold to obtain tissue sample solutions of different concentrations. 10 μl of each dilution gradient sample was dropped onto LB solid medium and inverted for culture at 37°C. After 16 hours of bacterial culture, the number of Vibrio anguillarum colonies growing on LB solid medium was observed and recorded to evaluate the colonization level of Vibrio anguillarum in zebrafish tissues. The results are shown in Figure 2. Figure 7 shown.

[0052] Depend on Figure 7 It can be seen that compared with the control group, the number of Vibrio anguillarum colonized in the liver and spleen of zebrafish transfected with circRNA-AntiB1 circular RNA preparations was significantly reduced, with the number of Vibrio anguillarum colonized in the liver reduced by about 80% and the number of Vibrio anguillarum colonized in the spleen reduced by about 90%.

[0053] In summary, circRNA-AntiB1 circular RNA preparations are very effective in the treatment of Vibrio anguillarum infection, and can significantly reduce the ability of Vibrio anguillarum to invade cells and colonize tissues, further confirming the therapeutic potential of circRNA-AntiB1 circular RNA preparations in eliminating Vibrio anguillarum infection.

[0054] Therefore, the circRNA-AntiB1 circular RNA preparation of the present invention can be used in the preparation of fish bacterial vaccines, antibacterial drugs and other biological immune products in aquaculture. The circRNA-AntiB1 circular RNA preparation can inhibit the invasion and colonization of Vibrio anguillarum by significantly increasing the expression level of inflammatory factors in fish, effectively blocking the spread of Vibrio anguillarum in a variety of economically farmed fish, greatly reducing the risk of outbreaks of fish bacterial diseases caused by Vibrio anguillarum infection, and effectively protecting the healthy breeding of a variety of economically farmed fish, thereby significantly improving the yield and economic benefits of fish breeding.

[0055] In addition, in traditional aquaculture, the treatment of bacterial diseases often relies on the extensive use of antibiotics, which not only pollutes the environment, but also may lead to drug residues and the emergence of drug-resistant strains. Therefore, the introduction of circRNA-AntiB1 circular RNA preparations not only reduces the use of antibiotics, but also has important practical significance in protecting the ecological environment, reducing drug residues, and reducing the risk of the emergence of drug-resistant strains. The application of this innovative technology provides new possibilities for achieving sustainable aquaculture.

[0056] Example 6: Stability test of circRNA-AntiB1 circular RNA preparation: Assay method: Take MSpC cells in the logarithmic growth phase, digest the cells with the corresponding digestion solution, and then dilute them with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added into a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 28°C.

[0057] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. The prepared circRNA-AntiB1 circular RNA preparation was transfected into the above MSpC cells, and 5 replicate wells were transfected. After 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours and 96 hours of transfection, the cells in each well were selected, the supernatant in the well was discarded, rinsed with sterile PBS, and then 1 ml of Trizol lysis buffer was added for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit.

[0058] The total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit. The level of circRNA-AntiB1 was then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers. The results are shown in Figure 8 As shown: circRNA-AntiB1-RT-1F: 5'-ACCACATTAAATATGACGAATG-3', the nucleotide sequence is shown in SEQ ID NO: 9; circRNA-AntiB1-RT-1R: 5'-GCTGAACTACAAGAAACACCG-3', the nucleotide sequence is shown in SEQ ID NO:10.

[0059] Depend on Figure 8 The results show that the relative levels of the synthesized circRNA-AntiB1 circular RNA preparations were detected after 24h, 36h, 48h, 60h, 72h and 96h of transfection into MSpC cells. The circRNA-AntiB1 circular RNA preparation showed almost no degradation trend within 48h of transfection, began to degrade after 60h of transfection, and degraded by about 40%-50% after 96h of transfection. Therefore, it can be seen that the half-life of the circRNA-AntiB1 circular RNA preparation in MSpC cells is about 96h, which has good stability.

[0060] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A fish circular RNA with anti-bacterial infection function, characterized in that: The circular RNA is circRNA-AntiB1, and the nucleotide sequence is shown in SEQ ID NO:

1.

2. A method for preparing fish circular RNA with anti-bacterial infection function, characterized in that: The steps include: (1) The differentially expressed circRNA sequences in the spleen tissue of croaker infected with Vibrio anguillarum were analyzed, and primers circRNA-AntiB1-F and circRNA-AntiB1-R were designed to perform PCR amplification to form a double-stranded DNA template, and T7 RNA polymerase and the double-stranded DNA template were used to perform T7 RNA transcription to obtain linear RNA, which was purified by ethanol precipitation. The nucleotide sequence of the primer circRNA-AntiB1-F is shown in SEQ ID NO:2, and the nucleotide sequence of the primer circRNA-AntiB1-R is shown in SEQ ID NO:3; (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R enzyme was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain circRNA-AntiB1.

3. The use of the fish circular RNA with anti-bacterial infection function as claimed in claim 1, wherein the circular RNA is combined with a lipid nanocarrier, and the prepared circular RNA biological preparation can be used as an antibacterial drug and vaccine product to prevent fish bacterial Vibrio anguillarum infection.

4. The use of fish circular RNA with anti-bacterial infection function according to claim 3, characterized in that: The mass ratio of the circular RNA to the lipid nanocarrier is 1:

10.

5. The use of fish circular RNA with anti-bacterial infection function according to claim 3, characterized in that: The lipid nanocarrier is prepared by mixing MC3, DSPC, cholesterol and DMG-PEG2000 in an ethanol solution at a mass ratio of 5:1:3.8:0.2.

Images