Application of Wheat WRKY Transcription Factor Gene TaWRKY1

Abstract

The present invention discloses the application of a wheat WRKY transcription factor gene TaWRKY1 , belonging to the technical field of genetic engineering. The nucleotide sequence of the open reading frame of the gene TaWRKY1 is shown in SEQ ID NO:5. The gene TaWRKY1 is induced to express by the infection of Puccinia striiformis f. sp. tritici during the interaction between wheat and Puccinia striiformis f. sp. tritici, and plays a negative regulatory role in wheat resistance to stripe rust. The present invention creates TaWRKY1 gene-edited mutant plants by means of Agrobacterium-mediated genetic transformation. The spore production on the leaves of the gene-edited mutant wheat is significantly reduced, and the hypersensitive necrosis increases, indicating that editing the gene TaWRKY1 can improve the resistance of wheat to stripe rust. The present invention provides a disease-resistant germplasm resource for the cultivation of wheat varieties resistant to stripe rust.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and relates to the application of wheat WRKY transcription factor genes TaWRKY1 . Background Art

[0002] Wheat stripe rust is an important disease in wheat production, which affects the yield and quality of wheat. Wheat stripe rust is a fungal disease caused by Puccinia striiformis f. sp. tritici ( Puccinia striiformis f. sp tritici , Pst). This disease may occur from the emergence to the maturity of wheat. It mainly damages the leaves of wheat, followed by leaf sheaths, stems, and also infects tissues such as spikes, glumes, and awns. Wheat stripe rust is mainly spread by air currents. Urediniospores are diffused to wheat fields by air currents and infect healthy wheat plants. In addition, seed-borne bacteria are also one of the important ways of disease transmission. Due to the characteristics of the heteroecious parasitism of Puccinia striiformis f. sp. tritici, its virulence varies frequently, and new physiological races are likely to appear, resulting in the loss of resistance of many disease-resistant varieties. Therefore, it is of great significance to explore new wheat disease-resistant gene resources and accelerate the creation and cultivation of new wheat varieties resistant to stripe rust.

[0003] Transcription factors are a class of proteins that can recognize the structure of specific regions of DNA and bind to them, making them serve as transcription start sites to initiate or inhibit the transcription process of genes associated with them. As one of the largest transcription factor families in plants, WRKY transcription factors are widely involved in the responses of plants to biotic, abiotic, and hormonal stresses, and play important roles in plant stress resistance, pathogen attack on plant defense responses, growth and development regulation, and regulation of related gene expression. Therefore, studying how WRKY transcription factors play a disease-resistant role in the interaction between wheat and Puccinia striiformis f. sp. tritici and revealing the mechanism of action of transcription factors against stripe rust is of great significance for improving and cultivating wheat varieties resistant to stripe rust. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides the application of wheat WRKY transcription factor genes TaWRKY1 . The nucleotide sequence of the open reading frame of the gene TaWRKY1 is shown in SEQ ID NO:5, and the amino acid sequence of the transcription factor TaWRKY1 encoded by this gene is shown in SEQ ID NO:6. The gene TaWRKY1 is induced to express by the infection of Puccinia striiformis f. sp. tritici and plays a negative regulatory role in wheat resistance to stripe rust. Editing the gene TaWRKY1 can improve the resistance of wheat to stripe rust. The present invention provides a disease-resistant germplasm resource for the cultivation of wheat varieties resistant to stripe rust.

[0005] To achieve the technical objectives of the present invention, on the one hand, the present invention provides the application of wheat WRKY transcription factor genes TaWRKY1 in the cultivation of wheat varieties resistant to stripe rust. The geneTaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 5. The gene TaWRKY1 encodes the transcription factor TaWRKY1, and the amino acid sequence of the transcription factor TaWRKY1 is shown in SEQ ID NO: 6.

[0006] Furthermore, the gene TaWRKY1 is induced to express by the infection of Puccinia striiformis f. sp. tritici, and plays a negative regulatory role in wheat resistance to stripe rust. Editing the gene TaWRKY1 can improve the resistance of wheat to stripe rust.

[0007] Specifically, by analyzing the expression profile of the gene TaWRKY1 under the infection of different physiological races of Puccinia striiformis f. sp. tritici, it is known that the gene TaWRKY1 is induced to express by the infection of Puccinia striiformis f. sp. tritici during the interaction between wheat and Puccinia striiformis f. sp. tritici, and the gene TaWRKY1 and its encoded transcription factor TaWRKY1 may be involved in the immune regulation pathway of wheat resistance to stripe rust.

[0008] Specifically, based on the CRISPR / Cas9 gene editing technology, the gene TaWRKY1 is edited, and gene-edited plants are created by using the Agrobacterium-mediated wheat genetic transformation technology. On the T2 generation positive lines of the gene-edited plants, the virulent race CYR31 of Puccinia striiformis f. sp. tritici is inoculated. After 14 days, the phenotypes are observed and it is found that compared with the wild-type control plants, TaWRKY1 the spore production on the wheat leaves of the T2 generation positive lines Line61, Line64 and Line67 of the gene-edited plants is significantly reduced, and the hypersensitive necrosis increases, indicating that editing the gene TaWRKY1 enhances the resistance of wheat to stripe rust. TaWRKY1 Specifically, the present invention constructs transgenic plants overexpressing the gene

[0009] On the transgenic plants overexpressing the gene, the avirulent race CYR23 of Puccinia striiformis f. sp. tritici is inoculated, and the relative expression of the gene TaWRKY1 is analyzed. It is found that compared with the wild-type control wheat, the relative expression level of the gene TaWRKY1 in the transgenic plants overexpressing the gene is significantly increased, and the spore production is significantly increased, indicating that the plants overexpressing the gene TaWRKY1 have weakened resistance to Puccinia striiformis f. sp. tritici, and the gene TaWRKY1 negatively regulates the resistance of wheat to stripe rust. TaWRKY1 On the other hand, the present invention claims a method for cultivating a wheat variety resistant to stripe rust, by gene editing the gene

[0010] The nucleotide sequence of the open reading frame of the gene TaWRKY1 is shown in SEQ ID NO: 5. TaWRKY1

[0011] ​Furthermore, the method for cultivating wheat varieties resistant to stripe rust includes constructing a gene editing vector and transforming the gene editing vector into wheat immature embryos to obtain wheat varieties resistant to rust. The gene editing vector is used to edit the gene TaWRKY1 , and the gene editing vector is Cas9.

[0012] To understand the technical solution of the present invention completely and without objection, it should be supplemented that the wheat WRKY transcription factor gene in the present invention is represented by the italic font " TaWRKY1 ", and the wheat WRKY transcription factor protein is represented by the non-italic font "TaWRKY1". Of course, those of ordinary skill in the art can clearly and completely understand the meanings and expressions of related genes and their encoded proteins according to the description of the present invention.

[0013] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0014] (1) The gene provided by the present invention TaWRKY1 is induced to express by the infection of Puccinia striiformis f. sp. tritici. Through analyzing the expression profile of the gene TaWRKY1 under the infection of different physiological races of Puccinia striiformis f. sp. tritici, it is known that the gene TaWRKY1 is induced to express by the infection of Puccinia striiformis f. sp. tritici during the interaction between wheat and Puccinia striiformis f. sp. tritici, and the gene TaWRKY1 and its encoded transcription factor TaWRKY1 may be involved in the immune regulation pathway of wheat resistance to stripe rust.

[0015] (2) The gene provided by the present invention TaWRKY1 plays a negative regulatory role in wheat resistance to stripe rust. The present invention constructs transgenic plants overexpressing the gene TaWRKY1 , inoculates the avirulent race CYR23 of Puccinia striiformis f. sp. tritici on the overexpressing transgenic plants, and analyzes the relative expression of the gene TaWRKY1 . It is found that compared with the wild-type control wheat, the relative expression level of the gene TaWRKY1 in the overexpressing transgenic plants is significantly increased, and the sporulation amount is significantly increased, indicating that the plants overexpressing the gene TaWRKY1 have weakened resistance to Puccinia striiformis f. sp. tritici, and the gene TaWRKY1 negatively regulates wheat resistance to stripe rust.

[0016] (3) Based on the CRISPR / Cas9 gene editing technology, the present invention edits the gene TaWRKY1 , and uses the Agrobacterium-mediated wheat genetic transformation technology to create TaWRKY1 gene-edited plants. The virulent race CYR31 of Puccinia striiformis f. sp. tritici is inoculated on the T2 generation positive lines of the gene-edited plants, and the phenotypes are observed 14 days later. It is found that compared with the wild-type control plants, TaWRKY1The spore production on the wheat leaves of the T2 generation positive lines Line61, Line64, and Line67 of the gene-edited plants was significantly reduced, and the hypersensitive necrosis increased, indicating that the edited gene TaWRKY1 enhanced the resistance of wheat to stripe rust.

[0017] (4) The present invention provides a new technical idea for cultivating wheat varieties resistant to stripe rust from the perspective of molecular biology, and lays a foundation for the genetic improvement of wheat resistance to stripe rust. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention.

[0019] Figure 1 It is the TaWRKY1 expression profile analysis diagram of the gene. ** indicates P the value < 0.01.

[0020] Figure 2 It is the TaWRKY1 detection result diagram of PCR positive plants of gene-edited plants. L61, L64, and L67 are respectively TaWRKY1 the T2 generation positive lines Line61, Line64, and Line67 of gene-edited plants; P is the final vector TaWRKY1 -Cas9; WT is the wild-type control Fielder; H is the negative control H2O; M is the DNA Marker.

[0021] Figure 3 It is the TaWRKY1 schematic diagram of the editing situation of gene-edited plants. TaWRKY1 -gRNA is the target sequence of the gene TaWRKY1 ; Target is the target sequence of the gene TaWRKY1 ; WT-3A, WT-3B, and WT-3D are three wild-type wheat plants respectively; TaWRKY1 -KO-3A, TaWRKY1 -KO-3B, and TaWRKY1 -KO-3D are three T2 generation wheat TaWRKY1 gene-edited plants respectively; +1bp, -4bp are the editing situations of gene-edited plants.

[0022] Figure 4 It is the TaWRKY1 gene-editing vector diagram. Among them, Target1 and Target2 are TaWRKY1Two target sgRNAs of the gene; TaU6 is the promoter for Target1 and Target2; Cas9 is the core element of the gene editing system encoding the Cas9 protein; ZmUbi is the maize ubiquitin promoter for initiating the expression of Cas9.

[0023] Figure 5 is TaWRKY1 Phenotype result diagram of gene-edited plants inoculated with stripe rust fungus CYR31. Fielder is a wild-type wheat variety; CYR31 is a physiological race CYR31 of stripe rust fungus; TaWRKY1 -KO is TaWRKY1 gene-edited plants.

[0024] Figure 6 is TaWRKY1 Phenotype result diagram of overexpressing transgenic plants inoculated with physiological race CYR23 of stripe rust fungus. Fielder is a wild-type wheat variety; CYR23 is a physiological race CYR23 of stripe rust fungus; TaWRKY1 -OE is TaWRKY1 overexpressing transgenic plants, and L69, L78, and L82 are respectively the T1 generation positive lines Line69, Line78, and Line82 of the overexpressing transgenic plants.

[0025] Figure 7 is TaWRKY1 Expression of the gene TaWRKY1 in overexpressing transgenic plants and wild-type plants. TaWRKY1 -OE#L69, TaWRKY1 -OE#L78, TaWRKY1 -OE#L82 are respectively the T1 generation positive lines Line69, Line78, and Line82 of the overexpressing transgenic plants. Detailed implementation manners

[0026] Next, the technical solutions of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are all conventional methods unless otherwise specified; the reagents and materials are all commercially available unless otherwise specified.

[0027] Example 1

[0028] This example provides the expression profile analysis of the wheat WRKY transcription factor gene TaWRKY1

[0029] ​Using the normal soil-cultivated Fielder wheat variety as the material, at the two-leaf and one-heart stage of wheat, the stripe rust physiological races CYR23 and CYR33 were inoculated on the second leaf by the smearing method and kept moisturized in the dark for 24 h. Water was set as the control group. At 24 h, 48 h, 72 h, 96 h, and 120 h after inoculation, the inoculated leaves were collected and stored at -80°C. Total RNA of the collected samples was extracted, and the reverse transcriptase was used to reverse-transcribe the total RNA into the first strand of cDNA. The reverse transcription reaction conditions were: 42°C, incubation for 1 h; 95°C, heating for 5 min. Using cDNA as the template, the wheat elongation factor gene TaEF as the internal reference gene, and the specific fragment of gene TaWRKY1 was used for real-time fluorescence quantitative PCR. The reaction conditions were: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 30 sec; annealing: 60°C, 30 sec; extension: 72°C, 30 sec; 40 cycles. The reaction was performed in 3 replicates, and the Ct values, their average values, and standard deviations of each replicate were generated by the quantitative PCR instrument by manually adjusting the baseline. The average Ct value was taken, and the 2 -△△CT method was used to calculate the relative expression level of gene TaWRKY1 ( Figure 1 ).

[0030] TaEF Internal reference gene primers:

[0031] TaEF -F: TGGTGTCATCAAGCCTGGTATGGT;

[0032] TaEF -R: ACTCATGGTGCATCTCAACGGACT.

[0033] TaWRKY1 Gene specific fragment primers:

[0034] TaWRKY1 -qRT-F: AAGAAGAGCCGGGCATCG;

[0035] TaWRKY1 -qRT-R: TCGTTCATGCGGCTCAGC.

[0036] As can be seen from Figure 1 , gene TaWRKY1 is induced to express by stripe rust infection during the interaction between wheat and stripe rust. Gene TaWRKY1 and its encoded transcription factor TaWRKY1 may be involved in the immune regulation pathway of wheat resistance to stripe rust.

[0037] Example 2

[0038] This example provides the isolation and cloning of the wheat WRKY transcription factor gene TaWRKY1 .

[0039] Using the cDNA reverse transcribed in Example 1 as a template, specific primers for the gene TaWRKY1 were designed and amplified using an ordinary PCR instrument. The ordinary PCR reaction conditions were: pre-denaturation: 95°C, 5 min; denaturation: 95°C, 30 sec; annealing: 52°C, 30 sec; extension: 72°C, 2 min; 35 cycles. The amplified DNA fragment was sequenced, and when the sequencing was correct, a DNA fragment containing the open reading frame of the gene TaWRKY1 was obtained. The nucleotide sequence of the open reading frame of the gene TaWRKY1 is shown in SEQ ID NO:5, and the amino acid sequence of the wheat WRKY transcription factor TaWRKY1 encoded by the gene TaWRKY1 is shown in SEQ ID NO:6.

[0040] Example 3

[0041] This example provides the creation, editing situation analysis, and disease resistance identification of gene TaWRKY1 mutant plants.

[0042] Two editing targets for the gene TaWRKY1 were designed in the wheat genome. Fragment Target-1 and Fragment Target-2 were synthesized and annealed. At the same time, the intermediate vector sgRNA was digested with BtgZ1 single enzyme, and then the digested vector was ligated with the synthesized fragment Target-1 using T4 ligase. The ligation product was transformed into Escherichia coli DH5α. When it grew to the point where colonies could be picked, monoclonal positive colonies were detected and cultured with shaking, and then sent for sequencing. The monoclonal colonies with correct sequencing were cultured and plasmids were extracted; the vector sgRNA-Target-1 was digested with Bsa1 enzyme, and then the digested vector was continued to be ligated with Fragment Target-2 using T4 ligase. The ligation product was transformed into Escherichia coli in the same way as above, cultured with shaking, and sent for sequencing. The monoclonal colonies with correct sequencing were cultured and plasmids were extracted to obtain the intermediate vector sgRNA-Target-1-Target-2. Subsequently, the intermediate vector sgRNA-Target-1-Target-2 was ligated with the final vector Cas9 using the LR reaction, and the above steps of Escherichia coli transformation and plasmid extraction were continued to obtain the final vector TaWRKY1 -Cas9. The final vector TaWRKY1 -Cas9 was introduced into Agrobacterium tumefaciens EHA105, and wheat immature embryos with Fielder as the recipient variety were infected. Gene TaWRKY1 editing materials were created using the Agrobacterium-mediated genetic transformation technology, and the positive plants of this material were subcultured and planted to the T2 generation. PCR positive plants of the T2 generation were detected (Figure 2 , Figure 3 , Figure 4 ).

[0043] Sow the T2 generation seeds in 7×7×8 cm flower pots, with 9 seeds per pot, and at the same time sow the wild-type material Fielder. When the materials grow to the stage of two leaves and one heart, inoculate the compatible race CYR31 on the second leaf, incubate in the dark with humidity at 12 °C for 24 h, and then transfer to normal growth conditions (16 h of light, 14 °C; 8 h of darkness, 10 °C as one growth cycle) for cultivation. Observe the phenotypes after 14 days ( Figure 5 ).

[0044] Gene editing target design:

[0045] TaWRKY1 -Target-1-F:ACTTGGAACAACACGAGGAGCGAC;

[0046] TaWRKY1 -Target-1-R:AAACGTCGCTCCTCGTGTTGTTCC;

[0047] TaWRKY1 -Target-2-F:ACTCGCATGAACGAGGAGAACCAG;

[0048] TaWRKY1 -Target-2-R:AAACCCGAAGCCGGCAGCTCTTGC.

[0049] Primers for detecting gene-edited positive plants:

[0050] NOS-F:AAGCACATACGTCAGAAACCATTAT;

[0051] NOS-R:TGGGTGAGATTCCTTGAAGTTGAGTA.

[0052] As can be seen from Figure 2 , TaWRKY1 the T2 generation positive lines Line61, Line64, and Line67 of the gene-edited plants have all successfully transformed the final vector TaWRKY1 -Cas9. As can be seen from Figure 3 , TaWRKY1 the gene-edited plants TaWRKY1 -KO-3A, TaWRKY1 -KO-3B, and TaWRKY1 -KO-3D have all modified the target gene TaWRKY1 as expected. As can be seen from Figure 5 , compared with the wild-type control plants, TaWRKY1The spore production on the wheat leaves of the T2 generation positive lines Line61, Line64, and Line67 of the gene-edited plants was significantly reduced, and the hypersensitive necrosis increased, indicating that the edited gene TaWRKY1 enhanced the resistance of wheat to stripe rust.

[0053] Example 4

[0054] This example provides the creation of TaWRKY1 transgenic wheat with overexpression and the identification of its disease resistance.

[0055] Based on Example 2, the gene TaWRKY1 was constructed into the overexpression vector pANIC-6E through the Gateway reaction to obtain the overexpression recombinant vector TaWRKY1 -OE. Subsequently, the successfully constructed overexpression recombinant vector TaWRKY1 -OE was introduced into Agrobacterium tumefaciens EHA105, and the overexpression recombinant vector TaWRKY1 -OE was transformed into wheat (Fielder) by the Agrobacterium-mediated infection method to obtain the TaWRKY1 transgenic plants with overexpression of the gene. The overexpression transgenic plants were advanced to the T1 generation. When the materials grew to the two-leaf and one-heart stage, the non-compatible race CYR23 was inoculated on the second leaf, and they were cultured in the dark with humidity at 12 °C for 24 h, and then transferred to normal growth conditions (16 h of light, 14 °C; 8 h of darkness, 10 °C as a growth cycle) for culture. After 14 days, the phenotypes were observed ( Figure 6 ). The leaves of the overexpression transgenic wheat and the Fielder wild-type wheat were collected, RNA was extracted and reverse transcribed into cDNA, and the expression of the gene TaWRKY1 in the wild-type wheat and the transgenic plants was analyzed ( Figure 7 ).

[0056] Primers for constructing the overexpression recombinant vector:

[0057] TaWRKY1 -OE-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACAAGGGCCACCTCGGT;

[0058] TaWRKY1 -OE-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCTACCCATACGATGTTCCAGATTACGCTGATTACAAGGACGACGATGACAAGTTGGGTCTCGCTGTTGGTGTTGTTG.

[0059] It can be seen from Figure 6 and Figure 7 that the gene TaWRKY1The relative expression level was significantly increased, indicating the successful construction of overexpressing transgenic plants. Compared with the wild-type control wheat, the sporulation amount on the leaves of overexpressing transgenic wheat was significantly increased, and the plants overexpressing gene TaWRKY1 showed weakened resistance to stripe rust, indicating that gene TaWRKY1 plays a negative regulatory role in the defense response of wheat against stripe rust.

[0060] The above-described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by relevant deductions and substitutions made by those of ordinary skill in the art under the condition of the concept of the present invention without creative efforts fall within the scope of protection of the present invention.

Claims

1. Wheat WRKY transcription factor genes TaWRKY1 The application of the method in breeding wheat varieties resistant to stripe rust is characterized in that: The gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO:5; Gene editing of the gene in wheat TaWRKY1 , improve wheat's resistance to stripe rust; The gene editing is gene deletion.

2. The use according to claim 1, characterized in that: The gene TaWRKY1 Encodes the transcription factor TaWRKY1, and the amino acid sequence of the transcription factor TaWRKY1 is shown in SEQ ID NO:

6.

3. The use according to claim 1, characterized in that: The gene TaWRKY1 Expression was induced by wheat stripe rust infection.

4. The use according to claim 3, characterized in that: The gene TaWRKY1 It plays a negative regulatory role in wheat resistance to stripe rust.

5. A method for breeding wheat varieties resistant to stripe rust, characterized in that: Gene editing in wheat TaWRKY1 , improve wheat's resistance to stripe rust; The gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO:5; The gene editing is gene deletion.

6. The method for breeding wheat stripe rust resistant varieties according to claim 5, characterized in that: The method comprises constructing a gene editing vector, and transforming the gene editing vector into wheat immature embryos to obtain a wheat stripe rust resistant variety; The gene editing vector is used to edit genes TaWRKY1 .

7. The method for breeding wheat stripe rust resistant varieties according to claim 6, characterized in that: The gene editing vector includes Cas9.

Images