Prokaryotically expressed I group 8a type fowl adenovirus agar diffusion antigen as well as preparation method and application of prokaryotically expressed I group 8a type fowl adenovirus agar diffusion antigen

Abstract

The invention discloses a prokaryotically expressed I group 8a type fowl adenovirus agar diffusion antigen as well as a preparation method and application thereof, and belongs to the technical field of biological diagnosis. According to the invention, prokaryotic expression is carried out on the primary antigen Fiber protein of the I-group 8a type fowl adenovirus, and the purified Fiber protein is used as an agar diffusion antigen to establish the agar diffusion detection method for the I-group 8a type fowl adenovirus antibody. According to the present invention, the expressed and purified Fiber protein is creatively adopted as the agar diffusion antigen, and the excellent effect is obtained;

Description

Technical Field

[0001] The invention belongs to the technical field of biological diagnosis, and in particular relates to a prokaryotic expressed group I type 8a avian adenovirus agar antigen and a preparation method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to increase some understanding of the overall background of the invention, and should not be necessarily regarded as an admission or any form of suggestion that the information constitutes the prior art already known to ordinary technicians in this field.

[0003] Avian adenovirus (FAdV) can cause a series of comprehensive symptoms, including inclusion body hepatitis, pericardial effusion syndrome, gizzard erosion, etc., which has brought huge economic losses to my country's poultry farming industry. Avian adenovirus belongs to the Adenoviridae family and the genus Avian adenovirus. It is a non-enveloped double-stranded DNA virus. According to antigenic differences, it can be divided into Group I, Group II, and Group III. Among them, Group I avian adenovirus can be divided into 12 serotypes (1-7, 8a, 8b, 9-11), and there is no cross-protection between the serotypes. Serotype 8a avian adenovirus mainly causes chicken inclusion body hepatitis, which is manifested as yellow and brittle liver, resulting in decreased immunity of chickens, severe secondary infection, and decreased production performance. It is an important disease affecting my country's poultry industry. Summary of the invention

[0004] In view of the deficiencies in the prior art, the first problem to be solved by the present invention is to provide a prokaryotically expressed group I type 8a avian adenovirus agar antigen and a preparation method thereof.

[0005] The second technical problem to be solved by the present invention is to provide an AGP detection method using the agar antigen of the group I type 8a avian adenovirus.

[0006] The present invention utilizes prokaryotic expression of the Fiber protein, the major antigen of the group I type 8a avian adenovirus, and uses the purified Fiber protein as an adenovirus antigen to establish a method for detecting antibodies against the group I type 8a avian adenovirus. The inventor initially expressed the Fiber-2 gene directly amplified from the group I type 8a avian adenovirus, but the expression level was low and most of the expressed proteins were in the form of insoluble inclusion bodies, which could not be directly used for the AGP test. Later, the serum group I type 8a avian adenovirus Fiber-2 protein sequence was artificially optimized, and the gene sequence shown in SEQ ID NO: 1 was finally selected to achieve soluble and efficient expression, and the AGP detection method was successfully established; other optimized group I type 8a avian adenovirus Fiber-2 protein sequences were verified by experiments to have low expression levels and / or low solubility, and the AGP detection method could not be successfully established.

[0007] To solve the above problems, the technical solution adopted by the present invention is as follows:

[0008] In the first aspect of the present invention, a gene encoding a prokaryotically expressed avian adenovirus group I type 8a adenovirus antigen is provided, and the nucleotide sequence thereof is shown in SEQ ID NO:1.

[0009] In a second aspect of the present invention, a method for preparing a prokaryotically expressed group I 8a avian adenovirus agar antigen is provided, the method comprising the following steps:

[0010] (1) Optimization and synthesis of the target gene. The optimized gene nucleotide sequence is shown in SEQ ID NO: 1; (2) Primer design; (3) Target gene amplification; (4) Target gene recovery and restriction digestion; (5) Vector restriction digestion; (6) Target gene cloning and sequencing; (7) Target gene expression; (8) Target protein purification and determination.

[0011] In one or some embodiments of the present invention, in step (2), the primers include an upstream primer P1 and a downstream primer P2, an endonuclease HindⅢ site and a protective base are added to the 5' end of the upstream primer P1, and an endonuclease NotI site and a protective base are added to the 5' end of the downstream primer P2, the size of the amplified fragment is 1572 bp, and the nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0012] In the third aspect of the present invention, there is provided a prokaryotically expressed group I type 8a avian adenovirus agar antigen prepared by the above method.

[0013] In one or some embodiments of the present invention, the protein content of the agar antigen is 0.5-0.75 mg / mL, preferably 0.75 mg / mL.

[0014] In a fourth aspect of the present invention, a prokaryotically expressed group I 8a avian adenovirus agar-amplified antigen reagent is provided, wherein the agar-amplified antigen reagent is prepared by the following method:

[0015] (1) Antigen inactivation: mixing the agar-expanded antigen and formaldehyde solution to inactivate the antigen to obtain an inactivated antigen;

[0016] (2) Preparation of lyophilized protective agent: Weigh sucrose, trehalose and skimmed milk powder, add purified water to make up to 100 ml, fully dissolve and sterilize to obtain lyophilized protective agent;

[0017] (3) The inactivated antigen and the lyophilization protective agent are mixed according to a set ratio, and after lyophilization, a prokaryotic expressed group I type 8a avian adenovirus agar amplification antigen reagent is obtained.

[0018] In one or some embodiments of the present invention, the specific steps of antigen inactivation are as follows: adding a formaldehyde solution with a final concentration of 0.8 to 1.2‰ to agar antigen with a concentration of 0.5 to 0.75 mg / mL, and placing it in a shaker at 35 to 40°C and 100 to 150 rpm for 18 to 36 hours for inactivation.

[0019] In one or some embodiments of the present invention, in step (2), to ensure the stability of the antigen, the feed ratio of sucrose, trehalose and skim milk powder is 12.5:3:5. The preferred embodiment is 12.5g sucrose, 3g trehalose and 5g skim milk powder, and purified water is added to make the volume to 100ml.

[0020] In one or some embodiments of the present invention, in step (3), to ensure the stability of the antigen, the ratio of inactivated antigen to lyophilization protectant is 1.5 ml:0.5 ml. A preferred embodiment is: each bottle of lyophilized agar-expanded antigen contains 1.5 ml of inactivated antigen and 0.5 ml of lyophilization protectant.

[0021] In a fourth aspect of the present invention, a method for detecting AGP based on a prokaryotically expressed group I 8a avian adenovirus agar antigen is provided, the method comprising the following steps:

[0022] The group I type 8a avian adenovirus agar antigen reagent is fully dissolved with PBS, and the dissolved antigen reagent is added to the middle well of the agarose plate, and the test samples diluted in multiples are added to the surrounding wells in turn, placed in a wet box, and placed in an incubator for 24 to 36 hours before observing the results.

[0023] Compared with the related art known to the inventor, one of the technical solutions of the present invention has the following beneficial effects:

[0024] The fiber protein of the present invention is innovative: the fiber protein sequence of serum type 8a group I avian adenovirus is artificially optimized to achieve soluble and efficient expression, while most fiber genes in the prior art are directly amplified from the virus without sequence optimization, and thus cannot achieve the purpose of the present invention.

[0025] In the previous stage, the whole FAdV-8a virus was used as an antigen, but antibodies of different serotypes could not be distinguished. In this invention, the purified Fiber protein was used as an agar antigen, which achieved excellent results.

[0026] The prokaryotically expressed group I 8a avian adenovirus agar amplification antigen reagent of the present invention has excellent stability and can be stored at 4°C for 12 months and at -18°C for 24 months. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute improper limitations on the present invention.

[0028] Figure 1 The SDS-PAGE electrophoresis diagram of the prokaryotically expressed Fiber protein of group I type 8a avian adenovirus of the present invention; wherein M is a protein marker, 1 is the supernatant after the expression product is crushed, and 2 is the precipitate after the expression product is crushed;

[0029] Figure 2 The agar amplification result of the positive serum in the agar amplification antigen test of avian adenovirus type 8a with a concentration of 1 mg / mL described in the present invention;

[0030] Figure 3 The agar amplification result of the positive serum in the agar amplification antigen test of avian adenovirus type 8a of group I with a concentration of 0.75 mg / mL according to the present invention;

[0031] Figure 4 The agar amplification result of the positive serum in the agar amplification antigen test of avian adenovirus type 8a group I at a concentration of 0.5 mg / mL according to the present invention;

[0032] Figure 5 This is the agar amplification result of the positive serum tested for the agar amplification antigen of avian adenovirus type 8a group I at a concentration of 0.25 mg / mL as described in the present invention. DETAILED DESCRIPTION

[0033] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0034] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations and / or combinations thereof.

[0035] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0036] Example 1 Preparation of prokaryotically expressed avian adenovirus group I type 8a adenovirus antigen

[0037] 1. Target gene optimization and synthesis

[0038] The fiber gene sequence of group I serotype 8a fowl adenovirus (FAdV-8a) was downloaded from NCBI, optimized according to the codon preference of Escherichia coli and the protein soluble expression tendency, and sent to a gene company for artificial synthesis. The optimized sequence is shown in SEQ ID NO: 1.

[0039] 2. Primer design

[0040] According to the optimized Fiber gene sequence, a pair of amplification primers were designed. The 5' end of the upstream primer P1 added an endonuclease HindⅢ site and a protective base, and the 5' end of the downstream primer P2 added an endonuclease NotI site and a protective base. The size of the amplified fragment was 1572 bp, and the sequence was as follows:

[0041] P1: 5'-GTCAAAGCTTATGGCAACGTCCACCCCT-3' (as shown in SEQ ID NO: 2)

[0042] P2: 5'-TTGTGCGGCCGCGGAAACATCCGCGGTGGA-3' (as shown in SEQ ID NO: 3)

[0043] SEQ ID NO:1 Sequence:

[0044] ATGGCAACGTCCACCCTCACGCTTTTAGCTTTGGTCAGATCGGCTCTCGTAAACGTCCGGCCGGTG

[0045] GTGACGGTGAACGCGACGCCTCCAAAGTGCCGAAAATGCAGACTCCGGCACCATCTGCTACTGCTA

[0046] ATGGTAACGATGAACTGGACCTGGTTTACCCGTTCTGGCTGCAGAACGGTTCTACCGGTGGTGGCGG

[0047] CGGTGGTGGTTCTGGTGGTAACCCTAGCCTGAACCCGCCATTCCTGGATCCGAACGGCCCACTGGCC

[0048] GTTCAAAACAACCTGCTGAAGGTGAACACTGCCGCTCCGATTACCGTGACTAACAAAGCGCTGACTC

[0049] TGGCTTACGAACCAGAATCTCTGGAACTGACTAACCAACAGCAGCTGGCGGTTAAAATCGACCCTG

[0050] AAGGTCCGCTGAAGGCTACTACTGAGGGTATCCAGCTGTCTGTGGACCCTATGACCCTGGAAGTGGA

[0051] CGACGTGGATTGGGAACTGACTGTGAAACTGGATCCGAACGGTCCTCTGGACTCTAGCGCAACCGGT

[0052] ATCACTGTCCGCGTAGACGATACGCTGCTGATTGACGATGATGGTTCTGGTCAGGGCAAAGAACTGG

[0053] GTGTACACCTGAACCCGGATGGTCCGATCACCGCAGACCAGAACGGTCTGGATCTGGAGATTGACA

[0054] ACCAGACCCTGAAGATCACCCCGGGCTCCGCGGGTGGCGTTCTGTCTGTTCAGCTGAAGCCGCAGGG

[0055] TGGTCTGAACTCTCAGAGCGACGGTATCCAGGTAGTGACCCAAAATAGCATCGAAGTAGACAATGG

[0056] CGCGCTGGACGTTAAAGTTGTTGCCAACGGTCCGCTGTCCACCACCCCGAACGGTCTGACCCTGAAC

[0057] TACGATACCGGCGACTTCACCGTGAATGCGGGTACTCTGTCTATCCTGCGCAACCCGTCTCTGGTGG

[0058] CAAACGCCTATCTGACCAGCGGCGCCCGCACCCTGCAGCAATTCACCGCAAAAGGTGAAAACAGCT

[0059] CCCAGTTCTCCTTCCCGTGCGCTTACTATCTGCAGCAATGGCTGTCTGACGGCCTGATTTTCTCCTCTC

[0060] TGTACCTGAAACTGGATCGCACGCGCTTTACCGGCATGTCTTCTGACCCGTCTTACCAGAACGCGCG

[0061] CTACTTTACGTTCTGGGTAGGTGGCGGTGCGGCAATGAACCTGTCCCAGCTGTCTACTCCGACTATTA

[0062] CCCCGTCCACGACTGAATGGACCGCTTTCGCCCCGGCGCTGAATTACTCTGGTGCTCCGGCGTTCGT

[0063] ATACGACGCGAACCCAGTATTCACTATTTACTTCCAGCCGAATACCGGCCGTGTGGATAACCTACCTG

[0064] CCGGGTGCTGACTGGCGATTGGAAGACGAGCTCTACCTACAACCCAGGCACCATTACTCTGGTCGTAC

[0065] GCAACGCGACTATTCAGCTGCAGTCTCAATCCACCTTCACCACCTCCGTGTGTTACAACTTCCGCTGC

[0066] CAAAATTCCGGTATCTTCAACAATAACGCCACTTCCGGTACCCTGACGCTGGGCCCGATTTTCTACTC

[0067] TTGCCCGGCTCTGTCCACCGCGGATGTTTCC

[0068] 3. Target gene amplification

[0069] The following PCR reaction was performed using the synthesized fiber gene as a template and a high-fidelity enzyme.

[0070] The reaction system (50 μL) includes: 34 μL of ddH2O, 10 μL of 5×PCR buffer, 1 μL of 10 mM dNTP, 1 μL of 10 pmol / μL primer P1 / P2, 1 μL of Super-Fidelity DNA Polymerase, and 2 μL of sample nucleic acid.

[0071] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 sec, annealing at 55°C for 20 sec, and extension at 72°C for 40 sec, for a total of 30 cycles; and extension at 72°C for 5 min.

[0072] 4. Target gene recovery and enzyme digestion

[0073] The amplified PCR product was subjected to 1.2% agarose gel electrophoresis. The agarose gel was prepared as follows: 0.72 g agarose was weighed and placed in a conical beaker, 60 mL TAE electrophoresis buffer was added, and the mixture was heated and melted in a microwave oven. After cooling slightly, 3 μL nucleic acid dye was added, and the mixture was plated. After the gel was cooled and solidified, the PCR product and the standard molecular weight 2000 DNA Marker were added to the sample wells in sequence, and the gel was placed in the electrophoresis tank. The gel was electrophoresed at 120 V for 25 min. After separation was observed by a UV analyzer, the target fragment was cut and recovered and purified using a DNA gel recovery kit.

[0074] The recovered and purified target gene was double-digested with endonucleases HindⅢ and NotI. The reaction system and reaction procedure were as follows:

[0075] The reaction system (50 μL) included: 10×buffer H 5 μL, 0.1% BSA 5 μL, HindⅢ 1 μL, NotI 1 μL, target gene 20 μL, and ddH2O 18 μL.

[0076] The reaction procedure is: incubate in a 37°C water bath for 2 hours.

[0077] 5. Vector digestion

[0078] The PET-32a plasmid bacteria were streaked on solid LB medium containing 1‰ ampicillin (50 mg / mL), cultured overnight at 37°C, and a single colony was picked and inoculated into liquid LB medium containing 1‰ ampicillin (50 mg / mL), and cultured overnight at 37°C in a shaker at 160rpm. The plasmid in the bacterial solution was extracted according to the instructions of the plasmid extraction kit. Double enzyme digestion was performed using endonucleases HindⅢ and NotI. The reaction system and reaction procedure are as follows:

[0079] The reaction system (50 μL) included: 10×buffer H 5 μL, 0.1% BSA 5 μL, HindⅢ 1 μL, NotI 1 μL, PET-32a carrier 20 μL, and ddH2O 18 μL.

[0080] The reaction procedure is: incubate in a 37°C water bath for 2 hours.

[0081] 6. Target gene cloning and sequencing

[0082] 6.1 Connection

[0083] The double-enzyme-digested target gene and the PET-32a vector were connected. The connection system and procedure are as follows:

[0084] The reaction system (10 μL) included: 1 μL of 10×T4 DNA ligase buffer, 0.5 μL of double-enzyme digested vector, 4 μL of double-enzyme digested target gene, 0.5 μL of T4 DNA ligase, and 4 μL of ddH2O.

[0085] The reaction procedure was: 16°C overnight ligation.

[0086] 6.2 Conversion

[0087] Pipette 5 μL of the ligated product into DH5α competent cells, place on ice for 20-30 minutes, heat shock at 42°C for 45 seconds, immediately place on ice for 2 minutes, add 1 mL of LB medium, place in a shaking incubator, and incubate at 37°C, 180 rpm for 1 hour. Take 100 μL and spread evenly on an LB plate containing 1‰ ampicillin (50 mg / mL). Place in a 37°C incubator and culture for 16-18 hours, pick a single colony and place it in a PCR tube containing 10 μL of sterile saline.

[0088] 6.3 Identification and sequencing

[0089] The single colony picked above was used as a template and the corresponding primers were used for amplification and identification.

[0090] The reaction system (20 μL) included: 2×PCR Mix 10 μL, 1 μL of 10 pmol / μL primers P1 / P2, 1 μL of bacterial solution, and 7 μL of ddH2O.

[0091] The reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 1 min, for a total of 30 cycles; and extension at 72°C for 5 min.

[0092] After the PCR reaction is completed, the product is added to 1.2% agarose gel for nucleic acid electrophoresis. The positive colonies are expanded and cultured, and the plasmids are extracted and sent to a sequencing company for sequencing.

[0093] 7. Target gene expression

[0094] The correctly sequenced plasmid was transformed into the expression host bacteria BL21 (DE3), and a single colony was picked and placed in liquid LB containing 1‰ ampicillin (50mg / mL) for shaking culture. When the OD600 value of the bacterial solution reached 0.6-0.8, ITPG (1mmol / mL) inducer was added at a dose of 1‰, and the expression was induced at 30°C and 120rpm for 5h. The expressed bacterial solution was centrifuged at 8000rpm for 5min, and the precipitate was resuspended with an appropriate amount of PBS and crushed with an ultrasonic crusher, then centrifuged at 8000rpm for 5min, and the supernatant and precipitate were subjected to SDS-PAGE electrophoresis respectively. The results showed that about half of the target protein was expressed in the supernatant, about 75kDa, and the size was correct. Figure 1 .

[0095] 8. Purification and content determination of target protein

[0096] The expressed protein supernatant was purified using a His-tag protein purification kit, and the protein content was detected.

[0097] 9. Protein agar expansion test at different concentrations

[0098] The purified target protein was diluted to 1 mg / mL, 0.75 mg / mL, 0.5 mg / mL and 0.25 mg / mL, respectively, and formaldehyde solution with a final concentration of 1‰ was added, and the mixture was inactivated for 24 hours in a shaker at 37°C and 120 rpm. FAdV-8a positive serum was determined by agar diffusion method, 25 μL / well. Results: When the target protein was 0.75 mg / mL and 0.5 mg / mL, the agar diffusion titer, precipitation line position and clarity were the best. Considering the antigen titer degradation factor, 0.75 mg / mL was selected as the agar diffusion test concentration. Figure 2 , Figure 3 , Figure 4 and Figure 5 .

[0099] 10. Specificity test

[0100] The expressed FAdV-8a agar antigen was used to measure the positive sera of common avian adenoviruses such as FAdV-1, FAdV-4, FAdV-8a, FAdV-8b and FAdV-11. The results showed that only the FAdV-8a positive serum had a precipitation line, while the other sera had no precipitation line.

[0101] 11. Preparation of FAdV-8a agar antigen

[0102] 11.1 Antigen inactivation: Add formaldehyde solution with a final concentration of 1‰ to the expressed and purified serum 8a fiber protein with a concentration of 0.75 mg / mL, and place it in a shaker at 37°C and 120 rpm for 24 hours for inactivation.

[0103] 11.2 Preparation of freeze-dried protective agent: Weigh 12.5g sucrose, 3g trehalose, and 5g skim milk powder, add purified water to make up to 100mL. After fully dissolved, press high pressure at 121℃ for 20min and set aside.

[0104] 11.3 Freeze-drying: For each bottle of freeze-dried agar-expanded antigen, mix the antigen and freeze-drying protectant in a ratio of 1.5 mL and 0.5 mL, and then freeze-dry.

[0105] 12. Determination of the shelf life of FAdV-8a agar antigen

[0106] The lyophilized antigens were stored at 4℃ and -18℃, and the antigens were taken out for agar amplification test on positive serum at the 3rd, 6th, 12th, 18th, 24th and 30th months after storage. Results: The titer of positive serum tested at the 3rd, 6th and 12th months of the antigen stored at 4℃ was the same as that before storage, and the titer was one titer lower than that before storage at the 18th month. The titer of positive serum tested at the 3rd, 6th, 12th, 18th and 24th months of the antigen stored at -18℃ was the same as that before storage, and the titer was one titer lower than that before storage at the 30th month.

[0107] Example 2 Agar amplification detection method for avian adenovirus group I type 8a

[0108] The specific steps of this embodiment are as follows:

[0109] Agarose gel with a concentration of 1% (1g agarose: 100ml PBS) was prepared with phosphate buffer (PBS) with a concentration of 0.01mol / L and a pH value of 7.4. After melting, the agarose plate was prepared by spreading the agarose gel. The thickness of the agarose gel was between 5 and 6mm. The agarose gel was punched with a seven-hole plum blossom puncher. Each bottle of freeze-dried agar antigen was diluted with 1.5mL PBS, and 25μL was added to the middle hole of the seven holes. The antibody to be tested was diluted in multiples, and 25μL was added to the surrounding 6 holes in turn. The agar plate was inverted in a warm box, and the agar antibody titer was read after reacting in a 37℃ incubator for 24 to 36 hours. When a precipitation line appeared, it was judged as antibody positive, and when no precipitation line appeared, it was judged as antibody negative.

[0110] Example 3 Application and comparison of agar amplification detection methods for avian adenovirus group I type 8a

[0111] In this embodiment, a total of 80 chicken sera from four chicken farms that were confirmed to be infected with FAdV-8a were collected from the clinic, and a total of 20 chicken sera from two healthy chicken farms were collected. The detection method in Example 2 and the classic chicken embryo neutralization test method were used for detection, and the results were: the results of the 20 sera from the healthy chicken farms were negative for both detection methods. Among the 80 sera infected with FAdV-8a, 54 were positive when detected by the detection method in Example 2, with a positive rate of 67.5%; 59 were positive when detected by the chicken embryo neutralization test, with a positive rate of 73.8%. Compared with the two methods, the chicken embryo neutralization test method has a slightly higher sensitivity, but the detection method in Example 2 is less time-consuming, lower cost, simpler to operate, and has lower instrument requirements. Therefore, it has more advantages than the classic chicken embryo neutralization test method and is particularly suitable for use in grassroots laboratories.

[0112] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A gene encoding a prokaryotically expressed avian adenovirus group 8a adenovirus antigen, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. A method for preparing a prokaryotically expressed avian adenovirus group I type 8a adenovirus antigen, characterized in that: The method comprises the following steps: (1) Optimization and synthesis of the target gene. The nucleotide sequence of the optimized target gene is shown in SEQ ID NO: 1; (2) Primer design; (3) Target gene amplification; (4) Target gene recovery and enzyme digestion; (5) Vector enzyme digestion; (6) Target gene cloning and sequencing; (7) Target gene expression; (8) Target protein purification and determination.

3. The method for preparing the prokaryotically expressed group I type 8a avian adenovirus agar antigen according to claim 2, characterized in that: In step (2), the primers include an upstream primer P1 and a downstream primer P2. The 5' end of the upstream primer P1 is added with an endonuclease HindⅢ site and a protective base, and the 5' end of the downstream primer P2 is added with an endonuclease NotI site and a protective base. The size of the amplified fragment is 1572 bp, and the nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

4. A prokaryotically expressed group I type 8a avian adenovirus adenovirus antigen prepared by the method of claim 2 or 3.

5. A prokaryotically expressed group I 8a avian adenovirus agar amplification antigen reagent, characterized in that: The agar expansion antigen reagent is prepared by the following method: (1) Antigen inactivation: mixing the agar-expanded antigen and formaldehyde solution to inactivate the antigen to obtain an inactivated antigen; (2) Preparation of lyophilized protective agent: Weigh sucrose, trehalose and skimmed milk powder, add purified water to make up to 100 ml, fully dissolve and sterilize to obtain lyophilized protective agent; (3) The inactivated antigen and the lyophilization protective agent are mixed according to a set ratio, and after lyophilization, a prokaryotic expressed group I type 8a avian adenovirus agar amplification antigen reagent is obtained.

6. The prokaryotically expressed group I 8a avian adenovirus agar antigen reagent according to claim 5, characterized in that: The specific steps of antigen inactivation are as follows: add formaldehyde solution with a final concentration of 0.8-1.2‰ to agar antigen with a concentration of 0.5-0.75 mg / mL, and place in a shaker at 35-40°C and 100-150 rpm for 18-36 hours for inactivation.

7. The prokaryotically expressed group I type 8a avian adenovirus agar antigen reagent according to claim 5, characterized in that: In step (2), the feed ratio of sucrose, trehalose and skimmed milk powder is 12.5:3:

5.

8. The prokaryotically expressed group I type 8a avian adenovirus agar antigen reagent according to claim 5, characterized in that: In step (3), the ratio of inactivated antigen to lyophilized protective agent is 1.5 ml:0.5 mL.

9. A method for detecting AGP using a prokaryotically expressed adenovirus group I type 8a adenovirus agar antigen, characterized in that: The method comprises the following steps: The group I type 8a avian adenovirus agar antigen reagent according to any one of claims 5 to 8 is fully dissolved with PBS, the dissolved antigen reagent is added to the middle well, and the test samples diluted in multiples are added to the surrounding wells in sequence, placed in a wet box, and placed in an incubator for 24 to 36 hours before observing the results.

Images