Gene clalmt12 for regulating organic acid content of phyllium fruit and application thereof

Abstract

The application belongs to the technical field of bioengineering, and discloses a gene ClALMT12 for regulating organic acid content of Huangpi fruits and application of the gene, and specifically discloses application of the ClALMT12 in regulating organic acid content of plant leaves / fruits. The ClALMT12 gene of Huangpi is screened for the first time, and it is verified through experiments that the ClALMT12 gene can significantly enhance accumulation of organic acid content in tobacco leaves and tomato fruits. The gene can be used as a target gene for in-depth research on regulation of organic acid content of Huangpi fruits and improvement of fruit flavor, and has high application and research value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a gene ClALMT12 for regulating organic acid content of fruits in Clausena lansium and application thereof. BACKGROUND

[0002] China is the country with the most genetic resources, the largest cultivation area and the highest yield of Clausena lansium (Lour.) Skeels in the world, and the cultivation area of Clausena lansium in Guangdong Province ranks first in China, with nearly 200,000 mu of Clausena lansium in Yun'an County alone. Clausena lansium is rich in nutrients, has the effects of antioxidant, anti-aging and tumor inhibition, and is a rare fruit for both medicine and food, which is deeply loved by consumers. The mature marketing period of Clausena lansium is staggered with that of the south major fruits such as lychee and longan, and Clausena lansium is a high economic value crop worthy of popular planting. However, there are few Clausena lansium cultivation varieties available for popularization, and the fruits have a single taste. The main cultivation varieties are mainly sour Clausena lansium mainly represented by 'Yunan seedless Clausena lansium' and 'Jixin Clausena lansium' and sweet Clausena lansium mainly represented by 'Congcheng sweet Clausena lansium' and 'Yunan sugar Clausena lansium'. The sour Clausena lansium tastes sour, and the sweet Clausena lansium tastes sweet and has very low acid content, resulting in serious polarization of Clausena lansium varieties in taste on the market. Fruit flavor is a key factor for the public acceptance of fruit tree varieties, and directly determines whether it can achieve commercial success. The organic acid content of Clausena lansium fruit is a key factor affecting the flavor of the fruit, therefore, it is urgent to deeply explore the regulation mechanism of the accumulation and metabolism of organic acids in Clausena lansium fruits, and to promote the creation and improvement of high-quality Clausena lansium varieties. SUMMARY

[0003] The first aspect of the present application aims to provide the application of ClALMT12.

[0004] The second aspect of the present application aims to provide the application of biological materials related to ClALMT12.

[0005] The third aspect of the present application aims to provide the application of a reagent for up-regulating the expression amount of ClALMT12.

[0006] The fourth aspect of the present application aims to provide a method.

[0007] In order to achieve the above-mentioned purposes, the technical scheme adopted by the present application is as follows:

[0008] The first aspect of the present application provides the application of ClALMT12 in any one of (1) to (5):

[0009] (1) regulating the organic acid content of plant leaves;

[0010] (2) preparing a product for regulating the organic acid content of plant leaves;

[0011] (3) modulating fruit quality of a plant;

[0012] (4) preparing a product for modulating fruit quality of a plant;

[0013] (5) breeding a genetic plant with high quality fruit;

[0014] The amino acid sequence of the ClALMT12 comprises the amino acid sequence shown in SEQ ID NO: 2.

[0015] In some embodiments of the present application, the plant comprises tobacco and / or fruits and vegetables.

[0016] In some embodiments of the present application, the fruits and vegetables comprise at least one of Chinese wax, tomato, and citrus.

[0017] In some embodiments of the present application, the modulating fruit quality of a plant comprises modulating the content of organic acid in fruit of a plant.

[0018] In a second aspect of the present application, there is provided a biological material related to ClALMT12 for use in any one of (1) to (5):

[0019] (1) modulating the content of organic acid in leaves of a plant;

[0020] (2) preparing a product for modulating the content of organic acid in leaves of a plant;

[0021] (3) modulating fruit quality of a plant;

[0022] (4) preparing a product for modulating fruit quality of a plant;

[0023] (5) breeding a genetic plant with high quality fruit;

[0024] The biological material carries ClALMT12, and the amino acid sequence of the ClALMT12 comprises the amino acid sequence shown in SEQ ID NO: 2.

[0025] In some embodiments of the present application, the biological material is any one of a1) to a12):

[0026] a1) a nucleic acid molecule encoding ClALMT12;

[0027] a2) an expression cassette comprising the nucleic acid molecule of a1);

[0028] a3) a recombinant vector comprising the nucleic acid molecule of a1);

[0029] a4) a recombinant vector comprising the expression cassette of a2);

[0030] a5) a recombinant microorganism comprising the nucleic acid molecule of a1 );

[0031] a6) a recombinant microorganism comprising the expression cassette of a2);

[0032] a7) a recombinant microorganism comprising the recombinant vector of a3);

[0033] a8) a recombinant microorganism comprising the recombinant vector of a4);

[0034] a9) a transgenic animal cell line comprising the nucleic acid molecule of a1 );

[0035] a10) a transgenic animal cell line comprising the expression cassette of a2);

[0036] a11) a transgenic animal cell line comprising the recombinant vector of a3);

[0037] a12) a transgenic animal cell line comprising the recombinant vector of a4).

[0038] In some embodiments of the application, the transgenic animal cell line does not comprise reproductive material.

[0039] In some embodiments of the application, the nucleic acid molecule comprises the sequence set forth in SEQ ID NO: 1.

[0040] In some embodiments of the application, the expression cassette comprises a 5' transcriptional control region, an open reading frame encoding the fusion protein of the first aspect of the application, a translational control signal, a 3' untranslated region (3'UTR) and a transcriptional termination signal.

[0041] In some embodiments of the application, the 5' transcriptional control region comprises a promoter (a universal promoter can be used, for example a viral promoter (SV40 promoter) or a mammalian "housekeeping" promoter), a transcription start site, an enhancer and / or a silencer element.

[0042] In some embodiments of the application, the 3'UTR can encode an AU-rich element, which is a common regulator of mRNA stability by the 3'-5' exosome pathway and is usually located in the 3'UTR. The AU-rich element can comprise one or more repeats of the sequence AUUUA. It can also comprise one or more so-called US2B elements with the sequence AUAUAU.

[0043] In some embodiments of the application, the vector comprises a promoter operably linked to the nucleic acid molecule.

[0044] In some embodiments of the application, the vector is independently selected from the group consisting of a non-pathogenic viral vector and a viral vector.

[0045] In some embodiments of the present application, the viral vector comprises at least one of lentivirus vector, adenovirus vector, baculovirus vector, retrovirus vector, poxvirus vector, sendai virus vector, herpes simplex virus vector.

[0046] In some embodiments of the present application, the non-viral vector comprises at least one of plasmid vector, cationic polymer vector, chitosan, polyethylenimine, nanoparticle vector, liposome.

[0047] In some embodiments of the present application, the vector is plasmid vector, phagemid, viral vector, cell vector, bacteriophage, cosmid, fosmid, artificial chromosome.

[0048] In some embodiments of the present application, the plasmid vector can be optional plasmid, and the viral vector can be optional virus.

[0049] In some embodiments of the present application, the recombinant expression vector uses super1300 as the original expression vector.

[0050] In some embodiments of the present application, the cell comprises prokaryotic cell, eukaryotic cell; the cell is non-plant or animal new variety.

[0051] In some embodiments of the present application, the prokaryotic cell comprises Escherichia coli, Streptomyces, Bacillus subtilis and other bacteria well known in the art which can be used to express the target protein.

[0052] In some embodiments of the present application, the eukaryotic cell comprises at least one of yeast cell, mammalian cell, plant cell and insect cell.

[0053] In some embodiments of the present application, the plant comprises tobacco and / or fruit and vegetable.

[0054] In some embodiments of the present application, the fruit and vegetable comprises at least one of yellow skin, tomato, citrus.

[0055] In some embodiments of the present application, the regulation of fruit quality of the plant comprises regulation of the content of organic acid in the fruit of the plant.

[0056] In a third aspect of the present application, the reagent for up-regulating the expression of ClALMT12 is used in the application of any one of (1) to (5):

[0057] (1) regulating the content of organic acid in the leaf of the plant;

[0058] (2) preparing a product for regulating the content of organic acid in the leaf of the plant;

[0059] (3) regulating the fruit quality of the plant;

[0060] (4) a product for regulating fruit quality of a plant;

[0061] (5) a genetic plant for cultivating high-quality fruit of a plant;

[0062] The amino acid sequence of the ClALMT12 comprises the amino acid sequence shown in SEQ ID NO: 2.

[0063] In some embodiments of the present application, the plant comprises tobacco and / or fruits and vegetables.

[0064] In some embodiments of the present application, the fruits and vegetables comprise at least one of Chinese wax, tomato, and citrus.

[0065] In some embodiments of the present application, the regulation of fruit quality of a plant comprises regulation of the content of organic acid in the fruit of a plant.

[0066] In a fourth aspect of the present application, a method for overexpressing ClALMT12 in a plant of interest is provided.

[0067] The method comprises any one of 1) to 3):

[0068] 1) a method for increasing the content of organic acid in a leaf of a plant;

[0069] 2) a method for regulating fruit quality of a plant;

[0070] 3) a method for cultivating a genetic plant for high-quality fruit of a plant;

[0071] The amino acid sequence of the ClALMT12 comprises the amino acid sequence shown in SEQ ID NO: 2.

[0072] In some embodiments of the present application, the method comprises the following steps:

[0073] (1) constructing a ClALMT12 gene overexpression vector;

[0074] (2) dipping a plant in Agrobacterium after transforming the overexpression vector into the Agrobacterium.

[0075] In some embodiments of the present application, the backbone vector of the overexpression vector is super1300.

[0076] In some embodiments of the present application, the method for constructing the overexpression vector comprises the steps of cloning the ClALMT12 gene, and connecting the recovered product with the super1300 vector, thereby constructing the overexpression vector (i.e., super1300-ClALMT12 overexpression vector).

[0077] In some embodiments of the present application, when the plant is tomato, the Agrobacterium is used to transform the overexpression vector into the tomato explant after step (2), and the tomato explant is screened to grow callus, and the callus is further cultivated to obtain a ClALMT12 stably overexpressing tomato plant (i.e., a tomato plant with a high content of organic acid in the tomato fruit).

[0078] That is, the ClALMT12 gene overexpression vector super1300-ClALMT12 is used to genetically transform the tomato explant by using the Agrobacterium-mediated method, and a ClALMT12 stably overexpressing tomato line is obtained by molecular identification.

[0079] The present application has the following beneficial effects:

[0080] The present application is based on the flavor of yellow skin fruit, and the yellow skin is divided into two subgroups of sweet yellow skin and sour yellow skin. Based on transcriptomic analysis, the gene ClALMT12 encoding the ALMT protein family is found in the significantly differentially expressed genes, and the RT-qPCR result also confirms this result. The gene is further studied in depth, the yellow skin ClALMT12 gene is cloned for the first time, the ClALMT12 is transiently overexpressed in tobacco leaves by using a tobacco transient expression system, it is verified that the gene can significantly enhance the accumulation of organic acid content, and the ClALMT12 is heterologously overexpressed in tomato by using the transgenic technology, it is further verified that the gene can significantly enhance the accumulation of organic acid content in the fruit. The present application effectively overcomes the blank of the regulation of organic acid accumulation in the yellow skin fruit in the prior art. The yellow skin ClALMT12 gene can be used as a target gene for the regulation of organic acid content and the improvement of fruit flavor of the yellow skin fruit, and has high application and research value.

[0081] In the method provided by the present application, the gene transient expression technology is simple in steps and effective in method, and can effectively shorten the time for studying the function of the gene. The gene heterologous expression can play an important role in the study of the function of the gene in the species for which the transgenic system has not been successfully established, and has important significance for revealing the function of the yellow skin gene and molecular breeding. BRIEF DESCRIPTION OF DRAWINGS

[0082] Figure 1 The discovery of ClALMT12; wherein A is the expression level of ClALMT12 in the transcriptomic analysis of sour yellow skin and sweet yellow skin, B is the expression level of ClALMT12 in the qPCR analysis of sour yellow skin and sweet yellow skin germplasm, respectively, and C is the correlation analysis of the expression level of ClALMT12 and the organic acid content of the yellow skin.

[0083] Figure 2Cloning of ClALMT12 and structure of the encoded protein; wherein A is an agarose gel electrophoresis map of PCR amplification of ClALMT12, B is a schematic diagram of the structure of ClALMT12 protein, C is a homologous comparison and domain analysis of ClALMT12 and seven ALMT protein sequences of other species.

[0084] Figure 3 ClALMT12 and the evolutionary tree analysis of seven homologous ALMT proteins in other species.

[0085] Figure 4 Construction and identification of ClALMT12 overexpression vector; wherein A is colony PCR identification after transformation of DH5α competent cells, and B is colony PCR identification after transformation of GV3101 competent cells.

[0086] Figure 5 Phenotype analysis of ClALMT12 transient overexpression tobacco leaves and ClALMT12 expression changes; wherein A is an agarose gel electrophoresis map of ClALMT12 expression detection in tobacco leaves after 3 days of transient overexpression, B is detection of changes in the content of organic acids in tobacco leaves after 3 days of injection of tobacco leaves with engineering bacteria containing empty vector (super1300) and ClALMT12 overexpression vector (super1300-ClALMT12); in the figure, ** represents p<0.01.

[0087] Figure 6 Tomato ClALMT12 overexpression stable plant acquisition process; wherein A is co-culture, B is screening and cultivation, C is differentiation and cultivation, D is rooting to form resistant seedlings, E is the result of transgenic tomato traits, F is extraction of transgenic tomato genomic DNA for marker gene HPT (hygromycin gene) PCR detection, and the detection primer is HPT-F / HPT-R, G is RT-PCR method for detecting the expression of ClALMT12 in overexpression lines, and H is detection of the content of organic acids in the fruits of ClALMT12 stable expression transgenic tomato lines. DETAILED DESCRIPTION

[0088] The content of the present application will be further described in detail through specific examples.

[0089] It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application.

[0090] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be described clearly and completely. The specific conditions not mentioned in the embodiments are carried out according to conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be purchased in the market.

[0091] In the following examples of the present application, the materials involved include:

[0092] Tobacco is Nicotiana benthamiana, and tomato material is Micro-TOM;

[0093] The primers and sequencing used in the test were completed by Shenguo Bioengineering (Shanghai) Co., Ltd.;

[0094] HindIII and KpnI were purchased from Thermo Fisher Scientific Company;

[0095] High-fidelity enzyme, IIOne Step Cloning Kit, RNA extraction kit, reverse transcription kit, and DNA purification kit were purchased from Nanjing Novozyme Bio-tech Co., Ltd.;

[0096] E. coli competent cells DH5α and Agrobacterium competent GV3101 were purchased from Shanghai Weidi Biological Technology Co., Ltd.;

[0097] The remaining molecular reagents were mainly purchased from Nanjing Novozyme Bio-tech Co., Ltd. and Shenguo Bioengineering (Shanghai) Co., Ltd.

[0098] The determination method of the organic acid content in the examples is as follows:

[0099] An appropriate amount of fruit and vegetable sample was weighed in a mortar, a small amount of boiled and cooled single distilled water was added, and the sample was ground into a homogenate, and the mortar was washed with a small amount of water several times, and then transferred into a test tube and diluted to the corresponding scale, shaken well, and then placed for 30 min (shake well several times during the period); centrifuged at 12000 rpm for 15 min, and the supernatant was collected. The automatic calibration instrument was used for determination, the corresponding filtrate was transferred into a 50 ml beaker of boiled and cooled single distilled water, and the calibrated NaOH solution was used for titration. The amount of NaOH titration solution was recorded, and the operation was repeated three times. Distilled water was used instead of the filtrate as a blank control.

[0100] Pre-culture medium: MS+1 mg / L IAA+1.75 mg / L ZT;

[0101] Co-culture medium: MS+1 mg / L IAA+1.75 mg / L ZT;

[0102] Screening medium: MS+1 mg / L IAA+1.75 mg / L ZT+10 mg / L hyg+500 mg / L Cb;

[0103] Differentiation medium: MS+1 mg / L IAA+1.75 mg / L ZT+5 mg / L hyg+500 mg / L Cb;

[0104] Rooting medium: MS + 5 mg / L hyg + 250 mg / L Cb;

[0105] MS was purchased from BioRun, catalog number RFA01; IAA was purchased from Sangon Biotech, catalog number A600723-0025; ZT was purchased from Sangon Biotech, catalog number A411990-0025; Cb was purchased from BioRun, catalog number RJD00; and hygromycin B was purchased from BioRun, catalog number RJA00-1g.

[0106] The germplasm resource information of wampee involved in the embodiments is shown in Table 1, and all of them are from the wampee germplasm resource nursery of the Ministry of Agriculture and Rural Affairs.

[0107] Table 1. Germplasm Resource Information for Huangpi (Huangpi)

[0108]

[0109]

[0110] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0111] Example 1: Discovery of the ClALMT12 gene

[0112] The flavor of fruit is a scientific issue of common concern to all fruit tree breeders, and wampee is no exception. Wampee varieties can be clearly divided into two subgroups based on taste: sweet wampee and sour wampee. Sweet wampee has a refreshing sweet taste with no sourness. Sour wampee, on the other hand, has a mixed sweet and sour taste with a distinct sourness, and this difference in taste is evident even from the young fruit. To investigate the genetic basis of wampee fruit taste, this study performed transcriptome sequencing on the fruits of sweet and sour wampee (germplasm resource information for wampee is shown in Table 1) and differential expression analysis. A gene annotated as encoding a malic acid transporter showed significant differences and was named ClALMT12.

[0113] Furthermore, the inventors selected five sweet and five sour yellow-skinned varieties (germplasm resource information for yellow-skinned varieties is shown in Table 1) and analyzed the expression level of ClALMT12 using qPCR. The results showed that the expression level of ClALMT12 in the sour yellow-skinned varieties was significantly higher than that in the sweet yellow-skinned varieties, and correlation analysis showed that the expression level of ClALMT12 was significantly positively correlated with the organic acid content of the fruit. Figure 1 (B and C). The above results suggest that ClALMT12 can regulate the accumulation of organic acids in fruit. Since molecular biology research on wampee is still in its early stages, transient transformation systems and stable transgenic systems are currently lacking. To verify the function of ClALMT12 in regulating the accumulation of organic acids in wampee, this invention uses heterologous overexpression.

[0114] Cloning and bioinformatics analysis of CDS region of ClALMT12 gene in Example 2

[0115] According to the reference genome “JingFeng” assembled by the research group (Chen et al. 2024. Identification of Key Genes Controlling Sugar and Organic Acid Accumulation in Wampee Fruit (Clausena lansium) via Genome Assembly and Genome-wide Association Analysis), the ClALMT12 sequence was extracted, and the primers ClALMT12-F / ClALMT12-R (Table 1) were designed using Premier 5.0. The total RNA of the wampee leaves was extracted using the RNA extraction kit (FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics-rich), Norgen, China), and the cDNA was reversely converted using the HiScript IV 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Norgen, China) kit.

[0116] The CDS cloning was performed using the cDNA as the template and the ClALMT12-F / ClALMT12-R as the primers. The PCR product was subjected to 1.5% agarose gel electrophoresis, and the results were detected and recorded using the gel imaging system (Bio-Rad). Figure 2 The PCR product was recovered and ligated with BlunT3, and the DH5a competent cells were transformed. The single colonies were selected for colony PCR, and the positive bacteria were sent to Shengong Bioengineering (Guangzhou) Co., Ltd. for sequencing. The CDS sequence of ClALMT12 was obtained, the sequence size was 1845 bp, and the CDS sequence of ClALMT12 gene was determined. The nucleotide sequence is shown as SEQ ID NO: 1.

[0117]

[0118] Table 2 Clones used in the experiment, identification and real-time fluorescence quantitative (RT-qPCR) primers

[0119]

[0120] ClALMT12 conservative domain and protein physicochemical properties were analyzed by ExPaSy: ClALMT12 gene encodes 541 amino acids (the amino acid sequence of ClALMT12 is shown as SEQ ID NO: 2), the theoretical molecular weight is 60.29 kD, the theoretical isoelectric point is 8.39, the protein contains 58 negative electric residues (Asp+Glu) and 62 positive electric residues (Arg+Lys), the instability coefficient is 34.33, the aliphatic index is 99.89, the average hydrophilicity is 0.024, indicating that ClALMT12 is a hydrophilic stable protein. According to the protein structure prediction of SMART (http: / / smart.embl.de / smart / set_mode.cgi?NORMAL=1) website, it is shown that ClALMT12 contains one same PFAM domain named "ALMT", which is located at the 48th-504th amino acid sequence (protein structure schematic diagram is shown as Figure 2 Fig. 2B).

[0121] The amino acid sequence of ClALMT12: MASKVHVGIEMAMSGDHAVSSS S SKEKLTKHMNVIGEKARRFPNLLWKVGREDPRRVIHALKVGLSLTLVSLLYLMGPLFKGIGENAIWAVMTVVVVLEFTAGATLCKGLNRGLGTLLAGSLAFLFEYIANESGHIFRAVFIGAAVFLVGAAATYMRFIPYIKKNYDYGVVIFLLTFNLITVSSYRVENVLRIAHDRFYTIAIGCGICLFMSLMIFPNWSGEDLHNSTVAKFEGLAKSIEACVNEYFNDHAEEVKINLMDKPSDDEDPIYKGYKAVLDSKSIDETLALYASWEPRHSRHCYRFPWQQYVKLGAVLRQFGYTVVALHGCLLTEIQTPRSVRALFKDPCIRLANEVSKALMELANSIKSRRHCSPEVLSDHLHEALQDLNRAIKSQPRLFLGSNSSQASNLLALAAAHARQQKEHGVSLSSFKTDTSALLEWKSKRISSERSKEAERKVLRPQLSKIAITSLEFSEALPFAAFASLLVEIVARLDNVIEEVEELGRIACFKEFNPGDDQIIVTCDKTPVDVTQNHLPSHPAD* (SEQ ID NO: 2).

[0122] To further study the relationship of ClALMT12 with other species in the evolutionary process, eight ALMT family genes of sweet orange (Citrus sinensis, KAH9769659.1), jujube (Ziziphus jujuba, XP_015880299.3), European wild apple (Malus sylvestris, XP_050131980.1), American black poplar (Populus trichocarpa, PNT54488.1), upland cotton (Gossypium hirsutum, XP_040963263.1), cocoa tree (Theobroma cacao, XP_007039541.1), Arabidopsis thaliana (NP_193531.1) were analyzed by phylogenetic analysis, and the results showed that ClALMT12 protein was in the same branch with sweet orange CitALMT12 (KAH9769659.1) protein, with the closest relationship Figure 3 ).

[0123] Example 3: Construction and Phenotypic Analysis of ClALMT12 Overexpression Vector

[0124] 1. Construction of ClALMT12 overexpression vector

[0125] Based on the ClALMT12 coding sequence, a forward primer ClALMT12-F1 containing a homologous arm with a Hind III restriction site (CCAAATCGACTCTAGAAAGCTT, SEQ ID NO:13) and a reverse primer ClALMT12-R1 containing a homologous arm with a Kpn I restriction site (CCTCGCCCTTGCTCACCATGGTACC, SEQ ID NO:14) were designed (primer sequences are shown in Table 2). cDNA was used as a template for amplification, followed by gel electrophoresis and recovery. The recovered product and the overexpression vector super1300 were digested with restriction endonucleases Hind III and Kpn I (Thermo Fisher Scientific), respectively, and then recovered. Subsequently, DH5α competent cells were transformed, and single colonies were picked for colony PCR using the universal vector primers Super1300-F / Super1300-R (primer sequences are shown in Table 2). Figure 4 As shown in Figure A), the positive colonies were shaken and sent to the company for sequencing. After the sequencing was confirmed to be correct, the plasmid was extracted to obtain the overexpression vector super1300-ClALMT12.

[0126] 2. Molecular identification and phenotypic analysis of ClALMT12 transient overexpression

[0127] Plasmids containing the ClALMT12 overexpression vector (super1300-ClALMT12) and the empty vector (super1300) were transformed into Agrobacterium GV3101, and colony PCR was performed for identification. Figure 4 In step B), positive single clones were selected to prepare engineered bacteria. The engineered bacteria containing the ClALMT12 overexpression vector (super1300-ClALMT12) and the empty vector (super1300) were injected into leaves of Nicotiana benthamiana that had been growing for 4-6 weeks. RT-PCR primers qClALMT12-F / qClALMT12-R were designed (primer sequences are shown in Table 2). The expression of ClALMT12 was detected 3 days later.

[0128] The results showed that ClALMT12 expression was detected in all tobacco leaves injected with the overexpression vector super1300-ClALMT12. Figure 5Figure 2A). Then the organic acid content of tobacco leaves injected with empty vector (super1300) and overexpression vector (super1300-CI ALMT12) was detected respectively. The organic acid content of tobacco leaves injected with overexpression vector (super1300-CI ALMT12) was significantly higher than that of tobacco leaves injected with empty vector Figure 5 Figure 2B).

[0129] 3. Molecular identification and phenotype analysis after heterologous overexpression of CI ALMT12

[0130] The sterile seedlings of tomato (Micro-TOM) were germinated, and the cotyledon petioles and cotyledon tips were removed with a scalpel when the cotyledons were fully unfolded. The middle part was cut into 2-3 segments and inoculated in pre-culture medium at 23±2°C for 2-3 days of pre-culture. The identified positive Agrobacterium (obtained from 2. Molecular identification and phenotype analysis after transient overexpression of CI ALMT12) was prepared in a bacterial resuspension solution with OD 600 =0.1; the dried explants were inoculated in co-culture medium at 23±2°C for 2 days of dark culture Figure 6 Figure 2A). The recovered callus was inoculated in selection medium at 23°C for 15-30 days of 16h / 8h light / dark culture Figure 6 Figure 2B); the selected callus was inoculated in differentiation medium at 23°C for 30-40 days of 16h / 8h light / dark culture Figure 6 Figure 2C). When the differentiated seedlings grew to about 2-3 cm, they were cut from the callus and inoculated in rooting medium at 23°C for 10-15 days of 16h / 8h light / dark culture to obtain resistant regenerated plants Figure 6 Figure 2D). The genomic DNA of tomato was extracted, and PCR detection of the marker gene HPT (hygromycin gene) was performed using primers HPT-F / HPT-R (see Table 2 for primer sequences). The PCR detection results of the marker gene HPT are shown in Figure 6 Figure 2F.

[0131] The mature fruits of the obtained positive plants and untransformed wild-type tomato plants were extracted for RNA, which was reverse transcribed into cDNA. qCI ALMT12-F / qCI ALMT12-R was used for amplification, and wild type was used as a control. Agarose gel electrophoresis detection of the expression of CI ALMT12 in regenerated plants was performed. Plants that could amplify the target fragment band were CI ALMT12 heterologous overexpression stable plants Figure 6 Figure 2E).

[0132] The results are shown in Figure 6As shown in G-H, the organic acid content of the fruits of the wild type and the two overexpression tomato lines is detected respectively, and the results show that the organic acid content of the fruits of the overexpression lines is significantly higher than that of the wild type, which proves that the fruit organic acid content improvement method based on the ClALMT12 gene can significantly improve the fruit organic acid content, and has high application and research value.

[0133] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. overexpression ClALMT12 The use according to any one of (1) to (5): (1) increasing the content of organic acid in tobacco leaves; (2) preparing a product for increasing the content of organic acid in tobacco leaves; (3) increasing the quality of Citrus grandis or tomato fruits; (4) preparing a product for increasing the quality of Citrus grandis or tomato fruits; (5) cultivating a genetically modified Citrus grandis or tomato with high quality fruits; the amino acid sequence of SEQ ID NO: 2; and ClALMT12 the amino acid sequence of SEQ ID NO: 2; and The quality of Citrus grandis or tomato fruits in (3)-(4) is increased in the content of organic acid in the fruits; The high quality fruits of Citrus grandis or tomato in (5) are high in the content of organic acid.

2. Use of the biological material of any one of (1) to (5) in the production of a medicament for the treatment of a disease associated with overexpression of the biological material. ClALMT12 3. Use of the biological material of any one of (1) to (5) in the production of a (1) increasing the content of organic acid in tobacco leaves; (2) preparing a product for increasing the content of organic acid in tobacco leaves; (3) increasing the quality of Citrus grandis or tomato fruits; (4) preparing a product for increasing the quality of Citrus grandis or tomato fruits; (5) cultivating a genetically modified Citrus grandis or tomato with high quality fruits; The biomaterial carries ClALMT12 The ClALMT12 The amino acid sequence is the amino acid sequence shown in SEQ ID NO:2; The quality of Citrus grandis or tomato fruits in (3)-(4) is increased in the content of organic acid in the fruits; The high quality fruits of Citrus grandis or tomato in (5) are high in the content of organic acid.

3. Use according to claim 2, characterized in that, The biological material is any one of a1)-a5): a1 ) a nucleic acid molecule encoding ClALMT12 a1 ) a nucleic acid molecule encoding a2) an expression cassette containing the nucleic acid molecule of a1); a3) a recombinant vector containing the nucleic acid molecule of a1); a4) a recombinant microorganism containing the nucleic acid molecule of a1); a5) a transgenic animal cell line containing the nucleic acid molecule of a1).

4. Use according to claim 3, characterized in that, The biological material is any one of a6)-a8): a6) a recombinant vector containing the expression cassette of a2); a7) a recombinant microorganism containing the expression cassette of a2); a8) a transgenic animal cell line containing the expression cassette of a2).

5. Use according to claim 3, characterized in that, The biological material is a9) or a10): a9) a recombinant microorganism containing the recombinant vector of a3); a10) a transgenic animal cell line containing the recombinant vector of a3).

6. The use according to any one of claims 3 to 5, characterized in that, The nucleic acid molecule is the sequence shown in SEQ ID NO:

1.

7. A method of overexpressing in a plant of interest ClALMT12 ; The method is any one of 1)-3): 1) a method for increasing the content of organic acid in tobacco leaves; 2) a method for increasing the quality of Citrus grandis or tomato fruits; 3) a method for cultivating a genetically modified Citrus grandis or tomato with high quality fruits; the amino acid sequence of SEQ ID NO: 2; and ClALMT12 the amino acid sequence of SEQ ID NO: 2; and The quality of Citrus grandis or tomato fruits in (3)-(4) is increased in the content of organic acid in the fruits; The high quality fruits of Citrus grandis or tomato in (5) are high in the content of organic acid.

8. The method of claim 7, wherein, The method comprises the following steps: (1) Construction ClALMT12 Gene overexpression vectors; (2) dipping tobacco, Citrus grandis or tomato into Agrobacterium after the overexpression vector is transformed into Agrobacterium.

9. The method of claim 8, wherein, The backbone vector of the overexpression vector is super1300.

10. detecting ClALMT12 application of the reagent in distinguishing between sweet and sour varieties of ClALMT12 nucleotide sequence SEQ ID NO:

1.

11. Use according to claim 10, characterized in that, The reagents include primers sequences that detect ClALMT12 the presence of the target nucleic acid.

12. Use according to claim 11, characterized in that, The primer sequence is shown in SEQ ID NO: 3-SEQ ID NO: 4.

Images