Gene clphl6 for regulating sugar content of clausena lansium fruit and application thereof
By cloning and overexpressing the ClPHL6 gene of Huangpi fruit, the research gap in sugar content regulation of Huangpi fruit was filled, significantly increasing the soluble sugar content of the fruit and improving the fruit flavor. This provided an important gene for the improvement of Huangpi varieties and shortened the research time.
Patent Information
- Application Number
- CN202411816935.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-10
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-12-10
AI Technical Summary
The lack of existing research on the regulation of sugar content in wampee fruit has led to a lack of variety in fruit flavor, resulting in a severe polarization in the taste of varieties on the market and affecting the commercial success of fruit tree varieties.
The ClPHL6 gene of yellow-skinned tomatoes was cloned, and its function in regulating the soluble sugar content of fruits was verified by transient expression in tobacco and heterologous overexpression in tomatoes. A ClPHL6 overexpression vector was constructed, and genetic transformation was carried out using Agrobacterium-mediated transformation to obtain stable overexpressing plants.
It significantly increased the soluble sugar content in the fruit, improved the fruit flavor, provided a research basis for the regulation of sugar accumulation in yellow-skinned fruit, provided target genes for variety improvement, and shortened the research time.
Smart Images

Figure BDA0005182070800000081 
Figure BDA0005182070800000091 
Figure BDA0005182070800000111
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of bioengineering, and particularly relates to a gene ClPHL6 for regulating sugar content of Clausena lansium fruits and application thereof. BACKGROUND
[0002] China is the country with the most genetic resources, the largest cultivation area and the highest yield of Clausena lansium (Lour.) Skeels in the world, and the cultivation area of C. lansium in Guangdong Province ranks first in China, with nearly 200,000 mu of C. lansium in Yun'an County alone. C. lansium fruits are rich in nutrients and have the effects of antioxidant, anti-aging and tumor inhibition, and are one of the few fruits that can be used as both medicine and food, which are deeply loved by consumers. The mature market period of C. lansium is staggered with that of the southern major fruits litchi and longan, and C. lansium is a high economic value crop worthy of popular planting. However, there are few C. lansium cultivars available for popularization, and the fruits have a single taste. The main cultivars are mainly sour C. lansium with 'Yunan seedless C. lansium' and 'Jixin C. lansium' as the main cultivars, and sweet C. lansium with 'Congcheng sweet C. lansium' and 'Yunan sugar C. lansium' as the main cultivars. The sour C. lansium tastes sour, while the sweet C. lansium tastes sweet and has very low acid content, resulting in a serious polarization of taste of C. lansium varieties on the market. Fruit flavor is a key factor in determining the public acceptance of fruit tree varieties, and directly determines whether it can achieve commercial success. The sugar content of C. lansium fruits is a key factor affecting fruit flavor. Therefore, it is urgent to deeply explore the regulation mechanism of sugar accumulation and metabolism in C. lansium fruits and promote the creation and improvement of high-quality C. lansium varieties.
[0003] Transcription factors affect fruit quality through various mechanisms, including developmental regulation, flavor and aroma formation, pigment synthesis, ripening process regulation and interaction with hormone signals. In apple, researchers found that MdMYB305 can promote sugar accumulation in red-fleshed apple offspring. MdMYB305 binds to sugar-related genes (MdCWI1 / MdVGT3 / MdTMT2) to promote or inhibit their activity, ultimately regulating sugar accumulation in fruits. In addition, the study also found that MdMYB305 and MdMYB10 balance the sugar content in fruits by competing for the binding site of MdbHLH33. In melon, transcriptional repressor CmMYB44 regulates sucrose accumulation in oriental melon fruits. CMMYB44 affects sucrose accumulation by inhibiting the transcriptional activation of sucrose phosphate synthase gene (CMSPS1). MDWRKY126 is a transcription factor that can up-regulate the activity of sucrose synthesis-related genes (SPS) and reduce the expression of sucrose decomposition-related genes.
[0004] In summary, the transcription factor family plays an important role in regulating fruit quality. In-depth study of the function and mechanism of transcription factors is of great significance for improving fruit quality. SUMMARY
[0005] The first aspect of the present application aims to provide an application of ClPHL6.
[0006] The second aspect of the present application aims to provide an application of a biological material related to ClPHL6.
[0007] The third aspect of the present application aims to provide an application of a reagent for up-regulating the expression amount of ClPHL6.
[0008] The fourth aspect of the present application aims to provide a method.
[0009] To achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows:
[0010] The first aspect of the present application provides an application of ClPHL6 in any one of (1) to (5):
[0011] (1) regulating the soluble sugar content of plant leaves;
[0012] (2) preparing a product for regulating the soluble sugar content of plant leaves;
[0013] (3) regulating the quality of plant fruits;
[0014] (4) preparing a product for regulating the quality of plant fruits;
[0015] (5) cultivating a gene plant with high-quality plant fruits.
[0016] The amino acid sequence of the ClPHL6 comprises the amino acid sequence shown in SEQ ID NO: 2.
[0017] In some embodiments of the present application, the plant comprises tobacco and / or fruits and vegetables.
[0018] In some embodiments of the present application, the fruits and vegetables comprise at least one of yellow skin, tomato, and citrus.
[0019] In some embodiments of the present application, the regulation of the quality of plant fruits comprises regulating the content of soluble sugar in plant fruits.
[0020] The second aspect of the present application provides an application of a biological material related to ClPHL6 in any one of (1) to (5):
[0021] (1) regulating the soluble sugar content of plant leaves;
[0022] (2) preparing a product for regulating the soluble sugar content of plant leaves;
[0023] (3) regulating the quality of plant fruits;
[0024] (4) a product for regulating fruit quality of a plant;
[0025] (5) a genetically modified plant with high quality fruit;
[0026] The biological material carries ClPHL6, and the amino acid sequence of the ClPHL6 comprises the amino acid sequence shown in SEQ ID NO: 2.
[0027] In some embodiments of the present application, the biological material is any one of a1) to a12):
[0028] a1) a nucleic acid molecule encoding ClPHL6;
[0029] a2) an expression cassette containing the nucleic acid molecule of a1);
[0030] a3) a recombinant vector containing the nucleic acid molecule of a1);
[0031] a4) a recombinant vector containing the expression cassette of a2);
[0032] a5) a recombinant microorganism containing the nucleic acid molecule of a1);
[0033] a6) a recombinant microorganism containing the expression cassette of a2);
[0034] a7) a recombinant microorganism containing the recombinant vector of a3);
[0035] a8) a recombinant microorganism containing the recombinant vector of a4);
[0036] a9) a transgenic animal cell line containing the nucleic acid molecule of a1);
[0037] a10) a transgenic animal cell line containing the expression cassette of a2);
[0038] a11) a transgenic animal cell line containing the recombinant vector of a3);
[0039] a12) a transgenic animal cell line containing the recombinant vector of a4).
[0040] In some embodiments of the present application, the transgenic animal cell line does not contain reproductive material.
[0041] In some embodiments of the present application, the nucleic acid molecule comprises the sequence shown in SEQ ID NO: 1.
[0042] In some embodiments of the present application, the expression cassette comprises a 5' transcription control region, an open reading frame encoding the fusion protein of the first aspect of the present application, a translation control signal, a 3' untranslated region (3' UTR), and a transcription termination signal.
[0043] In some embodiments of the application, the 5' transcriptional control region comprises a promoter (a universal promoter can be used, such as a viral promoter (SV40 promoter) or a mammalian "housekeeping" promoter), a transcription initiation site, an enhancer and / or a silencer element.
[0044] In some embodiments of the application, the 3'UTR can encode an AU-rich element, which is a common regulator of mRNA stability by the 3'-5' exosome pathway and is usually located in the 3'UTR. The AU-rich element can comprise one or more repeats of the sequence AUUUA. It can also comprise one or more so-called US2B elements with the sequence AUAUAU.
[0045] In some embodiments of the application, the vector comprises a promoter operably linked to the nucleic acid molecule.
[0046] In some embodiments of the application, the vector is independently selected from the group consisting of a non-pathogenic viral vector and a viral vector.
[0047] In some embodiments of the application, the viral vector comprises at least one of a lentivirus vector, an adenovirus vector, a baculovirus vector, a retrovirus vector, a poxvirus vector, a Sendai virus vector, a herpes simplex virus vector.
[0048] In some embodiments of the application, the non-viral vector comprises at least one of a plasmid vector, a cationic polymer vector, chitosan, polyethylenimine, a nanoparticle vector, a liposome.
[0049] In some embodiments of the application, the vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a bacteriophage, a cosmid, a fosmid, an artificial chromosome.
[0050] In some embodiments of the application, the plasmid vector can be an optional plasmid, and the viral vector can be an optional virus.
[0051] In some embodiments of the application, the recombinant expression vector uses super1300 as the original expression vector.
[0052] In some embodiments of the application, the cell comprises a prokaryotic cell, a eukaryotic cell; the cell is not a new plant or animal variety.
[0053] In some embodiments of the application, the prokaryotic cell comprises Escherichia coli, Streptomyces, Bacillus subtilis and other bacteria well known in the art that can be used to express the target protein.
[0054] In some embodiments of the present application, the eukaryotic cell comprises at least one of a yeast cell, a mammalian cell, a plant cell, and an insect cell.
[0055] In some embodiments of the present application, the plant comprises at least one of tobacco and / or a fruit or vegetable.
[0056] In some embodiments of the present application, the fruit or vegetable comprises at least one of a persimmon, a tomato, and a citrus.
[0057] In some embodiments of the present application, the regulating fruit quality of the plant comprises regulating the content of soluble sugar in the fruit of the plant.
[0058] In a third aspect of the present application, a reagent for up-regulating the expression of ClPHL6 is provided for use in any one of (1) to (5):
[0059] (1) regulating the content of soluble sugar in a leaf of a plant;
[0060] (2) preparing a product for regulating the content of soluble sugar in a leaf of a plant;
[0061] (3) regulating fruit quality of a plant;
[0062] (4) preparing a product for regulating fruit quality of a plant;
[0063] (5) cultivating a genetically modified plant with high-quality fruit;
[0064] The amino acid sequence of the ClPHL6 comprises the amino acid sequence set forth in SEQ ID NO: 2.
[0065] In some embodiments of the present application, the plant comprises at least one of tobacco and / or a fruit or vegetable.
[0066] In some embodiments of the present application, the fruit or vegetable comprises at least one of a persimmon, a tomato, and a citrus.
[0067] In some embodiments of the present application, the regulating fruit quality of the plant comprises regulating the content of soluble sugar in the fruit of the plant.
[0068] In a fourth aspect of the present application, a method for overexpressing ClPHL6 in a plant of interest is provided.
[0069] The method comprises any one of 1) to 3):
[0070] 1) a method for increasing the content of soluble sugar in a leaf of a plant;
[0071] 2) a method for increasing fruit quality of a plant;
[0072] 3) a method for cultivating a genetically modified plant with high-quality fruit.
[0073] The amino acid sequence of the ClPHL6 comprises the amino acid sequence shown in SEQ ID NO: 2.
[0074] In some embodiments of the present application, the method comprises the following steps:
[0075] (1) constructing a ClPHL6 gene overexpression vector;
[0076] (2) transforming the overexpression vector into Agrobacterium and then dipping plants.
[0077] In some embodiments of the present application, the backbone vector of the overexpression vector is super1300.
[0078] In some embodiments of the present application, the method for constructing the overexpression vector comprises the following steps: cloning the ClPHL6 gene, connecting the recovered product with the super1300 vector, and constructing the overexpression vector (i.e. super1300-ClPHL6 overexpression vector).
[0079] In some embodiments of the present application, when the plant is tomato, the overexpression vector is transformed into Agrobacterium and then dipped into tomato explants in step (2), and the tomato explants after dipping are screened to grow callus, and the ClPHL6 stably overexpressed tomato plant (i.e. tomato plant with higher soluble sugar content in tomato fruit) is obtained through further cultivation.
[0080] That is, the ClPHL6 gene overexpression vector super1300-ClPHL6 is used for genetic transformation of tomato explants by Agrobacterium-mediated method, and the ClPHL6 stably overexpressed tomato strain is obtained through molecular identification.
[0081] The present application has the following beneficial effects:
[0082] The application is based on the fruit flavor of Clausena lansium, and Clausena lansium is divided into two subgroups of sweet Clausena lansium and sour Clausena lansium, based on population selection analysis and transcriptome analysis, the gene ClPHL6 encoding ALMT protein family is found in the significantly differentially expressed genes, and the RT-qPCR result also proves the result, and the gene is further studied, the ClPHL6 gene of Clausena lansium is cloned for the first time, the ClPHL6 is overexpressed in tobacco leaves through a tobacco transient expression system, it is verified that the gene can significantly enhance the soluble sugar content of tobacco leaves, and the ClPHL6 is heterologously overexpressed in tomatoes through transgenic technology, and it is further verified that the ClPHL6 gene can accumulate the function of soluble sugar content. The scheme of the application effectively overcomes the blank of the prior art in the regulation research of sugar accumulation of Clausena lansium fruit, and the ClPHL6 gene of Clausena lansium can be used as a target gene for the regulation of soluble sugar content of Clausena lansium fruit and the improvement of fruit flavor, and has high application and research value.
[0083] In the method provided by the application, the gene transient expression technology applied is simple in steps and effective in method, can effectively shorten the time for researching the function of the gene, and the gene heterologous expression can play an important role in the research of the function of the gene in a species which is not easy to realize transgenic, and has important significance for revealing the function of the Clausena lansium gene and molecular breeding. BRIEF DESCRIPTION OF DRAWINGS
[0084] Figure 1 It is the discovery of ClPHL6, wherein A is that candidate divergence regions (CDRs) are detected based on high genetic differentiation (the first 5% of Fst) in sweet Clausena lansium and sour Clausena lansium germplasm in the whole genome, B is that the expression levels of ClPHL6 of sour Clausena lansium and sweet Clausena lansium are analyzed by transcriptome, C is that the expression levels of ClPHL6 in sour Clausena lansium and sweet Clausena lansium germplasm are analyzed by qPCR, and D is the correlation analysis of the expression level of ClPHL6 and the sugar content of Clausena lansium fruit, wherein ** represents p<0.01, and *** represents p<0.001.
[0085] Figure 2 It is the cloning of ClPHL6 and the structure of the protein coded by ClPHL6, wherein A is an agarose gel electrophoresis map of PCR amplification of ClPHL6, B is a schematic diagram of the structure of ClPHL6 protein, and C is the homologous comparison and domain analysis of ClPHL6 and 8 MYB protein sequences of other species.
[0086] Figure 3 It is the construction and identification of the overexpression vector of ClPHL6, wherein A is the colony PCR identification after transformation of the competent cells of DH5 alpha, and B is the colony PCR identification after transformation of the competent cells of GV3101.
[0087] Figure 4ClPHL6 transient overexpression tobacco leaf phenotype analysis and ClPHL6 expression quantity change; wherein, A is ClPHL6 transient overexpression 3d after tobacco leaf ClPHL6 expression quantity detection agarose gel electrophoresis chart; B is injection containing empty vector (super1300) and ClPHL6 overexpression vector (super1300-ClPHL6) engineering bacteria tobacco leaf 3d after, detect its leaf soluble sugar content change; in the figure, ** represents p<0.01.
[0088] Figure 5 Tomato ClPHL6 overexpression stable plant acquisition process; wherein, A is co-cultivation; B is screening cultivation; C is differentiation cultivation; D is rooting formation of resistant seedling; E is transgenic tomato result character; F is transgenic tomato genomic DNA extraction, marker gene HPT (hygromycin gene) PCR detection, detection primer is HPT-F / HPT-R; G is RT-PCR method detects the expression of ClPHL6 in overexpression strain; H is the soluble total sugar content detection of ClPHL6 stable expression transgenic tomato fruit. DETAILED DESCRIPTION
[0089] The content of the present application will be further described in detail by specific examples.
[0090] It should be understood that these examples are only used to illustrate the present application and are not used to limit the scope of the present application.
[0091] In order to make the purpose, technical scheme and advantages of the embodiments of the present application more clear, the technical scheme in the embodiments of the present application will be described clearly and completely. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used are not marked with the manufacturer, which are all conventional products that can be purchased in the market.
[0092] In the following embodiments of the present application, the materials involved include:
[0093] Tobacco is Nicotiana benthamiana, and tomato material is Micro-TOM;
[0094] The primers and sequencing used in the test are completed by Sheng Wu Bioengineering (Shanghai) Co., Ltd.;
[0095] HindIII, KpnI are purchased from Thermo Fisher Scientific company;
[0096] High-fidelity enzyme, IIOne Step Cloning Kit, RNA extraction kit, reverse transcription kit, DNA purification kit were purchased from Nanjing Nvige Biotech Co., Ltd.
[0097] E. coli competent cells DH5a, Agrobacterium competent GV3101 were purchased from Shanghai Weidi Biological Technology Co., Ltd.
[0098] The remaining molecular reagents were mainly purchased from Nanjing Nvige Biotech Co., Ltd. and Shengao Bioengineering (Shanghai) Co., Ltd.
[0099] The soluble total sugar content determination method in the examples is as follows: weigh an appropriate amount of fruit and vegetable sample in a mortar and grind into homogenate, rinse the mortar with a small amount of dd H2O several times, transfer into a test tube, and dilute to the corresponding scale, shake well. Seal with plastic wrap, poke holes, and boil in a water bath for 40 min (shake well several times during the period); centrifuge at 12000 rpm for 15 min, collect the supernatant. Add 1.5 mL ddH2O-5 mL concentrated sulfuric acid-(cooling)-0.5 mL anthrone ethyl acetate-0.5 mL extract solution in turn, shake well and place in a boiling water bath for 1 min. After cooling to room temperature, measure the absorbance at a wavelength of 630 nm, repeat three times. Prepare a standard curve in the same way; according to the absorbance value of the solution, find the corresponding sucrose mass in the standard curve, and calculate the soluble sugar content in the tissue.
[0100] Pre-culture medium: MS + 1 mg / L IAA + 1.75 mg / L ZT;
[0101] Co-culture medium: MS + 1 mg / L IAA + 1.75 mg / L ZT;
[0102] Screening medium: MS + 1 mg / L IAA + 1.75 mg / L ZT + 10 mg / L hyg + 500 mg / L Cb;
[0103] Differentiation medium: MS + 1 mg / L IAA + 1.75 mg / L ZT + 5 mg / L hyg + 500 mg / L Cb;
[0104] Rooting medium: MS + 5 mg / L hyg + 250 mg / L Cb;
[0105] Among them, MS was purchased from BioRun, with the product number RFA01; IAA was purchased from Shengao Bioengineering, with the product number A600723-0025; ZT was purchased from Shengao Bioengineering, with the product number A411990-0025; Cb was purchased from BioRun, with the product number RJD00; Hygromycin B was purchased from BioRun, with the product number RJA00-1g.
[0106] The information of the yellow skin germplasm resources involved in the embodiments is shown in Table 1, and all are from the Ministry of Agriculture and Rural Affairs of the People's Republic of China yellow skin germplasm resource garden.
[0107] Table 1 Information of yellow skin germplasm resources
[0108]
[0109]
[0110] The features and performances of the present application are further described in detail in combination with the embodiments.
[0111] Example 1 Discovery of ClPHL6 gene
[0112] The flavor of fruit trees is a scientific problem that all fruit tree breeders are concerned about, and yellow skin is no exception. Yellow skin varieties can be clearly divided into sweet and sour subgroups in terms of taste. Sweet yellow skin tastes sweet and has no sour taste. Sour yellow skin tastes sweet and sour, has a distinct sour taste, and the difference in sweet and sour taste between the two is obvious from the beginning of the young fruit. In order to study the genetic basis of the taste of yellow skin fruit, the inventors compared the genomes of sweet and sour yellow skin using previous yellow skin resource resequencing data (Table 1) to find significant selection signals. Based on the high genetic differentiation (top 5% of Fst) in the whole genome, candidate divergence regions (CDRs) were detected using a 10Kb sliding window method. Among the 68 candidate divergence regions (CDRs), 1716 genes were screened out, and one MYB transcription factor was found on Chr7, named ClPHL6 (A). Subsequently, the inventors also found that the expression level of ClPHL6 in sour yellow skin was significantly lower than that in sweet yellow skin (B). Figure 1 Figure 1
[0113] Further, the inventors selected 5 sweet and sour yellow skin varieties respectively, and analyzed the expression level of ClPHL6 by qPCR, the results showed that the expression level of ClPHL6 in sweet yellow skin varieties was significantly higher than that in sour yellow skin varieties, and the correlation analysis showed that the expression level of ClPHL6 was positively correlated with the total sugar content of the fruit (C and D). Figure 1
[0114] The above results suggest that ClPHL6 can regulate fruit sugar accumulation. Since the molecular biology of yellow skin is just starting, the transient transformation system and stable transgenic system are still blank, in order to verify the function of ClPHL6 in regulating the accumulation of total sugar content in fruit in yellow skin, the inventors choose to verify by heterologous overexpression.
[0115] Example 2 Cloning of CDS region of ClPHL6 gene and bioinformatics analysis
[0116] The ClPHL6 sequence was extracted with reference to the Wampee reference genome "JingFeng" assembled by the research group (Chen et al. 2024. Identification of Key Genes Controlling Sugar and Organic Acid Accumulation in Wampee Fruit (Clausena lansium) via Genome Assembly and Genome-wide Association Analysis), and the primers ClPHL6-F / ClPHL6-R (Table 2) were designed using Premier 5.0. The total RNA of Wampee leaves was extracted using the RNA extraction kit (FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics - rich), Novogene, China), and the cDNA was reversely converted using the HiScript IV 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Novogene, China) kit.
[0117] The CDS sequence of ClPHL6 was obtained by using the cDNA as a template and the ClPHL6-F / ClPHL6-R as primers for CDS cloning. The PCR product was subjected to 1.5% agarose gel electrophoresis, and the results were detected and recorded using a gel imaging system (Bio-Rad). Figure 2 The PCR product was recovered and ligated with BlunT3, and the DH5a competent cells were transformed. Single colonies were selected for colony PCR, and the positive bacteria were sent to Shengong Bioengineering (Guangzhou) Co., Ltd. for sequencing. The CDS sequence of ClPHL6 was obtained, with a sequence size of 1503 bp. The CDS sequence of ClPHL6 gene was determined, and the nucleotide sequence is shown in SEQ ID NO: 1.
[0118] CDS sequence of ClPHL6 gene:
[0119]
[0120] Table 2 Clones used in the experiment, identification and real-time fluorescence quantitative (RT-qPCR) primers
[0121]
[0122] Conserved domain and protein physicochemical properties of ClPHL6 were analyzed by ExPaSy: ClPHL6 gene encodes 500 amino acids (the amino acid sequence of ClPHL6 is shown as SEQ ID NO: 2), the theoretical molecular weight is 54.8 kD, the theoretical isoelectric point is 6.36, the protein contains 60 negative residues (Asp+Glu) and 54 positive residues (Arg+Lys), the instability coefficient is 50.93, the aliphatic index is 69.86, and the average hydrophilicity is -0.604, indicating that ClPHL6 is a hydrophilic stable protein. According to the protein structure prediction of SMART (http: / / smart.embl.de / smart / set_mode.cgi?NORMAL=1) website, it is shown that ClPHL6 contains a MYB-DNA binding domain located at amino acid sequence 269-320, and a MYB-CC domain located at amino acid sequence 356-403 (protein structure schematic diagram as Figure 2 Fig. 3B).
[0123] The ClPHL6 gene encodes an amino acid sequence: MNHSITSVTKNESNKGVSQSCCTALSPVHNFLSVETEGQSLSTGECPFPHPSPFKRKESLSSPKHMQASTVVPQKNGLISTPDSPISPGSHFQHSKGGFSRSSVFCTSLYLSSSASSETHRQIGNFPFLPHPPTYNRSVSAVDSTMSSLLFSEDIGNPYQEEHSESLMKDFLNLPRDASDASFHGVTCMGERLGLNEQLELQFLSDELDIAITDHGENPRLDEIYDASKPSLKPPMGLLCNQNYVSSAPPVDALSSHTSPGSATAHKPRMRWTPELHECFVEAVSKLDGAEKATPKGVLKLMNVEGLTIYHVKSHLQKYRLAKYMPEKKEEKKACSSEEKKAASSIESDGRKKGSIQITEALRMQMEVQKQLHEQLEVQRALQLRIEEHARYLQKILAEQQKAGSAMVLPQAQSLSTITNGSKASEQQPSSPSFTVTASAILSPEQPAESKTESSSTSLLSKHKATDGRESKPDACLKRIRLENKPEIASDEAVVENPVQ*(SEQ ID NO: 2).
[0124] Example 3 Construction of ClPHL6 overexpression vector and phenotype analysis
[0125] 1. Construction of ClPHL6 overexpression vector
[0126] According to the ClPHL6 coding sequence, a forward primer ClPHL6-F1 containing a homologous arm of Hind III enzyme cutting site (CCAAATCGACTCTAGAAAGCTT, SEQ ID NO: 13) and a reverse primer ClPHL6-R1 containing a homologous arm of Kpn I enzyme cutting site (CCTCGCCCTTGCTCACCATGGTACC, SEQ ID NO: 14) (primer sequences are shown in Table 2) were designed, and cDNA was used as a template for amplification. The recovered product and the overexpression vector super1300 were respectively subjected to enzyme cutting using restriction endonuclease Hind III and Kpn I (Thermo Fisher Scientific), and then recovered. After that, the DH5a competent cells were transformed, and single colonies were picked for colony PCR using the universal primer Super1300-F / Super1300-R (primer sequences are shown in Table 2) (as shown in FIG. 2A). Figure 3The positive colonies were shaken, and the company was sequenced. After sequencing, the plasmid was extracted to obtain the overexpression vector super1300-ClPHL6.
[0127] 2. Molecular identification and phenotype analysis after transient overexpression of ClPHL6
[0128] The ClPHL6 overexpression vector (super1300-ClPHL6) and the empty vector (super1300) plasmid were transferred to Agrobacterium GV3101, and colony PCR identification was performed Figure 3 In the middle B, the positive monoclonal was picked to prepare the engineering bacteria. The engineering bacteria containing the ClPHL6 overexpression vector (super1300-ClPHL6) and the empty vector (super1300) were injected into the leaves of 4-6 week old Nicotiana benthamiana. The RT-PCR primers qClPHL6-F / qClPHL6-R (see Table 2 for primer sequences) were designed, and the expression of ClPHL6 was detected after 3 days.
[0129] It was found that the tobacco leaves injected with the overexpression vector super1300-ClPHL6 could detect the expression of ClPHL6 Figure 4 In the middle A). Then the soluble total sugar content of the tobacco leaves injected with the empty vector (super1300) and the overexpression vector (super1300-ClPHL6) was detected. Compared with the tobacco leaves injected with the empty vector, the soluble total sugar content of the tobacco leaves injected with the overexpression vector (super1300-ClPHL6) was significantly increased Figure 4 In the middle B).
[0130] 3. Molecular identification and phenotype analysis after heterologous overexpression of ClPHL6
[0131] The sterile seedlings of tomato (Micro-TOM) were germinated, and the cotyledon petioles and cotyledon tips were removed with a scalpel, leaving the middle part cut into 2-3 segments for inoculation in pre-culture medium at 23±2°C for 2-3 days. The positive Agrobacterium identified in 2. Molecular identification and phenotype analysis after transient overexpression of ClPHL6 was prepared in the infiltration liquid to prepare an Agrobacterium resuspension solution with OD 600 =0.1; the dried explants were inoculated in co-culture medium at 23±2°C in the dark for 2 days Figure 5 In the middle A). The recovered callus was inoculated in selection medium at 23°C with 16h / 8h light / dark for 15-30 days Figure 5 In the middle B); the selected callus was inoculated in differentiation medium at 23°C with 16h / 8h light / dark for 30-40 days Figure 5The seedlings to be differentiated are grown to about 2-3 cm, and are excised from the callus and inoculated in rooting medium, and cultured at 23 DEG C, 16h / 8h light / dark for 10-15 days to obtain resistant regenerated plants Figure 5 The tomato genomic DNA is extracted, and PCR detection is performed on the marker gene HPT (hygromycin gene), and the detection primers are HPT-F / HPT-R (see Table 2 for primer sequences), and the PCR detection results of the marker gene HPT are as shown in Fig. 2B. Figure 5
[0132] The mature fruits of the obtained positive plants and untransformed wild-type tomato plants are extracted for RNA, and are reverse transcribed into cDNA, amplification is performed using qClPHL6-F / qClPHL6-R, the wild type is used as a control, and agarose gel electrophoresis detection is performed on the expression of ClPHL6 in the regenerated plants, and the plants that can amplify the target fragment band are ClPHL6 heterologous overexpression stable plants Figure 5
[0133] The results are shown in Figs. 6G-6H, the soluble total sugar content of the fruits of the wild type and the two overexpression tomato lines is detected, and the results show that the soluble total sugar content of the fruits of the overexpression lines is significantly higher than that of the wild type, proving that the improvement method for the soluble total sugar content of the fruits based on the ClPHL6 gene can significantly improve the soluble total sugar content of the fruits, and has high application and research value. Figure 5
[0134] The embodiments of the present application are described in detail above in combination with the drawings, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.
Claims
1. Use of a ClPHL6 protein in any one of (1) to (5): (1) increasing the soluble sugar content of plant leaves; (2) preparing a product for increasing the soluble sugar content of plant leaves; (3) improving the quality of plant fruits; (4) preparing a product for improving the quality of plant fruits; (5) cultivating a genetic plant with high-quality plant fruits; the amino acid sequence of the ClPHL6 protein is as shown in SEQ ID NO: 2; the plant is tobacco, yellow skin or tomato; the improvement of the quality of plant fruits is to increase the content of soluble sugar in plant fruits.
2. Use of a biological material related to a ClPHL6 protein in any one of (1) to (5): (1) increasing the soluble sugar content of plant leaves; (2) preparing a product for increasing the soluble sugar content of plant leaves; (3) improving the quality of plant fruits; (4) preparing a product for improving the quality of plant fruits; (5) cultivating a genetic plant with high-quality plant fruits; the biological material carries a ClPHL6 protein, and the amino acid sequence of the ClPHL6 protein is as shown in SEQ ID NO: 2; the plant is tobacco, yellow skin or tomato; the improvement of the quality of plant fruits is to increase the content of soluble sugar in plant fruits.
3. Use according to claim 2, characterized in that, the biological material is any one of a1) to a8): a1) a nucleic acid molecule encoding a ClPHL6 protein; a2) an expression cassette containing the nucleic acid molecule of a1); a3) a recombinant vector containing the nucleic acid molecule of a1); a4) a recombinant vector containing the expression cassette of a2); a5) a recombinant microorganism containing the nucleic acid molecule of a1); a6) a recombinant microorganism containing the expression cassette of a2); a7) a recombinant microorganism containing the recombinant vector of a3); a8) a recombinant microorganism containing the recombinant vector of a4).
4. Use according to claim 3, characterized in that, the nucleic acid molecule is the sequence shown in SEQ ID NO:
1.
5. Targeted upregulation ClPHL6 The use of a reagent for the expression amount of a gene in any one of (1) to (5): (1) increasing the soluble sugar content of plant leaves; (2) preparing a product for increasing the soluble sugar content of plant leaves; (3) improving the quality of plant fruits; (4) preparing a product for improving the quality of plant fruits; (5) cultivating a genetic plant with high-quality plant fruits; The nucleotide sequence of the gene is the nucleotide sequence set forth in SEQ ID NO:
1. ClPHL6 the nucleotide sequence of the gene is the nucleotide sequence set forth in SEQ ID NO:
1. the plant is tobacco, yellow skin or tomato; the improvement of the quality of plant fruits is to increase the content of soluble sugar in plant fruits.
6. A method, said method being overexpression in a target plant ClPHL6 Gene; the method comprises any one of 1) to 3): 1) a method for increasing the soluble sugar content of plant leaves; 2) a method for improving the quality of plant fruits; 3) a method for cultivating a genetic plant with high-quality plant fruits; The nucleotide sequence of the gene is the nucleotide sequence set forth in SEQ ID NO:
1. ClPHL6 the nucleotide sequence of the gene is the nucleotide sequence set forth in SEQ ID NO:
1. the plant is tobacco, yellow skin or tomato; the improvement of the quality of plant fruits is to increase the content of soluble sugar in plant fruits.
7. The method of claim 6, wherein, the method comprises the following steps: (1) Construction ClPHL6 Gene overexpression vectors; (2) dipping the plant into Agrobacterium after the overexpression vector is transferred into Agrobacterium.
8. The method of claim 7, wherein, the backbone vector of the overexpression vector is super1300.
9. detecting ClPHL6 The application of the reagent of the gene in distinguishing sweet poncian variety and sour poncian variety ClPHL6 The nucleotide sequence of the gene is shown as SEQ ID NO:
1.
10. Use according to claim 9, characterized in that, the reagent comprises a primer sequence for detecting a ClPHL6 gene.
11. Use according to claim 10, characterized in that, The primer sequence is shown as SEQ ID NO: 3-4. The primer sequence is shown as SEQ ID NO: 3-4.
Citation Information
Patent Citations
Gene for improving draught resistance ability of plants and application of gene
CN106520780A
Parthenogenetic haploid induction gene and application thereof
WO2022117024A1