Application and method of OsProT2 gene in regulating cadmium content, cadmium tolerance and yield in rice

Abstract

The present invention belongs to the field of crop genetic breeding and relates to a OsProT2 The application and method of genes in regulating rice cadmium content, cadmium tolerance and yield. OsProT2 It was found that the knockout strains significantly increased the Cd content in the aboveground parts and roots of rice, promoting rice plant height and root growth under Cd stress; at the same time, it significantly increased the Pro content in the aboveground parts of rice seedlings and reduced the Pro content in the roots of rice seedlings. It was also found that the yield of the knockout strains was increased, providing new genetic resources for the cultivation of high-yield and stress-resistant rice varieties.

Description

Technical Field

[0001] The present invention belongs to the field of crop genetic breeding and relates to OsProT2 New applications of genes. Background Art

[0002] Cadmium (Cd) is a highly toxic heavy metal element that is widely present in nature. Large amounts of cadmium enter the soil environment due to industrial wastewater discharge, wastewater irrigation, and the use of cadmium-containing fertilizers and pesticides. Rice has a strong ability to absorb and accumulate cadmium. Numerous studies have shown that when rice is grown in cadmium-contaminated soil, its roots absorb cadmium, which is transported to the aboveground parts through the xylem, ultimately accumulating in the rice grains. Consuming rice with excessive cadmium content can cause serious harm to human health. Cadmium can accumulate in organs such as the kidneys and liver. Long-term exposure can cause kidney diseases such as renal tubular damage and renal failure, as well as bone diseases such as osteoporosis and osteomalacia, seriously affecting food safety and human health.

[0003] Rice is one of the world's most important food crops, providing the staple food for approximately half of the world's population. With the continued growth of the global population and improvements in living standards, the demand for rice production is also increasing. Ensuring stable growth in rice production is of irreplaceable importance for addressing global food security. However, increasing rice production faces numerous challenges. On the one hand, the area of arable land is decreasing year by year, making increasing yield per unit area a key way to meet growing food demand. On the other hand, rice is subject to a variety of biotic and abiotic stresses during its growth. Biological stresses, such as pests and diseases, directly damage rice plants and reduce yield. Abiotic stresses, such as drought, flooding, high and low temperatures, and poor soil quality, can affect rice growth, photosynthesis, nutrient absorption, and other physiological processes, thereby limiting yield increases. For example, in drought-prone areas, insufficient water stunts rice growth, resulting in fewer grains per panicle and lower thousand-grain weight. High temperatures reduce pollen viability and seed set.

[0004] In terms of regulating cadmium content in rice, although some genes related to cadmium absorption, transport and detoxification have been identified, for example, some transporter genes such as OsNRAMP5 Although several genes have been found to be involved in cadmium uptake in rice, regulating these single genes alone often makes it difficult to effectively control cadmium levels without affecting other important agronomic traits. Furthermore, further research is needed to determine the stability of the regulatory effects of some genes across different rice varieties and environmental conditions.

[0005] Enhanced tolerance of rice to Cd stress is often due to reduced Cd uptake or activated stress signaling. However, there are no reports of simultaneously increasing Cd content and promoting rice growth and yield under Cd stress. Proline is a key stress-responsive substance in rice, but whether proline transport and genes mediating proline transport can be used to regulate Cd content and tolerance in rice plants under Cd stress remains unclear, and the potential effectiveness of such regulation remains to be explored. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention proposes a OsProT2 Application and methods of genes in regulating cadmium content, cadmium tolerance and yield in rice.

[0007] The technical solution of the present invention is achieved as follows:

[0008] OsProT2 The application of genes in regulating Cd content in rice, OsProT2 The gene nucleotide sequence has a similarity of more than 90% with the sequence shown in SEQ ID No.1.

[0009] Furthermore, the above OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0010] The above application is silent OsProT2 The function of the gene is to achieve the purpose of increasing the Cd content in rice.

[0011] OsProT2 Application of genes in improving rice yield.

[0012] The above application is through silence OsProT2 The function of genes is used to increase rice yield.

[0013] The present application also provides a method for cultivating rice tolerant to cadmium stress by inhibiting or knocking out the OsProT2 The expression of the gene was controlled to obtain rice tolerant to cadmium stress.

[0014] The above method for cultivating rice tolerant to cadmium stress is designed OsProT2 Gene knockout target site, construction OsProT2 The CRISPR-Ca9 knockout vector of the gene was used to obtain cadmium stress-tolerant rice using Agrobacterium-mediated genetic transformation.

[0015] Furthermore, the above rice is a japonica rice variety.

[0016] When the rice variety is ZH11, the sequence of the knockout target site is shown as SEQ ID No. 2; when the rice variety is Nipponbare, the sequence of the knockout target site is shown as SEQ ID No. 3.

[0017] When the target site sequence is shown as SEQ ID No. 2, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No. 4 and SEQ ID No. 5; when the target site sequence is shown as SEQ ID No. 3, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No. 6 and SEQ ID No. 7.

[0018] The present application also provides a primer set for identifying cadmium stress-tolerant rice cultivated using the above method. When the rice variety is ZH11, the primer set sequences are shown as SEQ ID No. 8 and SEQ ID No. 9; when the rice variety is Nipponbare, the primer set sequences are shown as SEQ ID No. 10 and SEQ ID No. 11.

[0019] The present invention has the following beneficial effects:

[0020] 1. This application is constructed by OsProT2 Knockout mutant material confirmed OsProT2 The encoded transporter protein can regulate the Cd or Pro content in rice. OsProT2 The gene significantly increased the Cd content in the aboveground and roots of rice seedlings at the seedling stage, promoting rice plant height and root growth under Cd stress; at the same time, it significantly increased the Pro content in the aboveground part of rice seedlings and reduced the Pro content in the roots of rice seedlings. OsProT2 It may negatively regulate the Cd content in plants. OsProT2 The Pro content in the roots of the mutant was reduced, resulting in an increase in Cd content.

[0021] 2. OsProT2 It is a gene encoding a proline transporter that can promote the distribution of proline to the roots. Silencing the gene function leads to a decrease in the proline content in the roots, thereby promoting the absorption of Cd. Silencing the gene function also leads to an increase in the proline content in the aboveground part, thereby increasing Cd tolerance and promoting growth. The increased proline content in the aboveground part promotes rice growth and can obtain higher yields at the harvest time, providing a new gene resource for breeding high-yield and stress-resistant rice varieties. Compared with existing technologies, the use of silencing OsProT2 Gene, can achieve the change of proline distribution in roots and aboveground parts, so as to simultaneously increase Cd content and promote growth under Cd stress; moreover, this technology silences OsProT2 The gene can increase yield while improving Cd tolerance. OsProT2 It was found that the yield of the knockout lines was increased, providing new genetic resources for breeding high-yield and stress-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 To use CRISPR technology to construct a OsProT2 Knockout of genetic material.

[0024] Figure 2 The results are as follows: normal hydroponic culture, 0.5 mM Pro, 10 μM Cd and 0.5 mM Pro+10 μM Cd four different treatments OsProT2 Phenotype diagram of mutant plants; Figure (A) shows the plant height statistics of mutants under different treatments; Figure (B) shows the root length statistics of mutants under different treatments; Figures (CF) show the treatments of normal hydroponic culture, 0.5 mM Pro, 10 μM Cd, and 0.5 mM Pro+10 μM Cd, respectively. prot2 Phenotype diagram of the mutant with two leaves and one heart.

[0025] Figure 3 Processed for Cd or Cd+Pro OsProT2 Figure 2. Cd content in mutant plants; Figure (A) is OsProT2 (ZH11) mutant seedling cadmium content and individual cadmium content, Figure (B) is OsProT2 Cadmium content in seedlings and individual plants of the (NIP) mutant.

[0026] Figure 4 Normal hydroponic culture or 10 μM Cd treatment OsProT2 Pro content in mutant plants. OsProT2 (ZH11) mutant seedlings aboveground Pro content, Figure (B) OsProT2 Pro content in the roots of (ZH11) mutant seedlings; Figure (C) OsProT2 (NIP) mutant seedlings aboveground Pro content, Figure (D) OsProT2 Pro content in roots of (NIP) mutant seedlings.

[0027] Figure 5 for OsProT2 Field phenotypes of the (ZH11) mutant. Scale bar in (A) is 10 cm.

[0028] Figure 6 for OsProT2 Field phenotypes of (NIP) mutant materials. Scale bar in (A) is 10 cm. DETAILED DESCRIPTION

[0029] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified. Example

[0031] 1. Test Materials

[0032] In November 2020 and April 2018, CRISPR-Cas9 gene editing technology was used in Zhonghua 11 (ZH11) and Nipponbare (NIP) respectively. OsProT2 Gene sequence analysis showed that the ZH11 knockout target site was designed as SEQ ID No. 2: ttaggctggattggtgggac, and the Nipponbare knockout target site was designed as SEQ ID No. 3: gacactgtccaggtctccga.

[0033] Oligonucleotides SEQ ID No. 4: TGATTGTTAGGCTGGATTGGTGGGA (ZH11-CrProT2-UP) and SEQ ID No. 5: AAACTCCCACCAATCCAGCCTAACA (ZH11-CrProT2-LOW) were synthesized. Primer dimers were prepared according to conventional methods and ligated into the vector BGK032 (for vector information and construction methods, see Lu, Yuming et al. Genome-wide Targeted Mutagenesis in Rice Using the CRISPR / Cas9 System, Molecular Plant, Volume 10, Issue 9, 1242–1245) to generate a CRISPR-Cas9 knockout vector in the ZH11 background.

[0034] Oligonucleotides SEQ ID No. 6: TGTGTGGACACTGTCCAGGTCTCCG (NIP-CrProT2-UP) and SEQ ID No. 7: AAACCGGAGACCTGGACAGTGTCCA (NIP-CrProT2-LOW) were synthesized. Primer dimers were prepared according to conventional methods and ligated into the vector BGK03 (for vector information and construction methods, see Lu, Yuming et al. Genome-wide Targeted Mutagenesis in Rice Using the CRISPR / Cas9 System, Molecular Plant, Volume 10, Issue 9, 1242–1245) to generate a CRISPR-Cas9 knockout vector in the Nipponbare background.

[0035] We commissioned BioGene to carry out genetic transformation on ZH11 and NIP to obtain T0 generation transgenic seedlings. After the test tube seedlings grew stably, we amplified the target fragments and sequenced the transgenic lines to screen and obtain effective knockout mutant materials.

[0036] 2. Identification of mutant materials

[0037] DNA extraction: using TGFast TM Plant Genome Rapid Extraction Kit (Catalog Number: TM0301) was used and the procedure was followed according to the manufacturer's instructions.

[0038] Identification of mutant genotype: Design a pair of specific primers for the target site of CRISPR material:

[0039] ZH11 Background:

[0040] SEQ ID No.8: TCGATCCTTAAGTCTTCCTAGCC(Cr-ProT2-ZH11F3);

[0041] SEQ ID No.9: GCAGAGCCCATGTAAGCGAATACA(Cr-ProT2-ZH11R3);

[0042] Japanese sunny background:

[0043] SEQ ID No.10: TGGCTAAGGAACAACCAGTGT(GP3748-3018-F);

[0044] SEQ ID No. 11: GCTACTTTTGTGGGGGTGCT (GP3748-3018-R).

[0045] Perform mutant genotype detection. Using DNA as a template, PCR amplified gene fragments, commissioned Qingke Biotechnology Company to sequence, and used SnapGene software to compare the amplified fragment sequences, and screened OsProT2 For mutant plants with deletions or additions of gene target site sequences that are not integer multiples of 3, the ZH11 background mutants were named C④-16 (2 bp deletion), C9 (59 bp deletion), C13 (1 bp deletion), and the Nipponbare background mutants were named LH34 (1 bp insertion). Figure 1 shown.

[0046] Application example: Rice cultivation

[0047] 1. Hydroponics in the seedling stage

[0048] Seed germination: Soak the rice seeds in tap water for 2-3 days to allow them to fully absorb water until they turn white. Then spread them evenly in a germination dish and culture them in a 30°C incubator under dark conditions for 1-2 days until the seeds grow young embryos and radicles.

[0049] Seedling culture: Seeds with consistent germination were seeded in 96-well hydroponic culture trays and cultured in a climatic chamber under simulated natural light conditions (14 h daytime, 30°C, 10 h nighttime, 26°C, light intensity of 30,000 lux) using Yoshida rice nutrient solution for 3 days. The treatment solution consisted of a normal nutrient solution supplemented with varying concentrations of CdCl2 and proline. The CK treatment consisted of a normal nutrient solution supplemented with 10 μM CdCl2; the Pro treatment consisted of a normal nutrient solution supplemented with 0.5 mM Pro; and the Cd+Pro treatment consisted of a normal nutrient solution supplemented with 10 μM CdCl2 and 0.5 mM Pro. Plants were cultured until they reached the two-leaf, one-heart stage, and parameters were observed and measured.

[0050] Table 5 Composition of normal nutrient solution for rice

[0051]

[0052] 2. Determination of growth indicators at the seedling stage

[0053] Plant height measurement: Use a ruler to measure the distance from the base of the plant to the tip of the highest leaf, which is the plant height.

[0054] Root length measurement: Use a ruler to measure the distance from the base of the plant to the top of the root tip, which is the root length.

[0055] Phenotype photos: obtained directly by taking photos.

[0056] like Figure 2 We found that compared with the control, the mutant OsProT2Under normal hydroponic conditions, 10 μM Cd and 0.5 mM Pro + 10 μM Cd treatments, the plant height was significantly higher than the control, and the root length was also significantly longer than the control. Among them, under normal hydroponic conditions, compared with the wild type ZH11, prot2 The plant heights of the mutants were extended by 8.99%, 7.09%, and 5.66%, respectively. prot2 The root lengths of the mutants were extended by 19.30%, 23.34%, and 10.43% respectively; under cadmium stress, compared with the wild type ZH11, prot2 The plant heights of the mutants were extended by 16.51%, 18.43%, and 23.50, respectively. prot2 The root lengths of the mutants were extended by 152.95%, 157.74%, and 163.87% respectively; under Pro+Cd conditions, compared with the wild type ZH11, prot2 The plant heights of the mutants were extended by 14.76%, 12.77%, and 14.89, respectively. prot2 The root lengths of the mutants were elongated by 20.29%, 23.31%, and 21.69%, respectively.

[0057] Determination of Cd ion content:

[0058] Will prot2 (ZH11) mutant materials C④-16, C13, C9 and wild type ZH11, and prot2 The mutant LH34 and wild-type NIP were removed from the hydroponic culture chamber and soaked in ultrapure water for approximately 30 seconds, repeated three times, to remove impurities. Plants were then soaked in 5 mM EDTA-2Na solution for 15 minutes to completely remove surface ions. The plants were then rinsed three times with fresh ultrapure water to remove the EDTA-2Na solution. The plants were dried with paper towels. The aerial parts (the entire plant 2 cm above the root base) and roots of the seedlings were transferred to 10 mL centrifuge tubes. After drying in a 105°C oven for 30 minutes, the tubes were oven-dried at 85°C for 3 days. Steel balls were placed in the centrifuge tubes containing the dried samples and ground using a high-throughput grinder at 40 Hz for 12 minutes. A 0.05 g sample was weighed and placed into heat- and acid-resistant flow cytometry tubes. 1 mL of nitric acid was added to each tube, mixed thoroughly by vortexing, and then digested overnight in a fume hood. The digested samples were then placed in a 100°C waterbath and boiled until clear and transparent. The digested samples were diluted 10 times with ultrapure water to a fixed volume for testing, and the Cd ion content was determined using an inductively coupled plasma mass spectrometer (PerkinElmer NexION 300).

[0059] The results are as follows Figure 3 As shown in Figure 2, under Cd stress, whether or not exogenous proline was applied, OsProT2 The Cd content in the shoots and roots of the mutant was increased. prot2 The Cd content in the aboveground parts of the mutants increased by 319.01%, 288.55%, and 207.50%, respectively. prot2 The Cd content in the roots of the mutants increased by 179.74%, 179.19% and 103.60% respectively; compared with the wild type Nipponbare, prot2 The Cd content in the aboveground part of the mutant increased by 56.11%. prot2 The Cd content in the roots of the mutant increased by 37.35%; under Cd+Pro treatment, compared with the wild type ZH11, prot2 The Cd content in the aboveground parts of the mutants increased by 34.95%, 45.46%, and 41.36%, respectively. prot2 The Cd content in the roots of the mutants increased by 19.74%, 21.14%, and 23.67%, respectively; compared with the wild type Nipponbare, prot2 The Cd content in the aboveground part of the mutant increased by 52.30%. prot2 The Cd content in the roots of the mutant increased by 33.44%.

[0060] Proline content determination:

[0061] Will prot2 (ZH11) mutant materials C④-16, C13, C9 and wild type ZH11, and prot2 When the (NIP) mutant LH34 and wild-type NIP plants developed two leaves and one heart during normal and Cd-treated culture, they were removed from the hydroponic culture chambers and soaked in ultrapure water for approximately 30 seconds three times to remove impurities. The plants were then dried with a paper towel. The aerial parts (the entire plant 2 cm above the root base) and roots of the seedlings were transferred to 10 mL centrifuge tubes. After drying in a 105°C oven for 30 minutes, the tubes were oven-dried at 85°C for 3 days. Steel balls were placed in the centrifuge tubes containing the dried samples and ground using a high-throughput grinder at 40 Hz for 12 minutes. Proline content was determined using a UV spectrophotometer. 0.1 g of powdered sample was weighed and placed in large test tubes. 5 mL of 3% sulfosalicylic acid was added, and the tubes were capped with glass balls. The tubes were then extracted in a boiling water bath for 10 minutes. Remove the test tubes and allow them to cool to room temperature. Transfer 2 mL of the supernatant to another stoppered test tube. Add 2 mL of glacial acetic acid and 3 mL of colorimetric solution. Heat in a boiling water bath for 40 min. Remove and cool, then add 5 mL of toluene to each tube and shake thoroughly to extract the red substance. Allow the mixture to stand for separation, then aspirate the toluene layer and compare color at 520 nm using a blank tube as a control.

[0062] The results are as follows Figure 4 As shown, in both cases compared with wild type OsProT2 The Pro content in the aboveground part of the mutants was significantly increased, while the Pro content in the roots was significantly decreased. Among them, under normal hydroponic conditions, compared with the wild type ZH11, prot2The Pro content in the aboveground part of the mutants increased by 33.72%, 29.36%, and 47.74%, respectively. prot2 The Pro contents in the roots of the mutants decreased by 16.67%, 33.73%, and 22.95%, respectively; compared with the wild type Nipponbare, prot2 The Pro content in the aboveground part of the mutant increased by 12.71%. prot2 The Pro content in the mutant roots was reduced by 41.41%; under Cd stress conditions, compared with the wild type ZH11, prot2 The Pro content in the aboveground part of the mutants increased by 42.73%, 48.38%, and 68.25%, respectively. prot2 The Pro contents in the roots of the mutants decreased by 9.40%, 21.78%, and 37.78%, respectively; compared with the wild type Nipponbare, prot2 The Pro content in the aboveground part of the mutant increased by 11.05%. prot2 The Pro content in the roots of the mutant was reduced by 23.95%, suggesting that increasing the Pro content in the aboveground parts and reducing the Pro content in the roots are beneficial to increasing Cd tolerance and plant Cd content.

[0063] 3. Field agronomic traits determination

[0064] Soak rice seeds in tap water for 2-3 days to allow them to fully absorb water until they turn white. Then, evenly spread them in germination dishes and incubate them in a dark incubator at 30°C for 1-2 days until tender plumules and radicles emerge. Sow the seeds in the soil on March 26, 2024, and transplant the rice seedlings on April 27, 2024. Maintain normal watering, fertilization, and pest management until harvest.

[0065] Yield per plant: The harvested seeds were threshed and dried, and then the rice yield was statistically analyzed using the SC-G automatic seed analyzer.

[0066] The yield performance during the harvest period is as follows Figure 5 As shown, OsProT2 (ZH11) mutant has increased yield per plant. OsProT2 Loss of gene function can increase yield. OsProT2 The (NIP) mutant also showed similar behavior ( Figure 6 ), compared with wild-type NIP, OsProT2 The single plant weight of the (NIP) mutant increased compared with the wild-type ZH11 and NIP. prot2 The yield of the mutants increased by more than 20%.

[0067] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. OsProT2 The application of the gene in increasing the cadmium content of rice is characterized by: described OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No. 1; The application is through silence OsProT2 gene, in order to increase the cadmium content in rice.

2. OsProT2 The application of genes in increasing rice yield is characterized by: described OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No. 1; The steps of the application are: OsProT2 Gene, to achieve the goal of increasing rice yield.

3. A method for cultivating rice tolerant to cadmium stress, characterized by: By inhibiting the OsProT2 Gene expression or knockout in rice OsProT2 Gene, to obtain rice tolerant to cadmium stress; OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. A method for cultivating rice tolerant to cadmium stress, characterized in that: The steps are: design OsProT2 Gene knockout target site, construction OsProT2 A CRISPR-Ca9 knockout vector of the gene is used to obtain rice tolerant to cadmium stress using Agrobacterium-mediated genetic transformation; OsProT2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

5. The method for cultivating rice tolerant to cadmium stress according to claim 4, characterized in that: The rice is a japonica rice variety.

6. The method for cultivating rice tolerant to cadmium stress according to claim 5, characterized in that: When the rice variety is ZH11, the knockout target site sequence is shown in SEQ ID No. 2; When the rice variety is Nipponbare, the knockout target site sequence is shown as SEQ ID No.

3.

7. The method for cultivating rice tolerant to cadmium stress according to claim 6, characterized in that: When the knockout target site sequence is shown as SEQ ID No. 2, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No. 4 and SEQ ID No. 5; when the knockout target site sequence is shown as SEQ ID No. 3, the oligonucleotide sequences used to construct the knockout vector are shown as SEQ ID No. 6 and SEQ ID No. 7.

Images