A method for modulating leaf length or width in maize

Abstract

The present application belongs to the field of molecular genetics, and particularly relates to a method for regulating the length or width of corn leaves. The present application provides a method for regulating the length or width of corn leaves through precise point mutation.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics, and specifically relates to a method for regulating the length or width of maize leaves. Background Technology

[0002] Dwarfing traits have led to breakthroughs in crop yield, and methods for reducing crop plant height have great application potential. Among the main agronomic traits of maize, plant height and ear height affect lodging resistance, photosynthetic efficiency, and harvest index, and are closely related to maize yield. Therefore, plant height and ear height traits have important value in maize breeding practices and germplasm resource improvement.

[0003] Gibberellin oxidase is a major regulatory site catalyzing the later stages of gibberellin biosynthesis and catabolism, playing a crucial role in regulating gibberellin homeostasis in plants. Gibberellin oxidases mainly include different types such as GA20ox, GA3ox, and GA2ox.

[0004] Because changes in the expression of GA2ox genes affect gibberellin content, most genetically modified materials related to GA2ox genes often exhibit significant changes in plant morphology, and even plant fertility can be affected, which is detrimental to the application of GA2ox genes. Studies have found that rice overexpressing wild-type OsGA2ox6 exhibits complete dwarfing, while the GA2ox6 mutants Y123A, E140A, A141E, H143A, and G343A show varying degrees of reduced plant height. Among them, E140A and A141E have a yield-increasing effect, while the other mutants, although affecting plant height, have no positive effect on yield (Plant Biotechnology Journal, 2017, 15:850–864).

[0005] The mutants E144A and A145E of ZmGA2ox6 in maize (corresponding to E140A and A141E in rice) have the effect of improving drought resistance in Arabidopsis thaliana (CN111778265 B), but it is still uncertain what phenotypic changes will occur when expressed in maize. Summary of the Invention

[0006] The technical problem to be solved by this invention is to develop a method for reducing maize plant height by mutating ZmGA2ox2.

[0007] To solve the above problems, the present invention adopts the following technical solution:

[0008] This invention provides the application of maize genes in regulating maize leaf length and / or width, characterized in that: the gene comprises any one of the following:

[0009] (1) The gene with the sequence shown in SEQ ID NO.1;

[0010] (2) The gene encoding the protein sequence shown in SEQ ID NO.2;

[0011] (3) The gene numbered Zm00001d002999 in the maize reference genome database.

[0012] The present invention also provides a method for increasing the length of maize leaves, characterized in that: the 144th E position of the protein encoded by the above-mentioned gene in maize is mutated to A or the 341st T position is mutated to A, and maize plants with increased leaf length are selected.

[0013] The present invention also provides a method for reducing the length of maize leaves, characterized in that: the above-mentioned gene is knocked out or suppressed, or a mutant gene of the above-mentioned gene is overexpressed in maize, wherein the mutant gene is a mutation of E at position 144 of the gene encoding a protein to A or a mutation of A at position 145 to E.

[0014] Select corn plants with reduced leaf length.

[0015] In some implementations, the above-mentioned method for knocking out or repressing genes involves deleting bases 291 to 1767 of the sequence shown in SEQ NO.1.

[0016] The present invention also provides a method for increasing the width of maize leaves, characterized in that: a mutant gene of the above-mentioned gene is overexpressed in maize, wherein the mutant gene is a mutation of E at position 144 to A or a mutation of A at position 145 to E in the protein encoded by the gene, or a mutation of T at position 341 to A in the protein encoded by the above-mentioned gene in maize.

[0017] Select corn plants with increased leaf width.

[0018] In some implementations, the above-mentioned overexpression method involves using the maize ubiquitin promoter to drive the mutant gene of the above-mentioned gene.

[0019] The present invention also provides a method for reducing the width of maize leaves, characterized in that: the above-mentioned gene is knocked out or suppressed, or the protein encoded by the above-mentioned gene in maize is mutated from E at position 144 to A;

[0020] Select corn plants with reduced leaf width.

[0021] This invention also provides a kit for reducing the length and / or width of corn leaves, characterized in that it comprises any one of the following:

[0022] (1) gRNA molecules that can simultaneously recognize TTGATCGACCTGACGTGCCTG and CTGGGCCACGACGAGGCGG or their reverse complementary sequences.

[0023] (2) The DNA molecule encoding the gRNA described in (1);

[0024] (3) Vectors for expressing the gRNA described in (1).

[0025] In some implementations, the sequences of the above-mentioned gRNA molecules are CAGGCACGUCAGGUCGAUCAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU and CUGGGCCACGACGAGGCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU.

[0026] In some implementations, the kit described above also includes the Cas9 protein.

[0027] This invention also provides a kit for regulating the length and / or width of maize leaves, characterized in that it comprises any one of the following:

[0028] (1) pegRNA molecules that can recognize AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC or their reverse complementary sequences.

[0029] (2) The DNA molecule encoding the pegRNA described in (1);

[0030] (3) A vector expressing the pegRNA described in (1);

[0031] (4) RNA molecules capable of recognizing CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC or their reverse complementary sequences;

[0032] (5) A DNA molecule encoding the RNA described in (4);

[0033] (6) A vector for expressing the RNA described in (4).

[0034] In some embodiments, the sequence of the pegRNA molecule described in (1) is CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

[0035] In some embodiments, the sequence of the RNA molecule described in (4) is CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU.

[0036] In some implementations, the kit described above also includes nSpCas9 fused with M-MLV.

[0037] In some embodiments, the amino acid sequence of the above-mentioned nSpCas9 is shown in SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown in SEQ ID NO.6.

[0038] The advantages and beneficial effects of this invention are as follows: This invention discovers that the ZmGA2ox2 gene has the function of regulating the length or width of maize leaves. Manipulating this gene, including knockout or suppression, overexpression of the mutant gene, and precise editing of the gene, can increase or decrease the length or width of maize leaves. Attached Figure Description

[0039] Figure 1 Information on ZmGA2ox2 gene overexpression and knockout vector elements. A: Schematic diagram of T-DNA region elements in the overexpression vector. B: Schematic diagram of T-DNA region elements in the gene editing knockout vector. C: Target site location and sequence of the knockout vector. D: Mutation status of the edited gene.

[0040] Figure 2 Leaf phenology in maize with and without ZmGA2ox2 gene overexpression and knockout. WT: wild-type maize; KO: gene knockout maize.

[0041] Figure 3Leaf phenology of maize overexpressing the ZmGA2ox2 mutant gene. A: T-DNA region structure diagram of the overexpression vector; B: Genotype of the target gene point mutation; C: Leaf phenology of the overexpressed point mutant gene. E144A-OE+: Positive E144A overexpression maize; A145E-OE+: Positive A145E overexpression maize; E144A-OE-: Negative control for E144A overexpression; A145E-OE-: Negative control for A145E overexpression.

[0042] Figure 4 The creation process of E144A and T341A precision-edited materials. A: T-DNA region structure diagram of the precision-editing vector; B: Target site location and sequence of the target gene; C: Specific mutation details. Detailed Implementation

[0043] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0044] As used herein, “maize” means any maize plant and includes all plant varieties that can be bred with maize, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of naturally occurring amino acids that can function in a similar manner to naturally occurring amino acids.

[0045] As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to nucleic acids or polypeptides or their biologically active portions, which are substantially or essentially free of components typically associated with or reacting with the nucleic acid or polypeptide as found in their natural environment. Thus, when isolated or purified nucleic acids or polypeptides are produced using recombinant techniques, they are substantially free of other cellular material or culture media, or when isolated or purified nucleic acids or polypeptides are chemically synthesized, they are substantially free of chemical precursors or other chemicals. "Isolated" nucleic acids typically do not contain sequences (such as sequences encoding proteins) naturally flanking the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid may comprise a nucleotide sequence of less than about 0.5 kb naturally flanking the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0046] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0047] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0048] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Identification of sequence identity includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism.

[0049] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, rachis, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0050] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0051] Example

[0052] Example 1: Effects of overexpression and knockout of the ZmGA2ox2 gene on maize phenotype

[0053] To clarify the impact of the ZmGA2ox2 gene (gene number Zm00001d002999) on maize growth, the inventors first used conventional overexpression and gene editing knockout techniques to overexpress and knock out the ZmGA2ox2 gene in the maize inbred line KN5585. Overexpression was performed using the ubi promoter to drive the gene CDS sequence, and gene knockout was performed using three sgRNAs simultaneously (see schematic diagram of the T-DNA vector for overexpression and gene editing). Figure 1 After obtaining overexpressed and edited maize materials, plant height and ear height, upper ear leaf length and width, ear leaf length and width, and lower ear leaf length and width were investigated. Results showed that the overexpressed maize material resulted in extremely dwarf maize with poor seed setting, a 52.53% reduction in plant height, and a 57.43% reduction in ear height. Gene-edited maize showed significantly increased plant height and ear height, with plant height increasing by 4.71% and ear height by 7.97%. Furthermore, the gene-edited materials showed significantly reduced upper ear leaf length and width, ear leaf length and width, and lower ear leaf length and width. Figure 2 ).

[0054] Table 1. Changes in leaf length and width of gene-edited maize (unit: cm)

[0055]

[0056] The above results indicate that the ZmGA2ox2 gene plays a role in regulating maize plant height and also affects the length and width of maize leaves.

[0057] Sequencing results of the target genes in the gene-edited (gene knockout) material showed that the gene editing resulted in a 1477bp deletion (positions 291–1767 of SEQ NO. 1) between target 1: TTGATCGACCTGACGTGCCTG and target 3: CTGGGCCACGACGAGGCGG. Figure 1 ).

[0058] Example 2: Phenotypic Performance of Maize Overexpressing ZmGA2ox2 Mutant

[0059] Direct overexpression of the ZmGA2ox2 gene leads to extreme dwarfing and very low seed setting rate in maize, rendering it impractical. The inventors propose to perform point mutations on ZmGA2ox2 followed by overexpression. Three gibberellin binding sites were selected as the protein mutation sites: A145E, E144A, and T341A. The corresponding codons were changed from GAG to GCG, GCG to GAG, and ACC to GCC, respectively. Except for the ZmGA2ox2 gene mutation, all other elements of the overexpression vector are the same as in Example 1.

[0060] The overexpression vector of the mutant gene was transformed into the maize inbred line KN5585 to obtain E144A-OE, A145E-OE, and T341A-OE transgenic plants. Among them, the T341A-OE plants failed to reach harvest age, while the E144A-OE and A145E-OE plants completed their growth cycle. Compared with the negative control, the E144A-OE and A145E-OE materials showed decreased leaf length and increased leaf width. Figure 3 (Tables 2 and 3).

[0061] Table 2. Leaf length of maize materials overexpressing mutant genes (unit: cm)

[0062]

[0063] "+" and "-" represent positive and negative controls for overexpression, respectively.

[0064] Table 3. Leaf width of maize materials overexpressing mutant genes (unit: cm)

[0065]

[0066] "+" and "-" represent positive and negative controls for overexpression, respectively.

[0067] Example 3: Precise editing of the ZmGA2ox2 gene locus to assess phenotypic performance in maize

[0068] The inventors further used precise gene editing technology (guided editing) to precisely edit the E144 and T341 sites of the endogenous ZmGA2ox2 gene in maize to obtain E144A and T341A mutant materials.

[0069] Finally, mutant materials E144A and T341A were successfully obtained. The editing vector structure, target sequence, and base editing details used for these two mutant materials are detailed in [link to documentation]. Figure 4 The two targets designed for the E144A mutation are CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC;

[0070] The two targets for the T341A mutation design are AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC.

[0071] The pegRNA (prime editing guide RNA) sequence of E144A is: CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU;

[0072] The pegRNA (prime editing guide RNA) sequence of T341A is: CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

[0073] The nSpCas9 used is a SpCas9 protein containing the H840A mutation, the nucleic acid sequence of which is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4. In addition, the C-terminus of nSpCas9 is fused with M-MLV reverse transcriptase, the nucleic acid sequence of which is shown in SEQ ID NO.5, and the encoded amino acid sequence is shown in SEQ ID NO.6. Protein tags (such as flags) or nuclear localization signals can be added to both ends of nSpCas9 or M-MLV as needed.

[0074] After PCR identification and sequencing, maize materials containing the target genotype but without the vector were screened for functional evaluation. Field survey results showed that, compared with the control, the leaf length and width of T341A precise point mutant maize were increased; the leaf length of E144A precise point mutant maize was increased and the leaf width was decreased (Tables 4 and 5).

[0075] Table 4. Precise Editing of Corn Leaf Length (Unit: cm)

[0076]

[0077] "+" and "-" indicate positive and negative controls, respectively.

[0078] Table 5. Accurately edited corn yield trait data.

[0079]

[0080] "+" and "-" indicate positive and negative controls, respectively.

[0081] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Use of a maize gene in modulating leaf length and / or width in maize, characterized in that: The gene is a gene encoding a protein as shown in SEQ ID NO.

2.

2. Use according to claim 1, characterized in that: The gene is a gene numbered as Zm00001d002999 in the maize reference genome database.

3. A method of increasing leaf length in maize, comprising: The E at position 144 of the protein as shown in SEQ ID NO. 2 is mutated to A or the T at position 341 is mutated to A in the maize, and plants with increased leaf length of maize are selected.

4. A method of reducing leaf length in maize, comprising: Knocking out or inhibiting the gene as described in any one of claims 1-2, or overexpressing in maize a mutant protein in which the E at position 144 of the protein as shown in SEQ ID NO. 2 is mutated to A or the A at position 145 is mutated to E; Plants with decreased leaf length of maize are selected.

5. The method of claim 4, wherein: The method for knocking out or inhibiting the gene as described in any one of claims 1-2 is deleting the bases at positions 291-1767 of the sequence as shown in SEQ NO.

1.

6. A method of increasing leaf blade width in maize, comprising: Overexpressing in maize a mutant protein in which the E at position 144 of the protein as shown in SEQ ID NO. 2 is mutated to A or the A at position 145 is mutated to E, or mutating the T at position 341 of the protein as shown in SEQ ID NO. 2 to A in maize; Plants with increased leaf width of maize are selected.

7. The method of claim 6, wherein: The method for overexpressing is using the maize ubiquitin promoter to drive the gene encoding the mutant protein.

8. A method of reducing leaf blade width in maize, characterized by: Knocking out or inhibiting the gene as described in any one of claims 1-2, or mutating the E at position 144 of the protein as shown in SEQ ID NO. 2 to A in maize; Plants with decreased leaf width of maize are selected.

9. A kit for reducing the length and / or width of corn leaves, characterized in that: The kit is composed of a Cas9 protein and any one of the following (1)-(3) nucleic acid molecules: (1) a gRNA molecule capable of simultaneously recognizing TTGATCGACCTGACGTGCCTG and CTGGGCCACGACGAGGCGG or their reverse complementary sequences; (2) a DNA molecule encoding the gRNA of (1); (3) a vector expressing the gRNA of (1).

10. The kit of claim 8, wherein: The sequence of the gRNA molecule is CAGGCACGUCAGGUCGAUCAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU and CUGGGCCACGACGAGGCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU.

11. A kit for increasing the length and / or width of corn leaves, characterized in that: The kit is composed of a nSpCas9 protein fused with M-MLV and any one of the following (1)-(3) nucleic acid molecules: (1) a pegRNA molecule capable of recognizing AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC or their reverse complementary sequences; (2) a DNA molecule encoding the pegRNA of (1); (3) a vector expressing the pegRNA of (1).

12. The kit of claim 11, wherein: (1) the sequence of the pegRNA molecule is CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

13. The kit of claim 11, wherein: The amino acid sequence of the nSpCas9 is shown as SEQ ID NO. 4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.

6.

14. A kit for increasing leaf length and / or decreasing leaf width in maize, characterized in that: The kit is composed of the nSpCas9 protein fused with the M-MLV and any one of the following nucleic acid molecules (1)-(3): (1) an RNA molecule capable of recognizing CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC or the reverse complementary sequence thereof; (2) a DNA molecule encoding the RNA of (1); (3) a vector expressing the RNA of (1).

15. The kit of claim 14, wherein: (1) the sequence of the RNA molecule is CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU.

16. The kit of claim 14, wherein: The amino acid sequence of the nSpCas9 is shown as SEQ ID NO. 4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO. 6.

Images