A method of constructing a transgenic mouse model expressing SARS-Cov2 structural proteins specifically in lung tissue

By inserting the Loxp-Stop-Loxp element and the tandem sequence of the SARS-Cov2 structural protein gene into the mouse genome, and combining this with the specific expression of the Cre enzyme, a transgenic mouse model that specifically expresses the SARS-Cov2 structural protein in lung tissue was constructed. This solved the problems of severe lesions and lack of specificity in expression in existing models, and achieved an efficient animal model that simulates lung injury.

CN119709862BActive Publication Date: 2025-12-12XI AN JIAOTONG UNIV
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202411830290.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-12-12
Estimated Expiration
2044-12-12

AI Technical Summary

Technical Problem

Existing SARS-CoV2 animal models suffer from problems in simulating lung damage, such as overly severe lesions that are difficult to capture and fail to accurately reproduce damage to important tissues and organs. Furthermore, the expression of SARS-CoV2 structural proteins in existing technologies lacks tissue specificity and cannot effectively simulate tissue damage after viral infection.

Method used

By inserting Loxp-Stop-Loxp elements and tandem sequences of SARS-Cov2 structural protein genes into the mouse genome using CRISPR/Cas9 technology, and combining this with specific expression of Cre enzymes, lung tissue-specific expression of SARS-Cov2 structural proteins S, E, M, and N was achieved, thus constructing a conditional expression model.

Benefits of technology

An animal model that matches the lung damage caused by human infection with SARS-CoV-2 has been developed, avoiding premature death of the model animals, improving genetic stability and simulation effectiveness, and accurately simulating interstitial pneumonia and ARDS. It is suitable for the development of antiviral drugs and vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a method for constructing a transgenic mouse model that specifically expresses SARS-Cov2 structural proteins in lung tissue. The method utilizes CRISPR / Cas9 technology to insert LSL elements and the gene sequences of SARS-Cov2 structural proteins S, E, M, and N into the mouse genome. SEMN Positive mice were mated with Cre tool mice, which have type II alveolar epithelial cells in the lungs, and LSL-SARS was preserved. SEMN Heterozygous and Cre-positive offspring were crossbred. Evaluation showed that the Cre enzyme successfully cleaved the LSL element, and with increased gene expression of various SARS-Cov2 structural proteins, the corresponding mice exhibited severe lung damage. This invention, by specifically expressing SARS-Cov2 structural proteins in mouse lung tissue, can accurately simulate lung damage following SARS-Cov2 infection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a method for constructing a mouse model, in particular to a method for constructing an animal model for simulating lung damage after SARS-Cov2 infection by using transgenic technology to conditionally express SARS-Cov2 structural proteins. BACKGROUND

[0002] The novel coronavirus (SARS-Cov2, also known as SARS-CoV-2) is the pathogen of the novel coronavirus disease, which can cause varying degrees of respiratory symptoms (such as inflammatory damage to the lungs) in infected individuals. Severe cases can develop respiratory failure, shock, and even death. In addition to respiratory symptoms, infected individuals also exhibit multiple system complications in the kidneys, cardiovascular system, nervous system, and gastrointestinal tract, which seriously affect people's life and health safety.

[0003] An ideal animal model is an important tool for elucidating the pathological mechanisms of infectious diseases, developing anti-infective drugs, and developing vaccines. Currently, animal models commonly used for SARS-Cov2 research include human angiotensin-converting enzyme (hACE2) transgenic mice infected directly by virus (see: "Construction of a Mouse Model of SARS-CoV-2 Infection and Study of Its Characteristics". Military Science and Technology University, 2024), as well as Syrian golden hamsters, ferrets, non-human primates, and others. However, due to issues such as viral load in animals, experimental costs, animal ethics, viral susceptibility, and laboratory biosafety, in vivo research on SARS-Cov2 has been constrained. In addition, the mortality rate of human infection with SARS-Cov2 in the clinic is not high, but when the above-mentioned CAG-hACE2 transgenic mice are exposed to SARS-CoV2, as the viral load increases, the mice rapidly progress to severe pneumonia, pulmonary consolidation, and exhibit high lethality, with most mice dying within 5 days (approximately 100% mortality), i.e., the transgenic mice infected with live SARS-CoV2 have a rapid disease course (and certain pathological manifestations are too severe), making it difficult to capture and reproduce the full characteristics of damage to important organs (such as the lungs).

[0004] By CRISPR / Cas9 technology and using homologous recombination repair, specific sites are integrated with Loxp-Stop-Loxp elements or floxThe transgenic mouse of the region can be applied to breeding with Cre mice of different tissue cell specificity (including drug-induced Cre) to express exogenous proteins in different tissues and organs or knock out endogenous genes, such as CN118931964A and CN114457114A. However, under the condition of not being infected with the virus, only by conditionally expressing SARS-Cov2 structural proteins in experimental animals (in order to achieve tissue-specific expression) is not directly related to the infection process of SARS-Cov2 by invading animals to cause lesions in tissues and organs in the body.

[0005] In addition, in view of the important role of SARS-Cov2 structural proteins (specifically, four proteins S, E, M and N) in the process of virus invasion into the body and the induction of tissue and organ damage after virus invasion and the inhibition of the body's anti-virus immune response, the technology of modification and expression of virus structural proteins will also be involved in the development of related vaccines and antiviral drugs, such as the fusion protein (involving N, S2 and RBD, E and M proteins) expressed by BCG strain in CN118436773A as an antigen to immunize experimental animals, and aims to improve the effectiveness of cellular and humoral immunity to high variability viruses. However, in this technology, after inserting several SARS-CoV2 antigen epitope sequences into the BCG vector to construct a plasmid vector and transfer it into bacteria, the virus antigen epitopes expressed by bacteria are used to immunize mice, and the production of antibodies against antigen epitopes and the activation of immune cells are investigated. The protein (specifically, the fusion protein) will not be expressed in the tissues and organs of mice. In CN112760297A, the full-length or different truncated coronavirus spike protein (S protein) expressed by VSV virus shell is also used to obtain a replication-defective and non-infectious pseudovirus that only expresses some S protein fragments, which can be used to simulate the invasion of coronavirus in cells through S protein (for binding with ACE2 expressed in cells) (but without the invasion of other structural proteins and viral nucleic acids). The titer of the pseudovirus can only indicate the entry of the virus into the cell (not the real infection). It can be seen that the expression experiment design of SARS-Cov2 and other related virus structural proteins usually does not involve the tissue (such as lung tissue) specific expression of virus structural proteins, nor does it involve the simulation and investigation of tissue damage after virus infection. SUMMARY

[0006] The purpose of the present application is to provide a method for constructing a transgenic mouse model for lung tissue-specific expression of SARS-Cov2 structural proteins. The present application takes mice as an example, and by expressing SARS-Cov2 structural proteins S, E, M and N in the lung tissue of mice, an animal model with high degree of correspondence with the lung damage after human infection with SARS-Cov2 is obtained.

[0007] To achieve the above object, the present application adopts the following technical solutions:

[0008] In a first aspect, a method for constructing an animal model simulating lung damage after SARS-Cov2 infection is provided, which comprises the following steps:

[0009] Preparation of a transgenic animal conditionally expressing a novel coronavirus (SARS-Cov2) structural protein, wherein the structural protein includes a spike protein (S), an envelope protein (E), a membrane protein (M), and a nucleocapsid protein (N), and the structural protein is expressed in the lung of the offspring of the transgenic animal by specific expression of Cre enzyme in the offspring, thereby obtaining an animal model simulating lung damage after SARS-Cov2 infection (i.e., without using the virus to attack animals).

[0010] Preferably, the method for constructing specifically comprises the following steps:

[0011] 1) inserting a LoxP-Stop-Loxp (LSL) element and a SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ) in sequence into the gene of an experimental mouse (specifically, a wild-type mouse), to obtain a transgenic mouse (referred to as LSL-SARS SEMN transgenic mouse) integrated with the gene fragment LSL-SARS SEMN ;

[0012] 2) mating the LSL-SARS SEMN transgenic mouse obtained in step 1 with a lung tissue-specific Cre tool mouse (for example, a mouse lung type II alveolar epithelial cell-specific Cre tool mouse Sftpc-IRES-iCre ), and mating the obtained LSL-SARS SEMN heterozygous and Cre-positive offspring (in which the LSL element inserted into the genome of the lung tissue cells, such as lung type II alveolar epithelial cells, of the female and male mice is excised by the Cre enzyme in the cells) with each other, to obtain a transgenic mouse expressing SARS-Cov2 structural protein specifically in lung tissue.

[0013] Preferably, in step 1, a CRISPR / Cas9 technology is used to insert an expression cassette containing a promoter, an LSL element, a SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ), a WPRE sequence, and a termination sequence (such as BGH polyA) into the intron region between exons 1 and 2 of the gene of the experimental mouse (specifically, a wild-type mouse) Rosa26 , i.e., an LSL element-embedded SARS-Cov2 structural protein expression cassette (containing LSL-SARS SEMN), and using the LSL element in the SARS-Cov2 structural protein expression cassette inserted into the mouse genome to block the expression of the LSL element downstream SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ).

[0014] Preferably, the homologous recombination repair is performed for the Cas9 protein binding to the target site under the guidance of the gRNA, and the double-stranded break of the genomic DNA at the target site caused by the cleavage activity of the Cas9 protein, wherein the target site is located in the intron region between the exon 1 and the exon 2 of the Rosa26 gene.

[0015] Preferably, the target site is selected from any one or both of the following DNA sequences: Rosa26

[0016] SEQ.ID.NO.1: 5'—CTAACTTCCCATGGCTTAAATGG—3'

[0017] SEQ.ID.NO.2: 5'—TTCCCATGGCTTAAATGGCATGG—3'.

[0018] Preferably, the donor vector (such as pCAG-LSL-SARS SEMN -EGFP-pA) used in the homologous recombination repair comprises, in sequence, a 1.0-1.5 kb 5' homologous arm, a CAG promoter, a Loxp element, a 5×stop sequence, a Loxp element, a Kozak sequence, a SARS-Cov2-S sequence, a P2A cleavage peptide sequence, a SARS-Cov2-E sequence, a F2A cleavage peptide sequence, a SARS-Cov2-M sequence, a T2A cleavage peptide sequence, a SARS-Cov2-N sequence, a E2A cleavage peptide sequence, a green fluorescent protein (such as EGFP) gene sequence, a TAA stop codon, a WPRE sequence, a BGH ployA, and a 1.0-1.5 kb 3' homologous arm. The 5' homologous arm is a homologous sequence of a segment of upstream DNA sequence spaced apart from the target site on the Rosa26 gene, and the 3' homologous arm is a homologous sequence of a segment of downstream DNA sequence spaced apart from the target site on the Rosa26 gene.

[0019] Preferably, the step 1 specifically comprises the following steps:

[0020] 1.1) design and prepare a gRNA targeting the corresponding intron region of the Rosa26 gene; according to the LSL element and the SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ​) and others used in relation to SARS SEMN SARS-Cov2 structural protein expression cassettes containing embedded LSL elements (which are composed of LSL-SARS) SEMN ( ) elements or sequences to construct donor vectors for homologous recombination repair;

[0021] 1.2) Cas9 mRNA, gRNA, and donor vector were simultaneously microinjected into the fertilized eggs of wild-type mice, and then the fertilized eggs were transplanted into pseudopregnant mice to obtain F0 generation mice produced by pseudopregnant mice.

[0022] 1.3) will be Rosa26 Positive F0 generation mice with SARS-Cov2 structural protein expression cassettes containing embedded LSL elements (i.e., the full-length knock-in fragment) inserted into the corresponding intron regions of the gene were mated with wild-type mice. The resulting F1 generation mice retained LSL-SARS expression. SEMN (Specifically referring to the SARS-Cov2 structural protein expression cassette containing embedded LSL elements) heterozygous transgenic mice (denoted as LSL-SARS) SEMN+ / - As a positive F1 generation mouse, it can be used to breed with the Cre tool mouse.

[0023] Preferably, step 2 specifically includes the following steps: [The text abruptly ends here, likely due to an incomplete sentence or a formatting error.] SEMN The heterozygous transgenic mice were mated with the Cre tool mice, and the offspring mice (i.e., F2 generation mice) that retained Cre positivity and contained the knock-in fragment were heterozygous transgenic mice (denoted as LSL-SARS). SEMN+ / - Cre + The retained transgenic mice were then mated with siblings. Among the offspring (F3 generation mice), homozygous transgenic mice that were Cre-positive and contained the knock-in fragment were retained (denoted as LSL-SARS). SEMN+ / + Cre + ) and Cre-positive heterozygous transgenic mice containing knock-in fragments.

[0024] The aforementioned wild-type mice do not carry the knock-in fragment and do not contain the Cre gene; therefore, they can be named LSL-SARS. SEMN- / - Cre - Named LSL-SARS SEMN+ / - Cre + The transgenic mice are LSL-SARS mice obtained through breeding. SEMN Knock-in heterozygous mice carrying the Cre gene (i.e., Cre-positive mice) should be... Rosa26 A gene containing LSL-SARS was knocked into one of its alleles. SEMNand the other allele is wild type, i.e. does not contain the knock-in fragment; named LSL-SARS SEMN+ / + Cre + The transgenic mice of LSL-SARS SEMN knock-in homozygous and carrying Cre gene, the transgenic mice should be Rosa26 knock-in homozygous and carrying Cre gene, the transgenic mice should be SEMN and the other allele is wild type, i.e. does not contain the knock-in fragment; named LSL-SARS

[0025] Preferably, the Cre enzyme of the Cre tool mouse is specifically expressed in lung type II alveolar epithelial cells, i.e. the above-mentioned excision occurs in these cells.

[0026] Preferably, the animal model simulating lung damage after SARS-Cov2 infection is a transgenic mouse of ≥8 weeks old that specifically expresses SARS-Cov2 structural proteins in lung tissue, such as the transgenic mouse LSL-SARS SEMN+ / + Cre + (8 weeks old), LSL-SARS SEMN+ / - Cre + (8 weeks old), or offspring of the transgenic mice with stable inheritance of the genotype.

[0027] In a second aspect, a preparation method of a transgenic animal conditionally expressing SARS-Cov2 structural proteins is provided, which comprises the following steps:

[0028] Inserting a gene sequence of SARS-Cov2 structural proteins and inserting Cre-Loxp system elements for expression regulation of the gene sequence into the genome of an experimental animal, thereby obtaining a transgenic animal conditionally expressing SARS-Cov2 structural proteins, wherein the structural proteins include spike protein (S), envelope protein (E), membrane protein (M) and nucleocapsid protein (N).

[0029] Preferably, the preparation method specifically comprises the following steps: inserting a Loxp-Stop-Loxp (LSL) element and a SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ) arranged in sequence into the genome of an experimental mouse (specifically a wild type mouse), thereby obtaining a transgenic mouse (referred to as LSL-SARS SEMN transgenic mouse) integrated with the gene fragment LSL-SARS SEMN , such as the above-mentioned positive F1 generation mouse.

[0030] Thirdly, the method for preparing transgenic animals that conditionally express the structural proteins of the novel coronavirus (SARS-Cov2) is applied in the construction of animal models simulating lung injury after SARS-Cov2 infection.

[0031] Preferably, the lung injury manifests as lesions associated with interstitial pneumonia, including alveolar septal thickening, inflammatory cell infiltration dominated by neutrophils, alveolar hemorrhage, and alveolar fusion. The severity of these lesions is correlated with the differences in the expression levels of various SARS-Cov2 structural proteins in the lungs of different genotype transgenic mice (e.g., the aforementioned LSL-SARS transgenic mice). SEMN+ / + Cre + The expression level in lung tissue compared to the aforementioned transgenic mouse LSL-SARS SEMN+ / - Cre + There is a certain positive correlation between the increased expression level in lung tissue and the expression level in lung tissue.

[0032] Preferably, the lesion also includes lung collapse, for example, this lesion is manifested in the aforementioned transgenic mouse LSL-SARS. SEMN+ / + Cre + The virus was present in the transgenic mice LSL-SARS, but not in the transgenic mice described above. SEMN+ / - Cre + middle.

[0033] Fourthly, the method for preparing transgenic animals that conditionally express the structural protein of the novel coronavirus (SARS-Cov2) is applied in the construction of animal models of interstitial pneumonia.

[0034] Fifthly, the method for preparing transgenic animals that conditionally express the structural protein of the novel coronavirus (SARS-CoV2) is applied in the construction of animal models of acute respiratory distress syndrome (ARDS).

[0035] The beneficial effects of this invention are reflected in:

[0036] The conditional expression of SARS-Cov2 structural proteins (specifically SARS-Cov2 S, E, M and N proteins) prepared in the application can be realized by the specific expression of Cre enzyme to realize the specific expression of each SARS-Cov2 structural protein in the lung tissue cells of the offspring, thereby simulating the lung damage caused after SARS-Cov2 infection (including the typical lesions of interstitial pneumonia, such as thickening of alveolar septum, inflammatory cell infiltration mainly with neutrophils, and alveolar hemorrhage, alveolar fusion, and lung collapse), while avoiding premature death of the model animal and achieving genetic stability, thereby meeting the economic, simple and reliable demand for animal models and their acquisition methods in the screening and pharmacodynamic evaluation of SARS-Cov2 pathogenesis and anti-viral damage drugs.

[0037] Further, the LSL element and the SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ) can be inserted into the mouse gene (such as Rosa26 gene) by using CRISPR / Cas9 technology and repairing by homologous recombination. SEMN The LSL-SARS SEMN transgenic mice are mated with specific Cre tool mice, and the LSL element inserted into the genome of the type II alveolar epithelial cells of the mouse lung is removed by the specific expression of Cre enzyme in the type II alveolar epithelial cells of the offspring, so that the SARS-Cov2 structural protein gene tandem sequence (SARS SEMN+ / + ) downstream of the element is expressed, thereby improving the genetic stability of the animal model simulating lung damage after SARS-Cov2 infection.

[0038] Further, the transgenic mice with increased expression level of SARS-Cov2 structural proteins (specifically LSL-SARS SEMN+ / + Cre + mice with higher expression level) are obtained by mating the same generation of mice with each other, and with the increase of the expression level of each SARS-Cov2 structural protein, the lung tissue of the corresponding transgenic mice shows severe lung damage.

[0039] Further, the WPRE sequence (inserted before the BGH polyA which terminates transcription and translation) and different splicing peptide sequences in the SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ) are used to connect the gene sequences of different SARS-Cov2 structural proteins, which can make the knock-in SARS-Cov2 structural protein gene tandem sequence (SARS SEMN) In the post-transcriptional stable and independent expression of each SARS-Cov2 structural protein, that is, in the lung, a transcription product produces multiple proteins (specifically S, E, M and N), provides a material basis for the differentiation of precision modeling of transgenic mice of different genotypes (and avoids mutual interference between lesions), and finally obtains the qualitative change of lung injury in the model animal (for example, transgenic mice LSL-SARS SEMN+ / + Cre + The lung tissue shows lung collapse, which is usually associated with ARDS), so as to more accurately simulate the lung damage after human infection with SARS-Cov2 in the clinic. BRIEF DESCRIPTION OF DRAWINGS

[0040] Figure 1 A schematic diagram for preparing a lung tissue-specific expression SARS-Cov2 structural protein transgenic mouse using CRISPR / Cas9 technology in the embodiments of the present application.

[0041] Figure 2 A plasmid map of a donor vector for homologous recombination repair in the embodiments of the present application.

[0042] Figure 3 A F0 generation mouse PCR identification strategy diagram for a knock-in SARS-Cov2 structural protein expression cassette embedded with an LSL element (containing LSL-SARS SEMN ) in the embodiments of the present application; wherein the primer locations and the corresponding PCR product sizes (units: bp) are indicated.

[0043] Figure 4 A F0 generation mouse PCR identification electrophoresis map obtained in the embodiments of the present application; wherein: numbers 1-9 are F0 generation mouse numbers, WT is a wild-type mouse C57BL / 6J, N is a blank control, P is a positive control (the donor vector as a template), and M is a DNA marker.

[0044] Figure 5 A genotype PCR identification strategy diagram of F1 generation mice obtained in the embodiments of the present application.

[0045] Figure 6 A genotype PCR identification electrophoresis map of F1 generation mice obtained in the embodiments of the present application; wherein: numbers 8-19 are F1 generation mouse numbers, WT is a wild-type mouse C57BL / 6J, N is a blank control, and M is a DNA marker.

[0046] Figure 7 PCR identification strategy of genotype of F3 generation mice LSL-SARS SEMN in the embodiments of the present application.

[0047] Figure 8 PCR identification strategy of Cre gene carrying situation of F3 generation mice in the embodiments of the present application.

[0048] Figure 9 PCR identification electrophoretogram of genotype and Cre gene carrying situation of F3 generation mice LSL-SARS SEMN in the embodiments of the present application; wherein: M represents DNA Marker.

[0049] Figure 10 PCR identification strategy of Cre enzyme action in lung tissue of F3 generation mice in the embodiments of the present application.

[0050] Figure 11 PCR identification electrophoretogram of Cre enzyme action in lung tissue of F3 generation mice in the embodiments of the present application; wherein: LSL-SARS SEMN+ / + Cre - is a control group mouse, and M represents DNA Marker.

[0051] Figure 12 SARS-Cov2 structural protein expression level detection results in lung tissue of F3 generation transgenic mice LSL-SARS SEMN+ / - Cre + , LSL-SARS SEMN+ / + Cre + and control group mice (LSL-SARS SEMN+ / + Cre - ) in the embodiments of the present application; wherein: (A) RT-qPCR detection results, (B) immunohistochemical staining detection results. P <0.001, P <0.0001.

[0052] Figure 13 SARS-Cov2 structural protein expression level detection results in lung tissue of F3 generation transgenic mice LSL-SARS SEMN+ / - Cre + , LSL-SARS SEMN+ / + Cre + and control group mice (LSL-SARS SEMN+ / + Cre - ) in the embodiments of the present application; wherein: (A) H&E staining detection results, (B) RT-qPCR detection results. P <0.05, P <0.001. DETAILED DESCRIPTION

[0053] The application will be further described in detail below in conjunction with the accompanying drawings and examples. The examples are only used to explain the application and are not intended to limit the scope of protection of the application.

[0054] The application uses CRISPR / Cas9 technology and Cre-Loxp system to construct a donor vector containing Loxp-Stop-Loxp (LSL) element and SARS-Cov2 structural protein gene tandem sequence (SARS SEMN , which specifically includes the gene sequences of SARS-Cov2 structural proteins S, E, M and N), to prepare a transgenic mouse that conditionally expresses SARS-Cov2 structural proteins, and to use the transgenic mouse as a parent (father or mother) to establish a mouse model that simulates lung damage induced after SARS-Cov2 infection. In the preparation of the transgenic mouse, Cas9 cuts the target site (e.g., a safe site that enables expression of an exogenous gene) in the mouse genome under the targeted guidance of gRNA, and uses the constructed donor vector to perform homologous recombination repair, thereby inserting an exogenous fragment containing LSL element and SARS-COV2 structural protein gene tandem sequence (SARS SEMN ) into the target site region, and then obtaining an F1 generation transgenic mouse that stably carries a knock-in fragment (containing LSL-SARS SEMN ), i.e., a transgenic mouse that conditionally expresses SARS-Cov2 structural proteins. The mouse can then be mated with a Cre tool mouse and obtain an F2 generation, which contains Cre positive and Cre negative mice. The mouse that carries the knock-in fragment (heterozygous) and is Cre positive is retained, i.e., LSL-SARS SEMN+ / - Cre + (F2 generation cannot obtain LSL-SARS SEMN+ / + Cre +) and Cre-negative mice were kept. In these F2 and F3 generation individuals, the individuals without Cre gene cannot express Cre enzyme (Cre-negative), so the LSL element completely blocks the expression of each SARS-COV2 structural protein gene downstream; individuals carrying the Cre gene can express Cre enzyme (Cre-positive), which recognizes the Loxp site, and then removes the LSL element upstream of each SARS-COV2 structural protein gene, thereby activating the expression of each SARS-COV2 structural protein gene. It was found through detection and evaluation that the two mice with homozygous and heterozygous knock-in fragments and Cre-positive in the F3 generation obtained by crossbreeding of the F2 generation at 8 weeks of age after birth, the SARS-COV2 structural protein was specifically expressed in lung tissue at different levels. These transgenic mice with lung tissue-specific expression of SARS-Cov2 structural proteins were then subjected to pathological analysis to determine the successful establishment of an animal model that simulates lung damage after SARS-Cov2 infection. The construction process of the animal model is described in detail as follows.

[0055] I. Preparation of transgenic mice with lung tissue-specific expression of SARS-Cov2 structural proteins

[0056] 1. For mice Rosa26 , a gene knock-in strategy was designed, and the knock-in region was selected as Rosa26 the intron region between exon 1 and exon 2 (as shown in Figure 1 ).

[0057] 2. According to the intron sequence between exon 1 and exon 2 of mouse Rosa26 , a gRNA was designed based on the CRISPR / Cas9 system, and the gRNA action site is shown in Table 1-1.

[0058] Table 1-1. gRNA action site

[0059]

[0060] The underlined bases in Table 1-1 are target sequences. The targeting sequence in the gRNA can recruit and guide the Cas9 protein to precisely cleave the target site by complementary pairing with the target sequence. Based on the sequences in Table 1-1, two sets of forward and reverse primers for gRNA were designed and synthesized, and annealed to form double strands with sticky ends. These were ligated into the gRNA backbone plasmid, and after sequencing verification, the gRNA fragment was re-amplified. After transcription and purification using a kit, two injectable gRNA single strands were obtained. Since the two target sites in Table 1-1 differ by 5 bases, after the two gRNA single strands are used simultaneously and two nicks are cleaved in the genome, the donor vector will perform homologous recombination repair on the broken genomic double strands through homologous arms. However, this repair will delete a small number of bases in the genome (the bases between the two nicks will be deleted, and the knock-in fragment will be inserted between the two nicks).

[0061] 3. In order to... Rosa26 Insertion knock-in fragment (including LSL-SARS) into the intron region between exons 1 and 2 of the gene. SEMN In vitro, a donor vector for homologous recombination repair was constructed using the pMD18-T vector (Takara, D101A). Figure 2 As shown in the figure, during the construction process, an I-CeuI restriction site was first introduced between the Hinc II and Xba I restriction recognition sites of pMD18-T, thereby using I-CeuI to obtain a linearized vector backbone to connect the knock-in fragment and the homologous arms on both sides.

[0062] Table 1-2. Homologous arm sequence information

[0063]

[0064] Table 1-3. Homologous arm sequence information

[0065]

[0066] The resulting donor vector is designated pCAG-LSL-SARS SEMN- EGFP-pA, containing the following elements or sequences arranged in order: 5' arm, CAG promoter, Loxp element, 5x stop sequence, Loxp element, Kozak sequence, SARS-Cov2-S sequence (i.e. the gene sequence of S protein), P2A cleavage peptide sequence, SARS-Cov2-E sequence (i.e. the gene sequence of E protein), F2A cleavage peptide sequence, SARS-Cov2-M sequence (i.e. the gene sequence of M protein), T2A cleavage peptide sequence, SARS-Cov2-N sequence (i.e. the gene sequence of N protein), E2A cleavage peptide sequence, EGFP gene sequence, TAA stop codon, WPRE sequence, BGH ployA and 3' arm.

[0067] 4. Cas9 mRNA, 2 gRNA single strands and donor vector were microinjected into fertilized eggs of C57BL / 6J mice (purchased in April 2023), and the surviving fertilized eggs after injection were transplanted into pseudopregnant female mice, and about 20 days later, mice were born, i.e. F0 generation mice, and the genotype of F0 generation mice was identified by PCR method (i.e. PCR was performed using extracted mouse genomic DNA as template, and positive F0 generation mice with completed knock-in were identified).

[0068] 5. After the positive F0 generation mice were sexually mature, F1 generation mice were obtained by mating the positive F0 generation mice after sexual maturity (6 weeks old) with wild-type mice (wild-type, WT), wherein the wild-type mice were C57BL / 6J mice; the genotype of F1 generation mice was identified by PCR method, and if positive mice (i.e. F1 generation heterozygotes with knock-in fragments) were born, it indicated that the knock-in LSL element and SARS SEMN has been integrated into the mouse germ cells.

[0069] The positive F1 generation mice were verified by sequencing, Rosa26 The target genomic sequence near the gene knock-in site is shown in SEQ. ID. NO. 3. The Rosa26The region identical to the 5' homologous arm sequence in the donor vector in the target genomic sequence (the full-length of which is 14770 bp) near the gene knock-in site is 434 bp~1809 bp; the CAG promoter is 1819 bp~3538 bp; the 2 Loxp elements are 3539 bp~3572 bp and 5167 bp~5200 bp; the 5xstop sequence is 3573 bp~5166 bp; the Kozak sequence is 5221 bp~5229 bp; the SARS-Cov2-S sequence is 5230 bp~9048 bp; the P2A cleavage peptide sequence is 9049 bp~9114 bp; the SARS-Cov2-E sequence is 9115 bp~9339 bp; the F2A cleavage peptide sequence is 9340 bp~9414 bp; the SARS-Cov2-M sequence is 9415 bp~10080 bp; the T2A cleavage peptide sequence is 10081 bp~10143 bp; the SARS-Cov2-N sequence is 10144 bp~11400 bp; the E2A cleavage peptide sequence is 11401 bp~11469 bp; the EGFP gene sequence is 11470 bp~12186 bp; the WPRE sequence is 12198 bp~12785 bp; the BGH ployA is 12786 bp~13017 bp; and the region identical to the 3' homologous arm sequence in the donor vector is 13018 bp~14496 bp.

[0070] 6. The F1 generation heterozygotes with the knock-in fragment are mated with specific Cre tool mice (specifically Sftpc-IRES-iCre , Jiangsu Jiquan Yekang Biotechnology Co., Ltd., purchased in September 2023) after sexual maturity (6 weeks old), and the F2 generation mice born are identified by PCR and the mice with the knock-in fragment heterozygous and Cre positive (denoted as LSL-SARS SEMN+ / - Cre + ) are reserved.

[0071] 7. The LSL-SARS SEMN+ / - Cre + mice reserved in the F2 generation are mated after sexual maturity (6 weeks old), and the F3 generation mice are obtained, which are identified by PCR and the mice with the knock-in fragment homozygous and Cre positive (denoted as LSL-SARS SEMN+ / + Cre + ) and the mice with the knock-in fragment heterozygous and Cre positive (denoted as LSL-SARS SEMN+ / - Cre + ) are reserved, i.e., transgenic mice with lung tissue-specific expression of SARS-Cov2 structural proteins are obtained.

[0072] Two, PCR identification results of mice

[0073] 2.1 PCR identification results of F0 generation mice

[0074] Genomic DNA was extracted from the tail tissue of F0 generation mice, and the knock-in of the exogenous fragment on the genome was identified by PCR amplification.

[0075] According to the PCR identification strategy in Figure 3 , first, the 5' arm homologous recombination region was amplified by PCR using primers 5'F and 5'R. A positive genome should amplify a 1558 bp fragment, and a negative genome should have no amplification fragment. The 3' arm homologous recombination region was amplified by PCR using primers 3'F and 3'R. A positive genome should amplify a 1698 bp fragment, and a negative genome should have no amplification fragment. Then, the full-length of the positive mouse knock-in fragment was amplified by PCR using primers I and II, primers III and IV, primers V and VI, primers VII and VIII, primers IX and X, and primers XI and XII, respectively. The length of the amplified fragments of the positive genome was: ① 1898 bp, ② 1916 bp, ③ 1838 bp, ④ 1967 bp, ⑤ 1810 bp, and ⑥ 1362 bp, respectively. A negative genome had no amplification fragment. The specific primers used for PCR identification are shown in Table 2.

[0076] Table 2. PCR identification primers for F0 generation mice

[0077]

[0078] The PCR identification results of F0 generation mice are shown in Figure 4 . Mice 1 to 6, 8 and 9 did not amplify the target fragments of the homologous arms, while mouse 7 could amplify the target bands of the homologous arms and also amplify the 6 target bands of fragments ① to ⑥ located within the knock-in fragment. The positive F0 generation mouse was 7 (7#).

[0079] 2.2 PCR identification results of F1 generation mice

[0080] Genomic DNA was extracted from the tail tissue of F1 generation mice, and the knock-in of the exogenous fragment on the genome was identified by PCR amplification.

[0081] According to the PCR identification strategy in Figure 5The PCR identification strategy used in this study was employed to identify F1 generation mice. The specific primers used are shown in Table 3. For PCR amplification of the 5'arm homologous recombination region using primers 5'F and 5'R, a 1558 bp fragment should be amplified in the positive genome, while no fragment should be amplified in the negative genome. For PCR amplification of the 3'arm homologous recombination region using primers 3'F and 3'R, a 1698 bp fragment should be amplified in the positive genome, while no fragment should be amplified in the negative genome. For PCR amplification of the knock-in fragment region using primers KiF and KiR, an 11.5 kb fragment should be amplified in the positive genome (which appears as no band on agarose gel electrophoresis due to its large size), while a 420 bp fragment should be amplified in the negative genome.

[0082] Table 3. Primers for PCR identification in F1 generation mice

[0083]

[0084] PCR identification results of F1 generation mice are as follows: Figure 6 As shown, mice 8, 9, 12, 14, 15, and 17 could amplify the target band of the homologous arm (and could also amplify the target band negative for the knock-in fragment region, so the genotype was determined to be knock-in heterozygous), and no knock-in homozygous F1 generation mice were observed. Information on positive F1 generation mice is shown in Table 4.

[0085] Table 4. Information on positive F1 generation mice

[0086]

[0087] 2.3 PCR identification results of F3 generation mice

[0088] Genomic DNA was extracted from the tail tissue of F3 generation mice and identified by PCR amplification.

[0089] according to Figure 7 The PCR identification strategy described in Table 5 was used to identify F3 generation mice. The specific primers used are shown in Table 5. PCR amplification was performed using primers F and R1, and primers F and R2, respectively. Wild-type mice showed only a single 420 bp band in the PCR reaction; knock-in heterozygous mice showed both 420 bp and 499 bp bands in the PCR reaction; and knock-in homozygous mice showed only a single 499 bp band in the PCR reaction (the identification of knock-in heterozygotes also applies to the F2 generation).

[0090] Table 5. F3 generation mice with LSL-SARS SEMN PCR primers for genotype identification

[0091]

[0092] At the same time, according toFigure 8 The PCR identification strategy used in this study was employed to identify Cre gene carriage in F3 generation mice. The specific primers used are shown in Table 6. PCR amplification was performed using primers Fc and Rc. Cre-positive mice showed a single 352 bp band in the PCR reaction; Cre-negative mice did not show a 352 bp band in the PCR reaction.

[0093] Table 6. Primers for PCR identification of Cre gene in F3 generation mice

[0094]

[0095] PCR identification results of F3 generation mice are as follows: Figure 9 As shown, LSL-SARS retained in the F2 generation SEMN+ / - Cre + Mice bred by sibling mating can produce LSL-SARS. SEMN- / - Cre - Wild-type mice; LSL-SARS SEMN+ / - Cre + That is, knock-in heterozygous Cre-positive mice; LSL-SARS SEMN+ / + Cre + This refers to knock-in homozygous, Cre-positive mice. Additionally, LSL-SARS mice can also be obtained. SEMN+ / + Cre - , that is, knock-in homozygous and Cre-negative mice.

[0096] III. PCR Identification and Results of Cre Enzyme Activity

[0097] Although knock-in heterozygous and Cre-positive mice may be born in the F2 generation, it is not necessary to identify the role of the Cre enzyme in their bodies (specifically, to remove the LSL element according to the working principle of the Cre-Loxp system, thereby restoring the expression cassette structure that can normally express SARS-CoV-2 S, E, M, and N proteins). After using F2 generation knock-in heterozygous and Cre-positive mice as parents for sibling mating and breeding F3 generation, further PCR testing can be used to identify whether the Cre enzyme is functional in the F3 generation mice that have been identified as knock-in homozygous (or heterozygous) and Cre-positive. Simultaneously, depending on the method used... Sftpc-IRES-iCre The study considered the specific expression characteristics of Cre enzyme in tissue cells (specifically, type II alveolar epithelial cells of the lungs) of tool mice, and took into account the difficulty of extracting type II alveolar epithelial cells of the lungs alone. Therefore, lung tissue from F3 generation mice (e.g., knock-in homozygous and Cre-positive F3 generation mice) was selected to detect the role of Cre enzyme.

[0098] The F3 generation mice which were homozygous knock-in and Cre positive (or Cre negative) were euthanized, and the lung tissues were taken for tissue DNA extraction. Then PCR identification was performed according to the identification strategy in Figure 10 , i.e. using primers Postcre-F and Postcre-R for PCR amplification. Cre worked, and a 420 bp band appeared in the PCR reaction, i.e. the LSL element in the knock-in fragment was excised in the lung tissue cells, corresponding to the genotype of LSL-SARS SEMN+ / + Cre + F3 generation mice; Cre did not work, and a 2048 bp band appeared in the PCR reaction (no 420 bp band appeared), i.e. the LSL element in the knock-in fragment was not excised, corresponding to the genotype of LSL-SARS SEMN+ / + Cre - control group mice. The specific primers used for PCR identification are shown in Table 7.

[0099] Table 7. PCR identification primers

[0100]

[0101] The identification results are shown in Figure 11 . It should be pointed out that since the mouse lung tissue contains not only type II alveolar epithelial cells but also other cells in the lung tissue, these cells do not have specific Cre enzyme, so in the identification, the LSL-SARS SEMN+ / + Cre + mice showed not only obvious 420 bp bands but also weak 2048 bp bands.

[0102] Four, model evaluation of transgenic mice with lung tissue-specific expression of SARS-Cov2 structural protein

[0103] 4.1 Detection of the expression level of SARS-Cov2 structural protein in the lung tissue of LSL-SARS SEMN+ / - Cre + , LSL-SARS SEMN+ / + Cre + mice and control group mice

[0104] The F3 generation mice with genotypes of LSL-SARS SEMN+ / - Cre + , LSL-SARS SEMN+ / + Cre + and control group mice (i.e. LSL-SARS SEMN+ / + Cre -The mice were euthanized, and the lung tissues were taken to extract RNA, and specific primers for SARS-Cov2 S protein, E protein, M protein and N protein were used for RT-qPCR detection, respectively, to analyze the expression of SARS-Cov2 structural proteins at the mRNA level. The RT-qPCR primers used are shown in Table 8.

[0105] The results are shown in Figure 12 (A). SEMN+ / + Cre - mice compared with control mice (i.e. LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN+ / + mice. Among them, the expression level of SARS-Cov2 structural proteins in the lung tissues of transgenic mice with knock-in homozygosity and Cre positivity (i.e. LSL-SARS SEMN+ / + Cre + mice) was significantly higher than that of transgenic mice with knock-in heterozygosity and Cre positivity (i.e. LSL-SARS SEMN+ / - Cre + mice).

[0106] In addition, the lung tissues of F3 generation mice with genotypes of LSL-SARS SEMN+ / + Cre - , LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN + / + Cre + were made into paraffin sections, and the expression of SARS-Cov2 structural proteins was detected by immunohistochemical staining. Since the inserted exogenous protein sequences (S, E, M and N protein gene sequences of SARS-Cov2 and the gene sequence of EGFP for tracing) are in series with a cleavage peptide, the five exogenous proteins will be transcribed and translated simultaneously. Therefore, the detection of EGFP expression can indicate the expression of the other four exogenous proteins. The results are shown in Figure 12 (B). SEMN+ / + Cre - mice compared with control mice (i.e. LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN+ / + Cre + mice. Among them, the expression level of SARS-Cov2 structural proteins in the lung tissues of transgenic mice with knock-in homozygosity and Cre positivity (i.e. LSL-SARS SEMN+ / + Cre +The expression level in mice was higher than that in LSL-SARS. SEMN+ / - Cre + Mice.

[0107] The above results indicate that the transgenic mice conditionally expressing the SARS-Cov2 structural protein can induce specific expression of the SARS-Cov2 structural protein in mouse lung tissue through the regulation of the Cre enzyme in their offspring. Furthermore, the knock-in homozygous mice carrying the Cre gene (i.e., LSL-SARS) are also capable of this expression. SEMN+ / + Cre + Mice) compared to heterozygotes (i.e., LSL-SARS) SEMN+ / - Cre + The expression intensity was higher in mice.

[0108] 4.2 Comparison of LSL-SARS SEMN+ / - Cre + LSL-SARS SEMN+ / + Cre + Lung tissue damage in mice and control mice

[0109] For F3 generation with LSL-SARS genotype SEMN+ / - Cre + LSL-SARS SEMN+ / + Cre + Mice and control mice (i.e., LSL-SARS) SEMN+ / + Cre - H&E staining was performed on paraffin sections of lung tissue from mice to analyze lung tissue damage. Results are as follows: Figure 13 As shown in (A), compared with the control group mice (i.e., LSL-SARS mice), SEMN+ / + Cre - Compared to mice, LSL-SARS SEMN+ / - Cre + Mice exhibited certain alveolar hemorrhage, alveolar epithelial cell proliferation and necrosis, alveolar capillary proliferation, alveolar septal thickening, inflammatory cell infiltration (mainly neutrophils), and alveolar fusion, while LSL-SARS... SEMN+ / + Cre + Mice exhibited more severe alveolar hemorrhage, alveolar epithelial cell proliferation and necrosis, alveolar capillary proliferation, thickening of alveolar septa, inflammatory cell infiltration, alveolar fusion, and even lung collapse. The results indicate that the lung lesions in these two Cre-positive mice are similar to those observed in clinical humans infected with SARS-CoV-2 (with more complete lesion details, easier detection, and no interference from excessive hemorrhage). Meanwhile, LSL-SARS... SEMN+ / + Cre + Lung injury in mice was more pronounced than in LSL-SARS. SEMN+ / -Cre + Mice are more typical, so knock-in homozygous and Cre-positive transgenic mice (i.e. LSL-SARS SEMN+ / + Cre + Mice) are more accurate animal models to simulate lung injury after SARS-Cov2 infection.

[0110] In addition, the expression of inflammatory factors in mouse lung tissues was analyzed by RT-qPCR (see Table 9 for RT-qPCR primers used). The results are shown in Figure 13 (B). Compared with control mice (i.e. LSL-SARS SEMN+ / + Cre - Mice), the expression of inflammatory factors IL-6 and IL-1β in the lung tissues of knock-in heterozygous and Cre-positive transgenic mice (i.e. LSL-SARS SEMN+ / - Cre + Mice) and knock-in homozygous and Cre-positive transgenic mice (i.e. LSL-SARS SEMN+ / + Cre + Mice) was significantly increased, and the expression level of inflammatory factors in the lung tissues of LSL-SARS SEMN+ / + Cre + Mice was significantly higher than that of LSL-SARS SEMN+ / - Cre + Mice. The results show that LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN+ / + Cre + Mice can simulate lung inflammatory response after SARS-Cov2 infection, and the higher the expression level of SARS-Cov2 structural protein, the more severe the lung tissue inflammatory response, i.e. the lung tissue inflammatory response of LSL-SARS SEMN+ / + Cre + Mice is more intense, which can be used as an animal model of severe lung injury caused by SARS-Cov2 infection.

[0111] Table 8. RT-qPCR primers

[0112]

[0113] Table 9. Inflammatory factor RT-qPCR primers

[0114]

[0115] Note: Actin in Table 8 is the internal reference, and is also applicable to the internal reference of inflammatory factor RT-qPCR.

[0116] Therefore, the transgenic mouse constructed above for expressing SARS-Cov2 structural protein specifically in lung tissue can be used as an animal model for simulating lung damage after SARS-Cov2 infection.

[0117] Fifth, advantages of the present application

[0118] ①Unlike the use of adenovirus or adeno-associated virus to mediate the transient expression of exogenous proteins in mice, the mouse model for simulating lung damage after SARS-Cov2 infection constructed by the present application is obtained by inserting the viral protein expression sequence into the mouse Rosa26 gene site through homologous recombination, so that the offspring mice obtained by breeding can stably carry the viral protein expression sequence. And with the increase of the expression amount of the viral protein, the lung tissue of the corresponding mouse shows light to severe lung damage performance (mainly including interstitial pneumonia, alveolar hemorrhage, alveolar septum thickening, inflammatory cell infiltration mainly with neutrophils, alveolar fusion and lung collapse).

[0119] ②The mouse model for simulating lung damage after SARS-Cov2 infection constructed by the present application can be used as an animal model for related basic diseases (such as interstitial pneumonia and ARDS) by itself or by further giving other disease inducers in mice, which enriches the animal model library for SARS-Cov2 research.

[0120] ③Since the mouse model for simulating lung damage after SARS-Cov2 infection constructed by the present application does not involve whole (live) virus infection, it is not limited to being used in a biosafety level three (P3) laboratory for research, which is convenient for researchers to use.

[0121] ④The present application will provide convenient, reliable and rich resource support for the research of SARS-Cov2, and provide protection for people to further understand the pathogenic mechanism of SARS-Cov2 and screen effective antiviral damage drugs.

Claims

1. A method for constructing an animal model simulating lung injury after SARS-Cov2 infection, characterized in that: The construction method comprises the following steps: Preparation of a transgenic animal conditionally expressing SARS-Cov2 structural proteins, wherein the structural proteins are S protein, E protein, M protein and N protein, and the structural proteins are expressed in the lung of the offspring of the transgenic animal by specific expression of Cre enzyme in vivo, to obtain an animal model simulating lung damage after SARS-Cov2 infection; The S protein, E protein, M protein and N protein are expressed in series.

2. The method according to claim 1, wherein the method for constructing an animal model of lung injury after SARS-Cov2 infection is characterized by: The construction method specifically comprises the following steps: 1) Inserting Loxp-Stop-Loxp elements and SARS-Cov2 structural protein gene tandem sequences in sequence into the wild-type mouse gene, obtaining transgenic mice integrated with gene fragments LSL-SARS SEMN ​ 2) The transgenic mice obtained in step 1 are mated with lung tissue specific Cre tool mice, and the resulting LSL-SARS SEMN heterozygous and Cre positive offspring are mated with each other to obtain transgenic mice expressing SARS-Cov2 structural proteins specifically in lung tissue.

3. The method of claim 2, wherein the method of constructing an animal model of lung injury after SARS-Cov2 infection is characterized by: In the step 1, the CRISPR / Cas9 technology is used and the wild-type mouse is repaired by homologous recombination Rosa26 The expression cassette containing a promoter, a Loxp-Stop-Loxp element, a SARS-Cov2 structural protein gene tandem sequence, a WPRE sequence and a termination sequence is inserted into the gene.

4. The method of claim 3, wherein the method is characterized by: The homologous recombination repair is performed in response to binding of a Cas9 protein to a target site under guidance of a gRNA and a double-stranded break of genomic DNA at the target site by a cleavage activity of the Cas9 protein, wherein the target site is located Rosa26 an intronic region between exon 1 and exon 2 of the gene.

5. The method of claim 4, wherein the method of constructing an animal model of lung injury after SARS-Cov2 infection is simulated, characterized by: The target site is selected from the group consisting of DNA sequences having the following Rosa26 any one or both of the genetic loci: SEQ.ID.NO.1: 5'—CTAACTTCCCATGGCTTAAATGG—3' SEQ.ID.NO.2: 5'—TTCCCATGGCTTAAATGGCATGG—3'; The donor vector used in the homologous recombination repair comprises 1.0-1.5 kb homologous arms arranged at the 5' end of the promoter and 1.0-1.5 kb homologous arms arranged at the 3' end of the termination sequence.

6. A method of producing a transgenic animal conditionally expressing SARS-Cov2 structural proteins, characterized by: The preparation method comprises the following steps: Inserting the gene sequence of SARS-Cov2 structural proteins and the Cre-Loxp system elements for expression regulation of the gene sequence into the genome of an experimental animal, to obtain a transgenic animal conditionally expressing SARS-Cov2 structural proteins, wherein the structural proteins are S protein, E protein, M protein and N protein; The S protein, E protein, M protein and N protein are expressed in series.

7. The method of claim 6, wherein the transgenic animal is prepared by the steps of: The preparation method specifically comprises the following steps: inserting a Loxp-Stop-Loxp element and a SARS-Cov2 structural protein gene tandem sequence arranged in sequence into a wild type mouse gene, to obtain a transgenic mouse integrated with a gene fragment LSL-SARS SEMN ​ 8. Use of the preparation method of the transgenic animal conditionally expressing SARS-Cov2 structural proteins according to claim 6 or 7 in the construction of an animal model simulating lung damage after SARS-Cov2 infection.

9. Use of the preparation method of the transgenic animal conditionally expressing SARS-Cov2 structural proteins according to claim 6 or 7 in the construction of an animal model of interstitial pneumonia.

10. Use of the preparation method of the transgenic animal conditionally expressing SARS-Cov2 structural proteins according to claim 6 or 7 in the construction of an animal model of acute respiratory distress syndrome.

Citation Information

Patent Citations

  • Coronavirus pseudovirus packaging system and packaging method, and application of coronavirus pseudovirus to evaluating disinfection efficacy

    CN112760297A

  • Construction method of Fars2 gene conditional knockout animal model

    CN114457114A

  • SARS-CoV-2 multi-epitope determinant recombinant live vaccine based on BCG vector and preparation method thereof

    CN118436773A

  • Construction method of transgenic mouse model for expressing plant gene OsTir1

    CN118931964A

  • Method for preparing humanized ACE2 mouse model

    CN111979273A