CALR gene mutation detection method, kit and application

Abstract

The invention relates to the field of biology, and discloses a method for detecting the mutation rate of a CALR (calreticulin) gene through qPCR based on multiple Taqman probes, the method can detect whether the CALR gene has I-type mutation or II-type mutation or not and calculate the copy number and the mutation rate of the mutant gene, and the method is the first method for detecting the mutation rate of the CALR gene through qPCR. And efficient, rapid and accurate detection and evaluation are provided for CALR mutation detection. The invention also discloses a fluorescent quantitative polymerase chain reaction system for detecting CALR gene mutation. The system comprises an upstream primer sequence, a downstream primer sequence, a universal probe sequence, a type I mutation probe sequence and a type II mutation probe sequence. The invention also discloses a reagent / kit. The invention also discloses application of the system or the kit in detection of CALR gene mutation, mutation copy number and mutation rate as well as auxiliary diagnosis of MPN typing and progress.

Description

Technical Field

[0001] The present invention belongs to the biological field and relates to a detection method, a kit and an application of a CALR gene mutation. Background Art

[0002] Myeloproliferative neoplasms (MPN) are a group of tumor diseases characterized by excessive proliferation of hematopoietic stem cells, granulocyte system, erythroid system, megakaryocyte system and mast cells. According to Dameshek's original summary of MPN, classic MPNs include: chronic myelogenous leukemia (CML), polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF); while the remaining myeloproliferative neoplasms that are different from the above four in epidemiological characteristics, clinical manifestations and laboratory characteristics are classified as non-classical MPNs. MPN patients suffer from blood stasis and increased viscosity due to excessive proliferation of blood cells, which can cause various cardiovascular and cerebrovascular diseases.

[0003] Conventional MPN diagnostic methods include blood cell count, bone marrow puncture, chromosome karyotype analysis, etc. In addition, the detection of Janus kinase 2 (JAK2) gene mutation, thrombopoietin receptor (MPL) gene mutation and calreticulin (CALR) gene mutation are molecular diagnostic criteria for MPN classification.

[0004] Studies have found that ET or PMF patients have a type I mutation with a 52bp deletion L367fs*46 (c.1092_1143del) or a type II mutation with a 5bp insertion K385fs*4 (c.1154_1155insTTGTC) in exon 9 of the CALR gene. By detecting CALR mutations, it is not only possible to classify MPNs, but also to predict the prognosis of MPNs. As a driving factor for MPNs, the mutation rate of CALR mutations is correlated with the course of the disease.

[0005] At present, there is no registered in vitro diagnostic kit for CALR gene mutation in China. Clinically, we have to try PCR-first-generation sequencing, second-generation sequencing and PCR-fragment analysis to detect the type of CALR gene mutation, but we cannot detect the mutation rate. In addition, these methods have the disadvantages of long detection time, low throughput and low sensitivity. At the same time, they are costly in manpower and material resources, prone to aerosol contamination in the laboratory, lack standardized processes, and are not suitable for large-scale clinical promotion and use. Therefore, there is currently no clinically applicable detection method and kit that can detect the type and mutation rate of CALR gene mutation. Summary of the invention

[0006] In order to overcome the above problems existing in the prior art, the present invention proposes for the first time a method based on Taqman probe real-time fluorescence quantitative PCR (Real time quantitative PCR, qPCR) to detect CALR gene mutants and CALR gene mutation rates in peripheral blood, which can innovatively realize rapid, accurate, and high-throughput clinical detection of whether the CALR gene in peripheral blood is mutated and calculate the copy number of the mutant gene, and obtain the CALR gene mutation rate to assist in the assessment of the course of MPN patients. Compared with fragment analysis and sequencing methods, the CALR gene mutation detection method provided by the present invention is applicable to clinical testing, with higher sensitivity, faster speed, high throughput, and easy-to-interpret results; and it is the first method to calculate the CALR gene mutation rate.

[0007] The present invention innovatively proposes for the first time a method for detecting the mutant type and / or mutation rate of the CALR gene by qPCR based on multiple Taqman probes. The method can detect whether the CALR gene has type I mutation or type II mutation, and / or calculate the copy number and mutation rate of the mutant gene. It is the first method to detect the mutation rate of the CALR gene using qPCR, and provides an efficient, rapid and accurate detection and evaluation for CALR mutation detection. Specifically, the mutation rate of the CALR gene can indicate the disease process and provide information support for the typing and process monitoring of MPN diseases.

[0008] Among CALR gene mutations, type I mutations and type II mutations account for 85% of CALR gene mutations, and the other more than 30 mutations account for a very low proportion and are not highly correlated with clinical diseases. Therefore, the method described in the present invention only detects type I mutations and type II mutations.

[0009] Compared with PCR-first-generation sequencing, PCR-fragment analysis, and second-generation sequencing, the qPCR described in the present invention has the following significant advantages: lower aerosol contamination risk; higher detection sensitivity than PCR-first-generation sequencing and PCR-fragment analysis, first-generation sequencing can only detect mutation sites with mutation rates higher than 20%, fragment analysis can only detect mutation sites with mutation rates higher than 10%, while qPCR can detect a mutation rate of 5%; fewer detection steps and shorter time, suitable for clinical application; low detection cost; high throughput, common clinical qPCR instruments can support 96 channels, which is larger than the throughput of commonly used instruments of other methods; high specificity, the double insurance of primers and probes can significantly improve specificity, eliminate interference caused by amplification errors, and improve data analysis efficiency; it is versatile, suitable for a variety of conventional real-time qPCR reaction platforms, and has scalability, which is conducive to clinical use and hospital promotion.

[0010] In summary, the present invention pioneered an efficient, rapid, accurate, low-cost, standardized quantitative detection method for the CALR gene, which is particularly suitable for large-scale clinical use and the first CALR mutation rate detection method suitable for clinical use. It only takes 2 hours (1 hour to process samples + 5 minutes to prepare reaction solution + 45 minutes to use the machine) to determine the mutation type and mutation rate of CALR. The targeted design of qPCR primers and probes for the CALR gene, the establishment of a matching reaction system, and the optimization of reaction conditions of the present invention are the key foundations for the rapidity and accuracy of this method.

[0011] In the present invention, the innovative features of the design of the probes and primers are:

[0012] The sequence of exon 9 of the CALR gene is special and contains multiple tandem repeat sequences. There are many difficulties in designing a quantitative mutation detection kit.

[0013] Although the type I mutation of the CALR gene has a 52 bp deletion, in fact, from the upstream sequence, the difference after the deletion is small, and the 7 bp after the deletion site is still exactly the same as the wild-type sequence. The fragment of the wild-type upstream sequence is: … ACAGGACGAGGA (Site where type I mutation occurs) GCAGAGG CTTAA… (the underlined part is where the sequence is identical); the upstream sequence fragment of the type I mutation of the CALR gene is: …ACAGGACGAGGA (52bp deletion) GCAGAGG ACAAG… The position of type II mutation is 11 bp after type I mutation sequence. The upstream sequence of wild type is: …AGGAGGAG GCAGAGGACAA (Site where type II mutation occurs) GGAGG… ; The upstream sequence fragment of the type II mutation of the CALR gene is: ...AGGAGGAG GCAGAGGACAA (TTGTC) GGAGG… , but the sequence of type I mutation also has a similar fragment, which is: ...GACGAGGA (52bp deletion) GCAGAGGACAA (Type II mutation site) GGAGG… Therefore, it is very difficult to design Taqman probes for these two mutation sites of the CALR gene, and there are few methods for designing Taqman probes for mutation sites to type the CALR gene at home and abroad.

[0014] Specifically, the nucleotide sequences of the fragments of the wild-type upstream sequence, the upstream sequence of the type I mutation of the CALR gene, and the upstream sequence of the type II mutation of the CALR gene are shown in SEQ ID NOs. 23-25.

[0015] The nucleotide sequence of the fragment of the wild-type upstream sequence (fragment of T1) is SEQ ID NO.23:

[0016] GAGACGTGGGGCGTAACAAAGGTGAGGCCTGGTCCTGGTCCTGATGTCGGGGGCGGGCAGGGCTGGCAGGGGGCAAGGCCCTGAGGTGTGTGCTCTGCCTGCAGGCAGCAGAGAAACAAATGAAGGACAAACAGGACGAGGAGCAGAGGCTTAAG GAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGGACAAGGAGGATGATGAGGACAAAGATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGCCAGGCCAAGGACGAGCTGTAGAGAGG.

[0017] The nucleotide sequence of the upstream sequence fragment of the type I mutation of the CALR gene (fragment of T2) is SEQ ID NO.24:

[0018] GAGACGTGGGGCGTAACAAAGGTGAGGCCTGGTCCTGGTCCTGATGTCGGGGGCGGGCAGGGCTGGCAGGGGGCAAGGCCCTGAGGTGTGTGCTCTGCCTGCAGGCAGCAGAGAAACAAATGAAGGAG AACAGGACGAGGAGCAGAGGACAAGGAGGATGATGAGGACAAAGATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGCCAGGCCAAGGACGAGCTGTAGAGAGG.

[0019] The nucleotide sequence of the upstream sequence fragment of the type II mutation of the CALR gene (fragment of T3) is SEQ ID NO.25:

[0020] GAGACGTGGGGCGTAACAAAGGTGAGGCCTGGTCCTGGTCCTGATGTCGGGGGCGGGCAGGGCTGGCAGGGGGCAAGGCCCTGAGGTGTGTGCTCTGCCTGCAGGCAGCAGAGAAACAAATGAAGGAG AACAGGACGAGGAGCAGAGGACAAGGAGGATGATGAGGACAAAGATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGCCAGGCCAAGGACGAGCTGTAGAGAGG.

[0021] In order to solve these difficulties, in addition to the general design ideas of the probe, the present invention takes into account the particularity of the CALR gene mutation sequence and designs the primers and probes in a targeted manner:

[0022] By design, potential non-specific positions are reduced, and two mutation probes can distinguish one mutation from another. In the downstream sequence, the wild type and type I mutation of the CALR gene have a difference of 5 bp before the deletion site, which is 2 bp less than the upstream sequence. Therefore, CALR-P1 (type I mutation probe of the CALR gene) is designed on the downstream sequence to maximize the specificity of CALR-P1 and cross the difference site between the wild type and type II mutation templates of the CALR gene, reducing the possibility of hybridization between CALR-P1 and the type II mutation template of the CALR gene. However, due to the limited design space, CALR-P1 still has 12 bp complementary to the wild type template starting from the 5' end, so strict reaction conditions and reaction systems must be established.

[0023] CALR-P2 (type II mutation probe of CALR gene) is also designed on the downstream sequence. Starting from the third base from the 5' end, there are 5 bp that can distinguish between the wild-type template and the type II mutation template, effectively improving the probe specificity; and CALR-P2 passes through the differential sites of the wild-type and type I mutation templates of the CALR gene, reducing the nonspecific signals generated by CALR-P2 and the type I mutation templates of the CALR gene.

[0024] During the design, the 5' end of CALR-P1 and CALR-P2 was purposely made to start with "CC". When the probe hybridizes with the template, two CG complementary pairs are formed, so that the probe is tightly bound to the template at the 5' end, which improves the cutting efficiency of the Taq enzyme, improves the specificity and hybridization efficiency, and ensures the cutting efficiency and improves the accuracy of quantification. In addition, the length and Tm value were carefully considered. In addition to ensuring the cutting efficiency and specificity, the distance between the fluorescent group and the quenching group was also ensured. The fluorescent signal of the probe was stable, which ensured the accuracy of quantification.

[0025] In order to accurately quantify the mutation rate, CALR-PG (the universal probe of the CALR gene) is designed at a conserved position near the 5' end of the downstream sequence. The Taq enzyme first cuts CALR-PG from the 5' end, and then cuts CALR-P1 or CALR-P2, ensuring that the universal probe and the mutant probe are hydrolyzed synchronously, that is, the release of the fluorescent group of each mutant probe is accompanied by the release of the fluorescent group of a universal probe, which is the key design of the present invention to achieve accurate quantification.

[0026] The present invention rationally and ingeniously designs highly specific primers and probes for the complex CALR gene sequence, which is the key to achieving a highly accurate and precise quantitative mutation rate.

[0027] Regarding the difficulty: the amplification efficiency of the three templates and the hydrolysis efficiency of the three probes should be close.

[0028] Differences in amplification efficiency of different templates and hydrolysis efficiency of different probes can lead to deviations in the calculated results of mutation rates.

[0029] In view of the difficulties, the present invention has carried out targeted design of product length, reaction system and reaction conditions:

[0030] The amplification lengths of the wild-type, type I mutation, and type II mutation templates of the CALR gene were designed to be 253 bp, 201 bp, and 258 bp, respectively. The length difference among the three was less than 20%, which reduced the impact of the amplification efficiency caused by the difference in the length of the amplification products.

[0031] When setting the reaction conditions, allow sufficient extension time to allow each amplification product to be fully extended.

[0032] Subsequently, according to the test results, the primer and probe sequences and input amounts were adjusted to make the amplification efficiency of the three templates and the efficiency of probe hydrolysis close to the same. The results are as shown in Examples 2, Figure 2 , Figure 3 shown.

[0033] Difficulty: High specificity of the reaction is required to ensure the accuracy of the quantitative results.

[0034] Nonspecific signals will affect the Ct value and the calculated results of the mutation rate, so high specificity of the reaction is required.

[0035] In view of the difficulties, the present invention has made targeted adjustments:

[0036] CALR-P1 is limited by the particularity of the CALR gene (a large number of repeated fragments), and there are still 12bp at the 5' end that can hybridize with the wild-type template, which will cause the appearance of non-specific signals of CALR-P1 to the wild-type template in the test. In this regard, by adjusting the ion concentration, enzyme, reaction conditions and other factors of the reaction system, the final reaction system and condition results with good specificity described in the present invention were established. Among them, the reaction conditions are particularly important. According to the designed probe annealing temperature and the ion concentration of the reaction system, a two-step method and an annealing extension temperature of 61°C were selected. Under this condition, the specificity and amplification efficiency of qPCR can be taken into account. If the annealing temperature is low (60°C), non-specific signals will appear, and a high annealing temperature (62°C) will significantly inhibit the amplification efficiency.

[0037] In summary, the present invention overcame multiple difficulties in developing primers and probes for quantitative detection of CALR gene mutations by single-well triple fluorescence quantitative PCR, and ultimately proposed for the first time highly specific primers and probes suitable for the technical scheme described in the present invention, achieving technical effects beyond expectations and possessing significant creativity and novelty.

[0038] Table-1 Methodology comparison table

[0039] qPCR PCR-Next Generation Sequencing Next-generation sequencing PCR-fragment analysis Mutation detection limit <5％ >20％ <1％ <10％ Aerosol pollution risk Low Higher Higher Higher Total detection time <2 hours >1 day 7-14 days >5 hours cost <10 yuan >30 yuan ≥1800 yuan >30 yuan Flux 96 / 384 96 / 384 2 / 4 4-96 Can you report mutation rates? able cannot cannot cannot

[0040] Specifically, the method for detecting the mutant type and / or mutation rate of the CALR gene by qPCR based on multiple Taqman probes of the present invention comprises the following steps:

[0041] 1) Sample DNA extraction: A commercial whole blood genome extraction kit can be used.

[0042] 2) qPCR amplification: The qPCR reaction system is configured according to the qPCR operation process, and amplified and detected according to total denaturation, cycles (denaturation, annealing and extension) on a fluorescent PCR instrument with a detection channel matching the probe.

[0043] Wherein, the qPCR reaction system is: 5-15 μL 2×qPCR Mix premix, upstream primer final concentration 50-500nM, downstream primer final concentration 50-500nM, universal probe final concentration 25-400nM, type I mutation probe final concentration 25-800nM, type II mutation probe final concentration 10-200nM, gDNA template 1-5 μL obtained after whole blood extraction. Preferably, the qPCR reaction system is: 7.5 μL 2×qPCR Mix premix, upstream primer final concentration 400nM, downstream primer final concentration 400nM, universal probe final concentration 200nM, type I mutation probe final concentration 500nM, type II mutation probe final concentration 50nM, gDNA template 5 μL obtained after whole blood extraction.

[0044] The qPCR Mix premix includes Hot-start Taq polymerase, dNTPs, Mg 2+ , dUTP, UNG enzyme, including Hot-start Taq polymerase 50-400U / mL, dNTPs 0.05-2mmol / L, Mg 2+ 1-10mmol / L, dUTP 0.01-0.2mmol / L (the ratio of dUTP and dNTP in dTTP is 1:3), UNG enzyme 5-40U / mL, Tris 1-20mmol / L, K + 10-100mmol / L, glycerol 1-20%, TritonX-10000.01-0.5%. Preferably, the qPCR Mix premix includes Hot-start Taq polymerase 400U / mL, dATP, dCTP, dGTP 0.2mmol / L, dTTP 0.15mmol / L, dUTP 0.05mmol / L, Mg 2+ 8mmol / L, UNG enzyme 20U / mL, Tris 10mmol / L, K + 50mmol / L, glycerol 5%, TritonX-1000.1%.

[0045] Wherein, in the qPCR amplification, the annealing temperature is 56-64°C, the length of the PCR amplified fragment is 150-300bp; the concentration range of the amplified genomic DNA is 20-150ng; preferably, the annealing temperature is 61°C, the length of the PCR amplified fragment is 201-258bp; the concentration of the amplified genomic DNA is 50ng.

[0046] The following universal amplification primers were designed based on the type I mutation and type II mutation regions of CALR gene exon 9. The CALR gene deletion region is L367fs*46 (c.1092_1143del) and the CALR gene insertion region is K385fs*4 (c.1154_1155insTTGTC).

[0047] Upstream primer CALR-F: AGGCAGCAGAGAAACAAATG (SEQ ID NO. 1);

[0048] Downstream primer CALR-R: CCTCTCTACAGCTCGTCCTT (SEQ ID NO. 2);

[0049] The following three specific fluorescent probes were designed based on the type I and type II mutation regions of exon 9 of the CALR gene to accurately determine whether the CALR gene sequence exists and detect whether it contains type I and type II mutations.

[0050] The specific fluorescent probes are:

[0051] Universal probe CALR-PG: TCCTCCTCATCTTCCTCCTTGT (SEQ ID NO. 3), used to detect the CALR gene;

[0052] Type I mutation probe CALR-P1: CCTTGTCCTCTGCTCCTCG (SEQ ID NO. 4), used to detect type I mutations in the CALR gene;

[0053] Type II mutation probe CALR-P2: CCGACAATTGTCCTCTGCCT (SEQ ID NO. 5), used to detect type II mutation of CALR gene.

[0054] The above primers and probes are proposed for the first time by the present invention.

[0055] 3) Result analysis and judgment: According to the Ct value detected in each channel of each sample, its gene type is determined by the specific probe labeling group. The Ct value of the wild-type probe fluorescence channel can determine the presence of the CALR gene, the Ct value of the type I probe fluorescence channel can determine the presence of the CALR gene with type I mutation, and the Ct value of the type II probe fluorescence channel can determine the presence of the CALR gene with type II mutation. Furthermore, the proportion of mutations can be determined by the Ct value.

[0056] The present invention also provides a method for standardized detection of mutant gene copy number and mutation rate. The calculation formula shown below is established by testing standard products and calculating and verifying. The formula can accurately, conveniently and quickly calculate the mutant copy number and mutation rate:

[0057]

[0058]

[0059] Among them, Ct(type I) represents the Ct value read from the fluorescence channel of the type I probe; Ct(wild type) represents the Ct value read from the fluorescence channel of the wild type probe; Ct(type II) represents the Ct value read from the fluorescence channel of the type II probe; B1 and B2 represent the constants in the formulas related to type I and type II mutations, respectively, ranging from 35.00 to 45.00. D1 and D2 represent the constants related to the wild type when calculating type I and type II mutations, respectively, ranging from 35.00 to 45.00. A1 and A2 represent the constants in the formulas related to type I and type II mutations, respectively, ranging from 3.200 to 3.600. C1 and C2 represent the constants related to the wild type when calculating type I and type II mutations, respectively, ranging from 3.200 to 3.600. Preferably, B1=42.83, B2=39.81, D1=42.54, D2=42.50, A1=3.489, A2=3.438, C1=3.326, C2=3.378.

[0060] After determining the genotype, the obtained Ct value is substituted into the formula to calculate the corresponding mutation copy number and mutation rate. The data analysis can be completed and the test report can be issued after the amplification program is completed, which is not affected by the subjective influence of the experimenter.

[0061] Through the above method, the CALR gene mutation copy number and mutation rate of a single-tube test sample can be achieved, providing a rapid, high-throughput, and standardized method for clinical detection of CALR gene mutation copy number and mutation rate.

[0062] The present invention also provides a fluorescent quantitative polymerase chain reaction system for detecting CALR gene mutations, wherein the reaction system comprises an upstream primer, a downstream primer, a universal probe, a type I mutation probe, a type II mutation probe, and the like.

[0063] The nucleotide sequence of the upstream primer CALR-F of the system is shown as SEQ ID NO.1 and the nucleotide sequence of the downstream primer CALR-R is shown as SEQ ID NO.2, or nucleic acid sequences with equivalent functions formed by replacing, deleting or adding one or more nucleic acid bases in the above sequences;

[0064] The nucleotide sequence of the universal probe CALR-PG of the system is shown as SEQ ID NO.3, the nucleotide sequence of the type I mutation probe CALR-P1 is shown as SEQ ID NO.4, the nucleotide sequence of the type II mutation probe CALR-P2 is shown as SEQ ID NO.5, or nucleic acid sequences with equivalent functions formed by replacing, deleting or adding one or more nucleic acid bases in the above sequences.

[0065] Furthermore, the fluorescent quantitative polymerase chain reaction system also includes Taq DNA polymerase, polymerase chain reaction buffer, deoxyribonucleoside triphosphates (dNTPs), uracil-N-glycosylase (UNG enzyme), deoxyuridine triphosphate (dUTP), etc.

[0066] The present invention also provides a kit for implementing the detection method of the present invention, which comprises an upstream primer, a downstream primer, a universal probe, a type I mutation probe, a type II mutation probe, etc. The present invention utilizes the MPN-specific mutation in the coding region of the CALR gene to prepare a diagnostic reagent for MPN. In real-time fluorescence quantitative PCR, the universal primers for the type I mutation and type II mutation regions of the 9th exon of the CALR gene and three specific Taqman probes for the conservative region, the deletion region, and the insertion mutation region are used to detect the presence, deletion or insertion of the CALR gene, and the mutation rate of the CALR gene can be obtained.

[0067] Furthermore, the kit also includes one or more of a PCR reaction solution, a positive quality control product, a wild-type quality control product, a blank quality control product, a nucleic acid extraction kit, and the like.

[0068] Wherein, the PCR reaction solution includes dNTPs, Mg 2+ , Hot-start Taq polymerase, dUTP, UNG enzyme, etc.

[0069] Wherein, the positive quality control product includes one or more of wild-type, type I mutant, type II mutant calreticulin gene DNA and the like.

[0070] Wherein, the wild-type quality control product includes wild-type calreticulin gene DNA and the like.

[0071] Wherein, the blank quality control product includes ddH2O and the like.

[0072] The kit of the present invention is used for in vitro quantitative detection of whether the 9th exon of the calreticulin (CALR) gene is deleted, and detects L367fs*46 (c.1179-1230del) type I deletion mutation and K385fs*4 (c.1234-1235insTTGTC) type II insertion mutation. It is suitable for genomic DNA extracted from peripheral blood to detect mutations, mutation copy numbers and mutation rates of the CALR gene as an auxiliary diagnosis for MPN typing and progression.

[0073] The principle of the kit of the present invention is as follows:

[0074] In a specific embodiment, the kit of the present invention adopts a qPCR method based on a Taqman probe, and uses a Hot-start Taq enzyme for PCR amplification. During the annealing extension phase of the PCR process, the Cy5-labeled CALR-PG probe will hybridize with the CALR gene fragment, the FAM-labeled CALR-P1 probe will hybridize with the CALR gene with type I mutation, and the Texas Red-labeled CALR-P2 probe will hybridize with the CALR gene with type II mutation; at the same time, when the Taq enzyme extends from the primer along the template, it will hydrolyze the hybridized Taqman probe, causing the probe to release the fluorescent group, causing the fluorescence signal to change. The genotype can be determined by the change in the fluorescence signal of different channels, and the gene mutation copy number and mutation rate can be calculated based on the results of the standard test when the kit is developed.

[0075] In a specific embodiment, the kit of the present invention is composed of the following:

[0076] The main components of the test kit (96 servings) are shown in Table 2 below:

[0077] Table-2 Composition of the kit

[0078]

[0079] The method of using the kit of the present invention is:

[0080] The reaction system is: the volume ratio of PCR reaction solution I to PCR reaction solution II is 1:(2-4), the volume of reaction solution I is 1-5 μL, the volume of reaction solution II is 2-20 μL, and the sample DNA to be tested is 1-5 μL. The reaction conditions are: total denaturation at 94-95°C for 1-10 minutes, 30-50 cycles (94-95°C for 3-30 seconds, 56°C-64°C for 30-60 seconds).

[0081] Preferably, the reaction system is: 2.5 μL of PCR reaction solution I, 7.5 μL of PCR reaction solution II, and 5 μL of the sample DNA to be tested. The reaction conditions are: total denaturation at 95°C for 5 minutes, 40 cycles (95°C for 3 seconds, 61°C for 30 seconds).

[0082] Determination of test results

[0083] According to Table 3, the sample test results were judged and the sample genotype was determined.

[0084] Table-3 Test result judgment table

[0085]

[0086] Product performance indicators

[0087] 1) Minimum detection limit: no more than 1000 CALR gene copies per reaction.

[0088] 2) Mutation detection rate: The mutation rate of each reaction is no higher than 5%.

[0089] 3) Specificity: Use PCR reaction solution to detect wild-type and mutant positive references, and the test results should be the corresponding genotypes.

[0090] 4) Repeatability: Use the PCR reaction solution to detect type I mutation and type II mutation repeatability reference products for 10 times. The results should all be the corresponding type I mutation and type II mutation, and the coefficient of variation of the Ct value should not be greater than 5.0%.

[0091] The present invention also proposes a primer pair, which includes an upstream primer CALR-F and a downstream primer CALR-R, wherein the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.2, or the above sequences are replaced, deleted or added with one or more nucleic acid bases to form a nucleic acid sequence with equivalent function.

[0092] The present invention also proposes a probe group, which includes a universal probe CALR-PG, a type I mutation probe CALR-P1, and a type II mutation probe CALR-P2, wherein the nucleotide sequence of the universal probe is shown in SEQ ID NO.3, the nucleotide sequence of the type I mutation probe is shown in SEQ ID NO.4, the nucleotide sequence of the type II mutation probe is shown in SEQ ID NO.5, or nucleic acid sequences with equivalent functions formed by replacing, deleting or adding one or more nucleic acid bases in the above sequences.

[0093] Specifically, the 5' end of the probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group.

[0094] Wherein, the fluorescent reporter group includes any one of FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, Cy5, etc.; and / or, the fluorescent quencher group includes any one of BHQ1, BHQ2, BHQ3, etc.

[0095] The present invention also proposes the use of the method as described above, or the reaction system as described above, or the kit as described above, or the primer pair as described above, or the probe group as described above in detecting CALR gene mutant type, mutant copy number and mutation rate, as an auxiliary diagnosis for MPN typing and progression, etc.

[0096] The present invention also proposes the use of the method as described above, or the reaction system as described above, or the kit as described above, or the primer pair as described above, or the probe group as described above in the preparation of CALR gene mutant type, mutation copy number and mutation rate detection reagents.

[0097] The present invention also proposes the use of the above-mentioned method, or the above-mentioned reaction system, or the above-mentioned kit, or the above-mentioned primer pair, or the above-mentioned probe group in the preparation of drugs for preventing / diagnosing / treating diseases related to CALR gene mutations, etc.

[0098] The present invention also proposes the use of the above-mentioned method, or the above-mentioned reaction system, or the above-mentioned kit, or the above-mentioned primer pair, or the above-mentioned probe group in the prevention / diagnosis / treatment of diseases related to CALR gene mutations, etc.

[0099] The present invention also provides the above-mentioned method, reaction system, kit, primer pair, probe set, and application, wherein the type I mutation of the calreticulin gene is a 52 bp deletion L367fs*46 in the 9th exon of the calreticulin gene, i.e., c.1092_1143del; and / or,

[0100] The type II mutation of the calreticulin gene is a 5 bp insertion of K385fs*4 in the 9th exon of the calreticulin gene, i.e., c.1154_1155insTTGTC; and / or,

[0101] The mutation rate of the calreticulin gene can indicate the disease progression, providing information support for the typing and progression monitoring of MPN diseases; and / or,

[0102] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; and / or,

[0103] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; and / or,

[0104] The nucleotide sequence of the universal probe is shown in SEQ ID NO.3; and / or,

[0105] The nucleotide sequence of the type I mutation probe is shown in SEQ ID NO.4; and / or,

[0106] The nucleotide sequence of the type II mutation probe is shown in SEQ ID NO.5; and / or,

[0107] The 5' end of the probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group; wherein the fluorescent reporter group includes any one of FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, Cy5, etc.; and / or the fluorescent quencher group includes any one of BHQ1, BHQ2, BHQ3, etc.

[0108] Furthermore, the application includes typing of CALR gene: using the reaction system and the kit of the present invention, the genotyping of clinical samples can be performed within two hours.

[0109] Furthermore, the application includes calculation of the mutant copy number and mutation rate of the CALR gene: the reaction system and the kit of the present invention also provide a method for calculating the copy number and mutation rate of two mutations, which can quickly, high-throughput and standardizedly detect the copy number and mutation rate of mutant genes in clinical samples.

[0110] Furthermore, the application includes using the reaction system and the kit of the present invention to type clinical samples and calculate the mutant copy number and mutation rate of the CALR gene, which can be used to evaluate the disease progression of MPN patients.

[0111] The beneficial effects of the present invention include: for the first time, a new method is proposed to detect the CALR genotype using a single qPCR tube, and obtain its copy number and mutation rate, see Example 4 of the present invention for details. The detection time is only 2 hours. The existing technology requires pre-processing of blood samples and extraction of DNA, which takes about 1 hour. On this basis, the present invention can simultaneously complete amplification and detection within one hour to obtain results. However, both PCR-first-generation sequencing and PCR-fragment analysis require PCR amplification and then detection with other instruments, which has many steps. In addition to the 1 hour of amplification, at least an additional 1 hour of detection is required. The second-generation sequencing requires steps such as library construction, sequencing, bioinformatics analysis, and report interpretation, which usually takes one week. The present invention can obtain the copy number and mutation rate of the CALR gene, providing the first rapid, high-throughput, standardized and clinically applicable CALR gene quantitative detection method. The detection limit of the detection method described in the present invention is as low as 5%, and the copy number and mutation rate of the mutant gene can be calculated. However, the detection limit of PCR-first-generation sequencing and PCR-fragment analysis in the prior art is about 15-20%, and the detection sensitivity is significantly lower than that of the method described in the present invention. In addition, PCR-first-generation sequencing and PCR-fragment analysis cannot calculate the copy number and mutation rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0112] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0113] Figure 1 :Part of the performance test of the kit in Example 2 of the present invention: A, B, and C are respectively the amplification curves when the wild-type, type I mutation (deletion type), and type II mutation (insertion type) positive standards with less than 1000 copies are used as templates; D, E, and F are respectively the amplification curves when the total number of templates is about 7×10 4 When the number of copies was 1, the amplification curves of the positive standards of 97.67% wild type and 2.33% type I mutation, 96.11% wild type and 3.89% type II mutation, and 93.64% wild type, 2.36% type I mutation, and 4.00% type II mutation were used as templates; G, H, and I are the amplification curves of the wild type positive standard, type I mutation positive standard, and type II mutation positive standard at different concentrations, respectively.

[0114] Figure 2: The positive standard amplification efficiency curve in Example 2 of the present invention: wherein A is the wild-type positive standard amplification efficiency curve; B is the type I mutation positive standard amplification efficiency curve; C is the type II mutation positive standard amplification efficiency curve; D is the mixed positive standard amplification efficiency curve.

[0115] Figure 3 : Amplification efficiency curves obtained by simulating different CALR gene mutation rates using the wild-type plasmid and mutant positive standards in Example 2 of the present invention: wherein A is the amplification efficiency curve of the wild-type and type I mutation positive standards simulating CALR gene type I mutation, and B is the amplification efficiency curve of the wild-type and type II mutation positive standards simulating CALR gene type II mutation.

[0116] Figure 4 : The kit described in Example 3 of the present invention and next-generation sequencing (NGS) respectively detect the genotype and mutation rate of clinical samples.

[0117] Figure 5 : The test results of the kit of the present invention on 6 standards in Example 4 of the present invention: A is the test result of the wild-type template standard; B is the test result of the Type I mutant template standard; C is the test result of the Type II mutant template standard; D is the test result of the Type 3 template standard; E is the test result of the Type 4 template standard; F is the test result of the Type 10 template standard.

[0118] Figure 6 : The test results of 6 standards by the method described in comparative document 1 in Example 4 of the present invention: A is the test result of the wild-type template standard; B is the test result of the Type I mutant template standard; C is the test result of the Type II mutant template standard; D is the test result of the Type 3 template standard; E is the test result of the Type 4 template standard; F is the test result of the Type 10 template standard.

[0119] Figure 7 : The test results of 6 standards by the method described in comparative document 2 in Example 4 of the present invention: A is the test result of the wild-type template standard; B is the test result of the Type I mutant template standard; C is the test result of the Type II mutant template standard; D is the test result of the Type 3 template standard; E is the test result of the Type 4 template standard; F is the test result of the Type 10 template standard.

[0120] Figure 8: The test results of 6 standards by the method described in comparative document 3 in Example 4 of the present invention: A is the test result of the wild-type template standard; B is the test result of the Type I mutant template standard; C is the test result of the Type II mutant template standard; D is the test result of the Type 3 template standard; E is the test result of the Type 4 template standard; F is the test result of the Type 10 template standard. DETAILED DESCRIPTION

[0121] The present invention is further described in detail in conjunction with the following specific examples and drawings / tables, and the protection content of the present invention is not limited to the following examples. Without departing from the spirit and scope of the inventive concept, the changes and advantages that can be thought of by those skilled in the art are included in the present invention, and the process, conditions, reagents, experimental methods, etc. of implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention has no special restrictions.

[0122] The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present invention and its application or use. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0123] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limiting. Therefore, other examples of the exemplary embodiments may have different values.

[0124] The present invention relates to the biological field, and discloses a method for detecting the mutation rate of the CALR gene by qPCR based on multiple Taqman probes. The method can detect whether the CALR gene has type I mutation or type II mutation, and calculate the copy number and mutation rate of the mutant gene. It is the first method for detecting the mutation rate of the CALR gene using qPCR, and provides efficient, rapid and accurate detection and evaluation for CALR mutation detection. The present invention also discloses a fluorescent quantitative polymerase chain reaction system for detecting CALR gene mutations, and the system includes an upstream primer sequence, a downstream primer sequence, a universal probe sequence, a type I mutation probe sequence, and a type II mutation probe sequence. The present invention also discloses a kit. The present invention also discloses the use of the system or the kit in detecting CALR gene mutations, mutation copy number and mutation rate, and as an auxiliary diagnosis for MPN typing and progression.

[0125] Unless otherwise specified, the test materials used in the examples are all conventional biochemical reagents.

[0126] Example 1: Preparation and absolute quantification of CALR genotype standards.

[0127] 1.1 Preparation of standard positive plasmids for each CALR genotype

[0128] The sequences of the present invention are derived from NCBI, wherein the sequences of the wild genotype are derived from the CALR gene entry (Gene ID: 811), Type I mutation (Allele ID: 102915), and Type II mutation (Allele ID: 1018499).

[0129] The present invention commissioned General Biotechnology (Anhui) Co., Ltd. to synthesize the above sequence, named the wild-type gene plasmid T1, the type I mutant gene plasmid T2, the type II mutant gene plasmid T3, and cloned the gene fragments into the commonly used pGEM-T Easy vector.

[0130] After calculation, the present invention adds 100 μL of water to dissolve the plasmid powder. At this time, the plasmid is about 10 10 The three plasmid solutions were diluted step by step to 10 4 The number of copies / μL is reserved.

[0131] 1.2 Absolute quantification of positive plasmids

[0132] The present invention takes 10 of three plasmids 5 copies / μL and 10 4 The two concentrations of plasmid were quantified using digital PCR. The primers used were the universal amplification primers of the present invention, which were:

[0133] Upstream primer CALR-F: AGGCAGCAGAGAAACAAATG (SEQ ID NO. 1);

[0134] Downstream primer CALR-R: CCTCTCTACAGCTCGTCCTT (SEQ ID NO. 2);

[0135] The specific detection fluorescent probe used in the present invention is:

[0136] The universal probe CALR-PG2 of the present invention: (FAM)TCCTCCTCATCTTCCTCCTTGT (BHQ1) (SEQ ID NO. 3).

[0137] The machine used in the present invention is Bio-rad QX200 digital PCR. The experimental method is the same as the conventional QX200 probe method digital PCR.

[0138] The present invention confirms that the actual initial copy number concentrations of the above three plasmids are:

[0139] T1 1.4471405×10 10 copies / μL

[0140] T2 0.6559091×10 10 copies / μL

[0141] T3 1.1137632×10 10 copies / μL

[0142] Example 2: CALR gene mutation detection kit

[0143] 2.1 Development and optimization of test kits

[0144] 2.1.1 Implementation methods

[0145] In this method, the detection method of the present invention is used to perform qPCR tests on each positive standard to preliminarily verify the feasibility of this method.

[0146] The real-time fluorescence quantitative PCR reaction system is:

[0147] 7.5 μL 2×qPCR Mix premix, upstream primer final concentration 300 nM, downstream primer final concentration 300 nM, universal probe final concentration 100 nM, type I mutation probe final concentration 100 nM, type II mutation probe final concentration 100 nM, 5 μL of the diluted plasmid in Example 1 of the present invention.

[0148] Upstream primer CALR-F: AGGCAGCAGAGAAACAAATG (SEQ ID NO. 1);

[0149] Downstream primer CALR-R: CCTCTCTACAGCTCGTCCTT (SEQ ID NO. 2);

[0150] Universal probe CALR-PG2: (FAM)TCCTCCTCATCTTCCTCCTTGT (BHQ1) (SEQ ID NO. 3);

[0151] The type I mutation probe sequence is: CCTTGTCCTCTGCTCCTCG (CALR-P1) (SEQ ID NO. 4);

[0152] The type II mutation probe sequence is: CCGACAATTGTCCTCTGCCT (CALR-P2) (SEQ ID NO. 5);

[0153] The reaction conditions were: total denaturation at 95°C for 5 minutes, and 40 cycles (95°C for 3 seconds, 62°C for 30 seconds).

[0154] After the PCR reaction is completed, the fluorescence signal of each channel is used to determine whether it is consistent with the genotype of the added positive sample, thereby proving the analytical specificity of the primers and probes of the system of the present invention for detecting each CALR genotype. Among them, sample No. 1 is a blank control sample, samples No. 2-4 are single genotype CALR standards, and samples No. 5-7 are multi-genotype combination CALR standards; specific information is shown in Table-4.

[0155] 2.1.2 Test results

[0156] The experimental results are shown in Table 4: The primers and probes of the system of the present invention have good specificity, and correct results can be obtained when both wild-type and mutant genes are present. The presence of wild-type, type I mutation, and type II mutation of the CALR gene can be determined at one time through a single-tube multiplex reaction.

[0157] Table-4 Preliminary verification results of the reaction system of the present invention

[0158]

[0159]

[0160] The present invention further optimizes the primer probe concentration and reaction conditions; optimizes the main component concentration of each component of the CALR gene mutation detection kit and the machine parameters (reaction conditions) during detection, as shown in Table 5.

[0161] Table-5 Primer probe concentrations and reaction conditions optimized by the present invention

[0162]

[0163] 2.2 Performance test of the kit

[0164] 2.2.1 Implementation methods

[0165] Positive standards of different concentrations and mixed positive standards were prepared according to the quantitative gene copy number of ddPCR; the minimum detection limit, mutation detection rate, positive reference conformity, repeatability and linearity of the kit were determined through testing.

[0166] 2.2.2 Test results

[0167] After the PCR reaction was completed, the Ct value of the fluorescence signal of each channel in each experimental group was counted.

[0168] After the results are analyzed and processed, Figure 1 shown.

[0169] 2.2.3 Kit performance analysis

[0170] 1) Minimum detection limit

[0171] The kit was used to test different genotype positive standards 20 times, and the amplification curves were as follows Figure 1 A (wild type), 1B (type I mutation), and 1C (type II mutation). Figure 1 A represents a wild-type positive standard that can detect 724 copies of the wild type; Figure 1 B represents a positive standard for type I mutations that can detect 328 copies; Figure 1 C represents a positive standard for type II mutations that can detect 557 copies.

[0172] In summary, the detection limit of this kit for the CALR gene is no higher than 1000 copies / test.

[0173] 2) Mutation detection rate

[0174] The kit was used to repeatedly test the wild-type and mutant mixed positive standards 10 times. The amplification curve was as follows: Figure 1 D (wild type + type I mutation), 1E (wild type + type II mutation), 1F (wild type + type I mutation + type II mutation). Figure 1 D indicates that 2.33% type I mutation positive standard can be detected in the wild-type background; Figure 1 E indicates that 3.89% type II mutation positive standard can be detected in the wild-type background; Figure 1 F means that 2.36% of type I mutation positive standards and 4.00% of type II mutation positive standards can be detected in the wild-type background.

[0175] In summary, this kit can detect CALR mutant genes with a mutation rate as low as 5%.

[0176] Since the CALR mutation rate of most MPN patients with CALR gene mutations is above 20% when they are first diagnosed, the 5% mutation detection limit of the kit of the present invention can not only meet clinical needs, but also can be used for screening of potential low mutation patients.

[0177] 3) Conformity of positive reference materials

[0178] The kit was used to test positive standards of different concentrations and genotypes. The test results were as follows: Figure 1G (wild type), 1H (type I mutation), 1I (type II mutation). From the amplification curve, it can be found that when there are only different concentrations of wild-type positive standards, there is only the signal of CALR-PG probe (Cy5); when there are only different concentrations of type I mutation positive standards, there are signals of CALR-PG probe (Cy5) and CALR-P1 probe (FAM); when there are only different concentrations of type II mutation positive standards, there are signals of CALR-PG probe (Cy5) and CALR-P2 probe (Texas Red).

[0179] In summary, it is shown that the positive reference material of the reaction system has good compliance.

[0180] 4) Repeatability: Figure 1 As shown in A-1F, the standards used are as described in "Minimum detection limit" and "Mutation detection rate". According to the Ct value, the CV value is less than 5% (as shown in Table-6).

[0181] Table-6 CV values ​​of multiple tests with different templates

[0182] Standards Copy number CV(Cy5) CV(FAM) CV (TexasRed) T1 724 1.60％ / / T2 328 2.15％ 2.34％ / T3 557 0.88％ 0.70％ / T1+T2 <![CDATA[7×10 4 ]]> 1.45％ 2.33％ / T1+T3 <![CDATA[7×10 4 ]]> 1.51％ / 1.30％ T1+T2+T3 <![CDATA[7×10 4 ]]> 1.68％ 3.72％ 1.68％

[0183] 5) Linear

[0184] Based on the experimental data of the kit for single positive standard of different concentrations, the amplification efficiency curves of T1, T2, T3 and 1:1:1 mixed positive standards were plotted with Ct value as y-axis and logarithm of positive standard copy number as x-axis. The results are as follows: Figure 2 As shown in A-2D, the fitted linear curve R 2 Greater than 0.99, linear range is 10 2 -10 7 Copy number / test. At the same time, when using mixed templates, the three probes show similar amplification efficiency and will not interfere with each other, which provides the basis for achieving quantification of three different templates in a single tube, and is the key basis for subsequent testing of mutation rate in a single tube.

[0185] 2.3 Detection and calculation of CALR gene copy number and mutation rate

[0186] 2.3.1 Implementation methods

[0187] 1) Test positive standards of different concentrations and mixed ratios, with mutation ratios of 5%, 10%, 20%, and 50%. The standard curves produced can cover the vast majority of CALR mutation patients and potential low mutation patients;

[0188] 2) Amplification efficiency analysis;

[0189] 3) Calculation formulas for copy number and mutation rate.

[0190] 2.3.2 Test results

[0191] After the PCR reaction is completed, the Ct value of the fluorescence signal of each channel is counted, and the obtained Ct value is used to draw two amplification efficiency curves according to type I mutation and type II mutation, as shown in the figure. Figure 3 shown.

[0192] The results showed that the fitted amplification efficiency curve R 2 All of them are greater than 0.984, that is, R is greater than 0.991. The reaction system of the present invention can quantify the wild-type and mutant templates of the CALR gene in a single tube, and calculate the mutation rate of the CALR gene. The Ct value of the Cy5 channel can calculate the total number of templates, and the Ct value of the FAM or Texas Red channel can calculate the number of mutant templates.

[0193] based on Figure 3 The calculation formulas for the copy number and mutation rate of type I mutations and the copy number and mutation rate of type II mutations can be obtained from the curves fitted by A and 3B respectively:

[0194]

[0195] Among them, B1 = 42.83, B2 = 39.81, D1 = 42.54, D2 = 42.50, A1 = 3.489, A2 = 3.438, C1 = 3.326, C2 = 3.378. Substituting the Ct value obtained from the experiment into the formula and comparing it with the true mutation rate of the standard, the results are shown in Table 7:

[0196] Table-7 Absolute deviation between calculated value and true value

[0197]

[0198] In the 5%, 10%, and 25% groups, the copy number was 10 3 -10 7 The absolute deviation between the calculated value and the true value was less than 5% for the copy number / test. In the 50% group, there were different degrees of deviation, but in the copy number of 10 4 -10 5 The absolute deviation between the calculated value and the true value is less than 10% when testing the copy number / test. When testing clinical samples, the input gDNA copy number is usually 10 4 -10 5 The copy number / test is different, so the absolute deviation can be controlled within 10% in clinical application.

[0199] In summary, based on the experimental results of the developed kit and positive standard, the present invention fits the calculation formula of the CALR gene mutation rate, which can realize the calculation of the CALR gene mutation rate. When the mutation rate is below 25%, the absolute deviation is less than 5%, and when the mutation rate is above 25%, within the commonly used concentration range of clinical samples (10 4 -10 5 The absolute deviation was less than 9%.

[0200] The standard sample set by the present invention has a low mutation rate in order to make the detection of low mutation rate samples more accurate, which is conducive to the accurate detection of patients with low mutation levels in the early stage of the disease and the accurate evaluation of the degree of molecular relief after treatment of patients.

[0201] Example 3: Clinical sample testing and verification.

[0202] In this example, a plurality of clinical samples were tested using the kit of the present invention. This example further confirmed that the kit of the present invention is suitable for the identification and detection of type I and type II mutations in exon 9 of the CALR gene in the human serum genome, and can obtain the mutation rate thereof, and is suitable for the diagnosis of human CALR-related MPNs. The mutation rate of CALR can also be used to assist in determining the course of a patient's disease.

[0203] 3.1 Consistency between mutation detection by kit and first-generation sequencing

[0204] 3.1.1 Implementation methods

[0205] 1) Take 200 μL of blood samples to be tested (10 cases in total), extract DNA using a blood DNA extraction kit, measure the OD value at 260 nm, and dilute to a concentration of about 20-25 ng / μL;

[0206] 2) The 10 samples were respectively tested for CALR genotype using the kit described in the invention and PCR-first-generation sequencing. PCR-first-generation sequencing was completed in two steps, of which PCR was performed in the company's laboratory and took 2 hours; first-generation sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd. and took about one working day.

[0207] 3) Interpretation of sequencing results. Since the signal peaks of the wild type and mutant types in the sequencing results overlap, it is impossible to determine the results based on the sequence obtained by sequencing, and it is necessary to analyze them one by one based on the peak graph of the sequencing results.

[0208] 3.1.2 Test results

[0209] The qPCR results and first-generation sequencing results are shown in Table-8:

[0210] Table-8Consistency of qPCR and first-generation sequencing results

[0211]

[0212] 3.1.3 Analysis of test results

[0213] From the results of qPCR testing and first-generation sequencing, it can be seen that the detection results of the CALR gene mutation detection kit developed by the present invention are consistent with the first-generation sequencing genotyping results, and the consistency rate after comparison reaches 100%. Therefore, this experiment can prove that the use of the kit of the present invention can accurately and specifically identify type I mutations and type II mutations of the CALR gene from gDNA samples at one time.

[0214] 3.2 Consistency between mutation rate and next-generation sequencing results

[0215] 3.2.1 Implementation methods

[0216] Twelve clinical samples were selected, including 5 PMF type I mutation samples, 1 PMF type II mutation sample, 3 ET type I mutation samples, and 3 ET type II mutation samples. The samples were tested using the kit of the present invention and next-generation sequencing (NGS), and the mutation rate was calculated.

[0217] The second-generation sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd. and took about ten working days. After obtaining the second-generation sequencing results, it is necessary to process the original data, eliminate low-quality sequencing results, compare data, evaluate comparison quality, detect variants, screen mutation-related sequences, and then calculate the mutation rate based on the analysis results. NGS technology is difficult, has many steps, and is time-consuming. The interpretation of the results is greatly affected by the analysts, making it difficult to carry out related applications in clinical practice.

[0218] 3.2.2 Test results

[0219] The results are shown in Table 9, and the linear regression equation is fitted according to the mutation rate results. Figure 4 shown.

[0220] Table-9Consistency of qPCR and next generation sequencing (NGS) results

[0221]

[0222] Note: The mutation rate test results of NGS are obtained after bioinformatics analysis, not machine-reported results.

[0223] 3.2.3 Experimental results analysis

[0224] The results of qPCR test and next-generation sequencing show that the detection results of the CALR gene mutation detection kit developed by the present invention are consistent with the NGS genotyping results, with a coincidence rate of 100%; and the mutation rates of qPCR and NGS show a high correlation (slope = 1.0068, R2 >0.95). Therefore, this experiment proves that the kit of the present invention can accurately and specifically identify type I and type II mutations of the CALR gene from the gDNA sample at one time, and calculate the mutation rate of CALR by using the Ct value and the formula of the present invention.

[0225] 3.3 Mutation rate and disease progression

[0226] When the World Health Organization revised the "WHO Classification of Myeloid Neoplasms and Acute Leukemias" in 2016, it proposed that CALR is one of the important driving factors for the occurrence of MPN and should be tested together with JAK2 and MPL.

[0227] Detection of CALR type I or type II mutations can help determine the clinical phenotype and prognosis of CALR-mutated MPNs. For example, patients with ET with type I mutations have a higher risk of progression to myelofibrosis, while patients with type II mutations have a lower risk of thrombosis and a slower clinical course.

[0228] In addition, some studies have suggested that a higher CALR mutation rate may make MPN more invasive, more likely to transform into leukemia and affect survival. Although there are few studies on the correlation between CALR mutation rate and MPN disease progression, some studies have shown that the mutation rate of JAK2 is significantly correlated with the disease progression and survival rate of MPN patients, and CALR may also have a similar situation.

[0229] Therefore, it is necessary to study the relationship between CALR gene mutations and their mutation rates and MPNs.

[0230] The CALR gene mutation detection kit of the present invention provides an efficient, fast and inexpensive kit, which can detect type I and type II mutations of the CALR gene and their mutation rates based on Taqman probes. The present invention uses triple probes on the basis of qPCR to achieve the calculation of the mutation rate of the mutant gene, which is low-cost and fast, and provides an efficient tool for the research and diagnosis of CALR gene mutations. The kit of the present invention is the first detection method and kit that can be used for clinical extensive detection of CALR gene mutation types and mutation rates.

[0231] Example 4 Comparison of the method of the present invention with three comparative methods

[0232] In order to reflect the creativity and progressive significance of the present invention, this comparative example refers to three articles or patents to compare the present invention with three other methods for detecting CALR exon 9 mutations.

[0233] Type I mutations and Type II mutations together account for 85% of CALR gene mutations. Most of the remaining mutations are derivative mutations of Type I and Type II, which account for a low proportion and are often only detected in individual clinical samples. Clinical-related research is limited, so they are not designed to be within the detection range of the kit described in the present invention. This comparative example selects relatively high-proportion Type 3 (1.7%), Type 4 (1%), and Type 10 (0.7%) templates, among which Type 3 (46bp deletion) and Type 4 (34bp deletion) are derivative mutations of Type I mutations, and Type 10 (1bp deletion, 6bp insertion) is a derivative mutation of Type II mutations.

[0234] In this comparative example, a total of 6 templates were selected to compare the specificity of different methods, namely wild type, type I mutation, and type II mutation, with an input of 5×10 4 copies / reaction, slightly higher than the clinical sample input; Type 3, Type 4, and Type 10 template input is 5×10 7 copies / reaction, and use high concentrations of templates of other mutant types to test specificity.

[0235] The present invention and the three comparative experiments were all performed using an ABI-7500fast instrument, and the primers, probes, and qPCR Mix were consistent with those described in the respective methods.

[0236] 4.1 The present invention

[0237] 4.1.1 Experimental methods

[0238] As described in Example 2 of the present invention, six standards were tested using the kit of the present invention.

[0239] 4.1.2 Experimental Results and Analysis

[0240] Figure 5 The red color represents the signal of the CALR-PG probe, the green color represents the signal of the CALR-P1 probe, and the blue color represents the signal of the CALR-P2 probe.

[0241] like Figure 5 As shown, the results show that the kit of the present invention can accurately detect wild-type, type I mutation, and type II mutation templates without non-specific signals. When testing high-concentration Type 3, Type 4, and Type 10 templates, CALR-PG accurately detects the CALR gene without non-specific signals of CALR-P1 and CALR-P2. This shows that the specificity of the kit of the present invention is very good, and it can accurately determine type I mutations and type II mutations, and will not produce non-specific reactions to other mutation types.

[0242] The targeted design of primers and probes, and the optimization of reaction systems and reaction conditions are the key to the high specificity of the kit of the present invention. High specificity helps to accurately and quantitatively detect type I and type II mutations of the CALR gene, eliminate interference from other mutation types, and avoid misdiagnosis caused by specificity issues.

[0243] 4.2 Comparative Document 1

[0244] Comparative Document 1: Detection method and kit for CARL gene deletion and insertion mutation, publication number CN105441562A.

[0245] Comparative Document 1 used three Taqman probes to classify CALR wild type, type I mutation, and type II mutation respectively.

[0246] 4.2.1 Experimental methods

[0247] 1) Primers and probes

[0248] Upstream primer 1-F: CTGGTCCTGGTCCTGATGTCG (SEQ ID NO. 6);

[0249] Downstream primer 1-R: TCTTCTCTCTTGTCCTCCTCA (SEQ ID NO. 7);

[0250] Wild-type probe 1-P-Wild: CCTCCTCCTCCGTCTCCTGTTCCTCCT (SEQ ID NO. 8);

[0251] Deletion probe (type I mutation) 1-P-DEL: TTGTCCTGCTCCTCGTCTCCTGTTCCT (SEQ ID NO. 9);

[0252] Insertion probe (type II mutation) 1-P-INS: TCTCCTCCTCCTCCGTCTCCTGTTAACAG (SEQ ID NO. 10).

[0253] 2) Reaction system

[0254] 2×Mix 5μL, upstream primer final concentration 300nM, downstream primer final concentration 300nM, wild-type probe final concentration 150nM, deletion probe final concentration 150nM, insertion probe final concentration 150nM, add DNA template 2μL, and make up to 10μL with water.

[0255] 3) Reaction conditions

[0256] 95℃10min, 40 cycles (95℃15s, 62℃30s), reaction time 1.5h.

[0257] 4.2.2 Experimental results and analysis

[0258] Figure 6 Purple represents the signal of the wild-type probe, green represents the signal of the type I mutation probe, and blue represents the signal of the type II mutation probe.

[0259] like Figure 6 As shown in A, the wild-type probe produces a significant fluorescence signal for the wild-type template. Figure 6 As shown in BC, the wild-type probe of comparative document 1 produces significant fluorescence signals for templates with type I and type II mutations, and has significant non-specificity. Figure 6 As shown in DF, the method described in comparative document 1 has significant wild-type probe signals for Type 3, Type 4, and Type 10, and has certain type II mutation signals for Type 10.

[0260] Therefore, the method described in Comparative Document 1 has poor specificity for mutation detection of the CALR gene. During quantification, nonspecific signals will affect the Ct value and the calculation of the mutation rate. Therefore, even if the standard is further used to make a standard curve based on the design of Comparative Document 1, the CALR mutation rate cannot be accurately quantified.

[0261] In summary, compared with Comparative Document 1, although both the present invention and comparative document 1 are based on multiple Taqman probes for CALR genotyping in a single well, the primers and probes designed by the present invention have good specificity, can accurately and quantitatively detect CALR mutations, and have a short analysis time, which has significant differences and progressive significance.

[0262] 4.3 Comparative Document 2

[0263] Comparison document 2: Rapid and Sensitive Detection of Calreticulin Type 1and2Mutations by Real-Time Ouantitative PCR. Mol Diagn Ther, 2015, 19(5): 329-334.

[0264] Comparative Document 2 uses two sets of primer probes to specifically amplify type I mutations and type II mutations in two reaction wells, respectively.

[0265] 4.3.1 Experimental methods

[0266] 1) Primers and probes

[0267] Type 1 (amplification type I mutation):

[0268] Upstream primer 2-1-F ACAGGACGAGGAGCAGATGA (SEQ ID NO. 11);

[0269] Downstream primer 2-1-R GGACATCTTCCTCCTCATCTTCCT (SEQ ID NO. 12);

[0270] Probe 2-1-P FAM-TGTCCTCCTCATCCTCCTCATCCTCATCT-BHQ1 (SEQ ID NO. 13).

[0271] Type 2 (amplification type II mutation):

[0272] Upstream primer 2-2-F GCTTAAGGAGGAGGAAGAAGACAA (SEQ ID NO. 14);

[0273] Downstream primer 2-2-R TGTCCTCATCATCCTCCGACAATT (SEQ ID NO. 15);

[0274] Probe 2-2-P FAM-TCTGCCTCCTCCTCCTCTTTGCGT-BHQ1 (SEQ ID NO. 16).

[0275] 2) Reaction system

[0276] 2×Mix 12.5μL, upstream primer final concentration 400nM, downstream primer final concentration 400nM, probe final concentration 100nM, add 5μL of DNA template, add water to make up to 25μL (Type1 and Type2 reaction systems are added to two wells respectively).

[0277] 3) Reaction conditions

[0278] 95℃15min, 50 cycles (95℃15s, 62℃60s), reaction time 2.5h.

[0279] 4.3.2 Experimental results and analysis

[0280] Figure 7 The red color represents the reaction signal of the Type 1 system, and the blue color represents the reaction signal of the Type 2 system.

[0281] like Figure 7 As shown in AC, the two reaction systems described in Comparative Document 2 can correctly detect type I mutations and type II mutations; Figure 7 As shown in DF, the method described in Comparative Document 2 has significant signals for Type 3, Type 4, and Type 10, so the specificity of the method described in Comparative Document 2 is poor.

[0282] Since the method described in Comparative Document 2 has poor specificity in detecting CALR mutation types, when testing unknown samples, it is impossible to determine whether the reaction signal is derived from type I mutations, type II mutations, or other CALR mutations, which can easily lead to misdiagnosis. In addition, since this method does not detect the total amount of wild-type or CALR gene fragments, it cannot be used to quantitatively detect the CALR mutation rate.

[0283] In summary, compared with Comparative Document 2, the primers and probes designed in the present invention can specifically and efficiently detect type I and type II mutations of CALR, and accurately and quantitatively detect CALR mutations, with better analytical performance and short analysis time. Therefore, the present invention is significantly different from Comparative Document 2 and has creative and progressive significance.

[0284] 4.4 Comparative Document 3

[0285] Comparison document 3: Differential Dynamics of CALR Mutant Allele Burden inMyeloproliferative Neoplasms during InterferonAlfa Treatment. Plos One, 2016,11(10):e0165336.

[0286] Comparative Document 3 requires two steps to quantitatively detect CALR mutations. First, the CALR genotype needs to be determined by sequencing, and then the mutant gene and the wild-type gene are amplified using two primers of the corresponding genotype, and the mutation rate is calculated based on the Ct values ​​of the two reactions. The design uses a common downstream primer and a common fluorescent probe, and different upstream primers are used to distinguish between wild-type and mutant templates. Type I mutations and type II mutations each have two upstream primers, one specifically amplifies the wild-type template, and one specifically amplifies the mutant template, for a total of four upstream primers.

[0287] 4.4.1 Experimental methods

[0288] 1) Primers and probes

[0289] Common downstream primer 3-R GCCTCTCTACAGCTCGTCCTTG (SEQ ID NO. 17);

[0290] Wild-type upstream primer 3-1-Wild CAGGACGAGGAGCAGAGaCT (SEQ ID NO. 18);

[0291] Type I mutation upstream primer 3-1-Mut ACAGGACGAGGAGCAGAGaAC (SEQ ID NO. 19);

[0292] Wild-type upstream primer 3-2-Wild GAGGAGGAGGCAGAGGACAtGG (SEQ ID NO. 20);

[0293] Type II mutation upstream primer 3-2-Mut GGAGGAGGAGGCAGAGGACAtTT (SEQ ID NO. 21);

[0294] Common probe 3-P 6-FAM-CCGGGGACATCTTCCTCCTCATCT-TAMRA (SEQ ID NO. 22).

[0295] 2) Reaction system

[0296] 2×Mix 12.5μL, upstream primer final concentration 300nM, downstream primer final concentration 300nM, probe final concentration 200nM, add DNA template 5μL, and add water to make up to 25μL.

[0297] 3) Reaction conditions

[0298] 50℃ for 2 min, 95℃ for 10 min, 50 cycles (95℃ for 15 s, 60℃ for 60 s), reaction time is 2 h.

[0299] 4.4.2 Experimental results and analysis

[0300] Figure 8 Red represents the wild-type upstream primer for type I mutation, purple represents the type I mutation upstream primer for type I mutation, blue represents the wild-type upstream primer for type II mutation, and green represents the type II mutation upstream primer for type II mutation.

[0301] like Figure 8 As shown in A, the two wild-type upstream primers can amplify the wild-type template, and the two mutant upstream primers have no significant non-specific amplification. Figure 8 As shown in B-8C, the two wild-type upstream primers showed different degrees of amplification for type I and type II mutation templates, indicating that the two wild-type upstream primers have poor specificity and will overestimate the amount of wild-type template during quantification, resulting in a low mutation rate. Figure 8 As shown in D-8F, when testing Type 3, Type 4, and Type 10 mutations of CALR, the four upstream primers were all able to amplify, which means that the gene mutation types of CALR could not be distinguished at all, and the specificity was poor.

[0302] It can be seen that comparative document 3 has the following disadvantages: 1) The two wild-type primers have poor specificity, which will cause low quantitative results;

[0303] 2) This method requires sequencing first and then qPCR quantification, which has many steps and complicated operations. It takes more than one day to quantify the CALR genotype; 3) Since this method requires two sets of primers to amplify the wild-type and mutant templates in two wells respectively, it has low throughput, long working hours and high costs. In addition, it increases the operational error, thus affecting the calculation of the mutation rate.

[0304] In addition, according to comparative document 3: "Both assays performed exceptionally well, with the Type 1 assay displaying coefficients of variation in the range of 1.7%-11% for mutant allele burdens in the range of 2.8%-46% and the Type 2 assay displaying coefficients of variation in the range of 0.0%-3.2% for mutant allele burdens in the range of 5.5%-70%", that is, the CV for detecting type I mutations is 1.7%-11%, and the CV for detecting type II mutations is 0.0%-3.2%. The CV of the kit of the present invention in detecting both mutations is less than 3% (as described in Example 2), which is significantly better than comparative document 3.

[0305] In summary, the present invention has significant innovation and progress compared with Comparative Document 3. The present invention has the advantages of good primer specificity, high precision, fewer experimental steps, short detection time, low cost, and high reaction throughput. It can complete the qualitative and quantitative analysis of CALR in one step and one well, has significant progress and creativity, and has more clinical application value.

[0306] 4.5 Summary

[0307] According to the above test results, the results are summarized in Table 10.

[0308] Table-10 Comparison of CALR detection methods of the present invention and three comparative examples

[0309]

[0310] In summary, the present invention can quantitatively detect type I and type II mutations of CALR by one-step qPCR and single-well, and has the advantages of high specificity, precise quantification, high throughput, low cost, and short detection time. It is significantly superior to the methods described in the three comparative documents, especially the primers and probes have significant advantages, and can specifically detect type I and type II mutations without being interfered by other genotypes, and has significant progressive significance and creativity.

[0311] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0312] As used in the present invention, the terms "include" and "comprising" are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0313] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0314] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the present invention, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A method for detecting mutant type and / or mutation rate of calreticulin gene by qPCR based on multiple Taqman probes, characterized in that: The method can detect whether the calreticulin gene has type I mutation or type II mutation, and / or calculate the copy number and mutation rate of the mutant gene, providing efficient, rapid and accurate detection and evaluation for mutation detection of the calreticulin gene.

2. The method according to claim 1, characterized in that The qPCR reaction system includes: 5-15 μL 2×qPCRMix premix, 50-500 nM upstream primer final concentration, 50-500 nM downstream primer final concentration, 25-400 nM universal probe final concentration, 25-800 nM type I mutation probe final concentration, 10-200 nM type II mutation probe final concentration, 1-5 μL gDNA template obtained after whole blood extraction; The qPCR Mix premix includes: Hot-start Taq polymerase 50-400U / mL, dNTPs 0.05-2mmol / L, Mg 2+ 1-10mmol / L, dUTP 0.01-0.2mmol / L, UNG enzyme 5-40U / mL, Tris 1-20mmol / L, K + 10-100mmol / L, glycerol 1-20%, TritonX-1000.01-0.5%; the ratio of dTTP contained in dUTP and dNTP is 1:

3.

3. A method for standardized detection of mutant gene copy number and mutation rate, characterized in that: The method establishes the following calculation formula by testing standard products, calculating and verifying, and the formula can accurately, conveniently and quickly calculate the mutation copy number and mutation rate: Among them, Ct(type I) represents the Ct value read from the fluorescence channel of the type I probe; Ct(wild type) represents the Ct value read from the fluorescence channel of the wild-type probe; Ct(type II) represents the Ct value read from the fluorescence channel of the type II probe; B1 and B2 represent the constants in the formulas related to type I and type II mutations, respectively, ranging from 35.00 to 45.00; D1 and D2 represent the constants related to the wild type when calculating type I and type II mutations, respectively, ranging from 35.00 to 45.00; A1 and A2 represent the constants in the formulas related to type I and type II mutations, respectively, ranging from 3.200 to 3.600; C1 and C2 represent the constants related to the wild type when calculating type I and type II mutations, respectively, ranging from 3.200 to 3.

600.

4. A fluorescent quantitative polymerase chain reaction system for detecting calreticulin gene mutation, characterized in that: The reaction system comprises an upstream primer, a downstream primer, a universal probe, a type I mutation probe and a type II mutation probe.

5. The reaction system according to claim 4, characterized in that The reaction system also includes Taq DNA polymerase, polymerase chain reaction buffer, deoxyribonucleoside triphosphate, uracil-N-glycosylase, and deoxyuridine triphosphate.

6. A kit, characterized in that: The kit comprises an upstream primer, a downstream primer, a universal probe, a type I mutation probe, and a type II mutation probe.

7. The kit according to claim 6, characterized in that The kit also includes one or more of a PCR reaction solution, a positive quality control product, a wild-type quality control product, a blank quality control product, and a nucleic acid extraction kit.

8. The kit according to claim 6, characterized in that The PCR reaction solution includes dNTPs, Mg 2+ , Hot-start Taq polymerase, dUTP, UNG enzyme; and / or, the positive quality control product includes one or more of wild-type, type I mutation, and type II mutation calreticulin gene DNA; and / or, the wild-type quality control product includes wild-type calreticulin gene DNA; and / or, the blank quality control product includes ddH2O.

9. A primer pair, characterized in that: The primer pair includes an upstream primer CALR-F and a downstream primer CALR-R, wherein the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.2, or the above sequences are replaced, deleted or added with one or more nucleic acid bases to form a nucleic acid sequence with equivalent function.

10. A probe set, characterized in that: The probe group includes a universal probe CALR-PG, a type I mutation probe CALR-P1, and a type II mutation probe CALR-P2, wherein the nucleotide sequence of the universal probe is shown in SEQ ID NO.3, the nucleotide sequence of the type I mutation probe is shown in SEQ ID NO.4, the nucleotide sequence of the type II mutation probe is shown in SEQ ID NO.5, or the above sequences are replaced, deleted or added with one or more nucleic acid bases to form a nucleic acid sequence with equivalent function; and / or, the 5' end of the probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group; wherein the fluorescent reporter group includes any one of FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, and Cy5; and / or, the fluorescent quencher group includes any one of BHQ1, BHQ2, and BHQ3.

11. Use of the method according to claim 1 or 2, or the method according to claim 3, or the reaction system according to claim 4 or 5, or the kit according to any one of claims 6 to 8, or the primer pair according to claim 9, or the probe group according to claim 10 in detecting the mutant type, mutant copy number and mutation rate of the calreticulin gene.

12. The method, reaction system, kit, primer pair, probe set, and use according to claims 1 to 11, characterized in that: The type I mutation of the calreticulin gene is a 52 bp deletion L367fs*46 in the 9th exon of the calreticulin gene, namely c.1092_1143del; and / or, The type II mutation of the calreticulin gene is a 5 bp insertion of K385fs*4 in the 9th exon of the calreticulin gene, i.e., c.1154_1155insTTGTC; and / or, The mutation rate of the calreticulin gene can indicate the disease progression, providing information support for the typing and progression monitoring of MPN diseases; and / or, The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; and / or, The nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; and / or, The nucleotide sequence of the universal probe is shown in SEQ ID NO.3; and / or, The nucleotide sequence of the type I mutation probe is shown in SEQ ID NO.4; and / or, The nucleotide sequence of the type II mutation probe is shown in SEQ ID NO.5; and / or, The 5' end of the probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group; wherein the fluorescent reporter group includes any one of FAM, HEX, VIC, JOE, TAMRA, Cy3, NED, ROX, TEXAS-Red, and Cy5; and / or the fluorescent quencher group includes any one of BHQ1, BHQ2, and BHQ3.

Images