H1299 cell strain with CALR gene knocked out as well as construction method and application of H1299 cell strain

By constructing an H1299 cell line that does not express CALR protein using the CRISPR/Cas9 system, the problem of lack of target sites during IBV virus replication was solved, and effective inhibition of IBV virus was achieved, providing a new approach to drug development.

CN121825893APending Publication Date: 2026-04-10SOUTH CHINA AGRICULTURAL UNIVERSITY +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current technologies lack research on the role of the CALR gene in the IBV virus replication process, making it difficult to provide effective targets for IBV virus prevention and control.

Method used

H1299 cell lines with CALR gene knockout were designed and constructed using the CRISPR/Cas9 system. Gene editing was performed using sgRNA primers and the PX459 vector to construct H1299 cell lines that do not express CALR protein.

Benefits of technology

It significantly inhibited IBV virus replication and S protein expression, revealing the association between the CALR gene and IBV virus replication, and providing a new target for IBV virus drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825893A_ABST
    Figure CN121825893A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and discloses a CALR gene knockout H1299 cell strain, in the H1299 cell strain, the nucleotide sequence of the CALR gene before knockout is shown as SEQ ID NO.1, and the nucleotide sequence of the CALR gene after knockout is shown as SEQ ID NO.2; the CALR gene of the H1299 cell strain is knocked out through a CRISPR / Cas9 system, so that the mutant H1299 cell strain is constructed, CALR endogenous expression is reduced, it is verified that after the CALR gene is knocked out, the H1299 cell strain can remarkably inhibit IBV virus replication and S protein expression, association between the CALR gene and IBV virus replication is revealed, and the mutant H1299 cell strain has a good application prospect. And a new target and a new idea are provided for research and development of medicines for preventing and treating IBV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to an H1299 cell line with the CALR gene knocked out, its construction method, and its uses. Background Technology

[0002] Infectious bronchitis virus (IBV) is a highly contagious virus in chickens, primarily affecting the respiratory, urogenital, and digestive systems, exhibiting widespread tissue tropism. It can cause mortality in chicks, kidney lesions, permanent oviduct degeneration, reduced feed conversion ratio, and decreased egg production and quality in laying hens. Chickens aged 1-4 weeks are most susceptible, with mortality rates reaching 40%-60% in severe cases. The incidence rate shows a certain seasonal pattern, with relatively higher rates in winter and spring. Besides isolated infections, IBV is often mixed with bacteria and viruses; mixed infections with mycoplasma and parasites are less common. Among bacterial mixed infections, Escherichia coli is predominant, while among viral mixed infections, avian influenza and / or Newcastle disease are the most common. Therefore, strengthening IBV prevention and control is of great significance to the poultry industry.

[0003] The spike protein (S protein) is a key protein for coronavirus infection and host invasion, playing a crucial role in in vivo virulence and in vitro cell tropism. The S1 subunit mediates initial viral attachment, while the S2 subunit drives virus-cell fusion. Similar to other coronaviruses, IBV typically exhibits limited cell and tissue tropism, depending on the strain's S glycoprotein. Some IBV strains can replicate in primary chicken cells, such as chicken kidney (CK) cells and chicken embryo fibroblasts (DF1). Previous studies have found that the Beaudette strain and its recombinants have a broader host range, replicating in passaged cell lines such as Vero, H1299, DF1, and HeLa.

[0004] The binding of the S protein to specific receptors largely determines the host and tissue range of coronaviruses. Specific protein receptors for many α and β coronaviruses have been identified, with α2,3-sialic acid considered crucial for the attachment and infection of γ coronavirus IBV. Studies have also shown that HSP70 is part of the IBV receptor complex, potentially aiding in understanding the S-mediated mechanism of IBV cell entry; however, other studies have shown that HSP70 overexpression inhibits viral replication, suggesting it as a potential host antiviral factor. Furthermore, N-glycosylation of the S protein is a determining factor for receptor binding specificity. However, research on other host cell membrane proteins that can interact with IBV S1 and mediate viral adsorption or invasion is scarce.

[0005] Calreticulin (CALR), first discovered by Ostwald and MacLennan in 1974, is a 46 kDa protein that plays a role in many cellular processes in the endoplasmic reticulum (ER) and cytoplasm. CALR has two main functions: intracellular calcium homeostasis and chaperone function. In the ER, it binds to calcium, thereby affecting intracellular calcium balance. As a chaperone protein, it enables proteins to fold correctly. Currently, research on CALR is primarily focused on the pathogenesis of essential thrombocythemia (ET) and primary myelofibrosis (PMF) in humans. However, research on the IBV infection process is almost nonexistent. Therefore, investigating the role of CALR in IBV viral replication is of great value.

[0006] Based on this, the problem that this invention needs to solve is: how to provide an H1299 cell line with the CALR gene knocked out. Summary of the Invention

[0007] The present invention provides an H1299 cell line with the CALR gene knocked out, characterized in that the nucleotide sequence of the CALR gene before knockout in the H1299 cell line is as shown in SEQ ID NO.1, and the nucleotide sequence of the CALR gene after knockout is as shown in SEQ ID NO.2.

[0008] In addition, the present invention also provides a method for constructing the cell line and its application.

[0009] To achieve the above objectives, the present invention provides the following technical solution:

[0010] An H1299 cell line with the CALR gene knocked out, wherein the H1299 cell line does not express CALR protein, and the nucleotide sequence of the CALR gene before knockout in the H1299 cell line is shown in SEQ ID NO.1, and the nucleotide sequence of the CALR gene after knockout is shown in SEQ ID NO.2.

[0011] Furthermore, this invention discloses a method for constructing the H1299 cell line as described above, comprising the following steps:

[0012] Step 1: Two sgRNA primers, sgRNA-F and sgRNA-R, were designed and screened based on the CALR gene. After adding Bbsl restriction sites to both ends of the sgRNA primers, phosphorylation modification and annealing were performed.

[0013] Step 2: Linearize the PX459 vector by BBSL digestion and then recover it;

[0014] Step 3: Ligate the sgRNA primers to the linearized PX459 vector;

[0015] Step 4: Transform the ligation product into DH5a competent bacteria, select single clones of bacteria for amplification and culture, and then send them for sequencing verification. After the sequencing is correct, extract the plasmid and name it PX459-CALR recombinant plasmid.

[0016] Step 4: Screen the PX459-CALR recombinant plasmid for drugs, and transfect the screened PX459-CALR recombinant plasmid into H1299 cells to obtain the H1299 cell line.

[0017] Preferably, the nucleotide sequence of sgRNA-F is shown in SEQ ID NO.3, and the nucleotide sequence of sgRNA-R is shown in SEQ ID NO.4; the nucleotide sequence of sgRNA-F after adding the Bbsl restriction site is shown in SEQ ID NO.5, and the nucleotide sequence of sgRNA-R after adding the Bbsl restriction site is shown in SEQ ID NO.6.

[0018] Furthermore, this invention discloses the use of the H1299 cell line described above in the preparation of a drug that inhibits IBV virus replication.

[0019] Furthermore, this invention discloses the use of the H1299 cell line as described above in screening drugs that inhibit IBV virus replication.

[0020] Furthermore, this invention discloses the use of the H1299 cell line described above in the study of IBV virus replication mechanisms.

[0021] Furthermore, this invention discloses the use of a reagent for inhibiting or silencing CALR gene expression in the preparation of drugs that inhibit IBV virus replication.

[0022] Preferably, the reagent comprises sgRNA that targets and knocks out the CALR gene, wherein the sgRNA comprises sgRNA-F and sgRNA-R, the nucleotide sequence of sgRNA-R is shown in SEQ ID NO.4, and the nucleotide sequence of sgRNA-F is shown in SEQ ID NO.5.

[0023] Finally, this invention discloses an sgRNA that targets and knocks out the CALR gene. The sgRNA includes sgRNA-F and sgRNA-R. The nucleotide sequence of sgRNA-R is shown in SEQ ID NO.4, and the nucleotide sequence of sgRNA-F is shown in SEQ ID NO.5.

[0024] Compared with the prior art, the beneficial effects of the present invention are:

[0025] This invention knocks out the CALR gene in the H1299 cell line using the CRISPR / Cas9 system, thereby constructing a mutant H1299 cell line that reduces endogenous CALR expression. This verifies that after CALR gene knockout, the H1299 cell line can significantly inhibit IBV virus replication and S protein expression, revealing the association between the CALR gene and IBV virus replication, and providing new targets and ideas for the development of drugs to prevent and treat IBV. Attached Figure Description

[0026] Figure 1 The image shows the PX459-CALR recombinant plasmid.

[0027] Figure 2 Western blot identification results of H1299 cell line with CALR gene knockout;

[0028] Figure 3 RT-qPCR identification results of H1299 cell line with CALR gene knockout;

[0029] Figure 4 Sequencing results of PCR products from H1299 cell line with CALR gene knockout;

[0030] Figure 5 The lesion status of WT and KO-CALR cells at 8h, 12h, 16h and 24h after inoculation;

[0031] Figure 6 The expression of IBV S1 in WT and KO-CALR cells collected at different time points (8h, 12h, 16h, and 24h) after inoculation with the virus was investigated.

[0032] Figure 7 The expression levels of CALR mRNA in WT and KO-CALR cells after inoculation with the virus;

[0033] Figure 8 The expression level of IBV S1 mRNA in WT and KO-CALR cells after inoculation with the virus;

[0034] Figure 9 TCID for IBV virus infection of WT and KO-CALR cell lines 50 Test results. Detailed Implementation

[0035] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0036] The following are the main experimental materials and reagents used in the examples:

[0037] TIAN prep Mini Plasmid Kit (DP103-03) was purchased from Tiangen Biotech (Beijing) Co., Ltd.; Gel Extraction Kit (D2500-02) was purchased from OMEGA; pEASY®-Basic Seamless Cloning and Assembly Kit (CU201) was purchased from TransGen Biotech Co., Ltd.; T4 DNA ligase and other commonly used restriction endonucleases were purchased from TAKARA; 180 kDa Prestained Protein Marker (MP102-01) was purchased from Nanjing Novizan Biotechnology Co., Ltd.; calreticulin Polyclonal antibody (27298-1-AP) was purchased from Wuhan Sanying Biotechnology Co., Ltd.; ActivAb® Goat Anti-Rabbit IgG / HRP (SE134) was purchased from Beijing Solarbio Science & Technology Co., Ltd.; SteadyPure Rapid RNA Extraction Kit (AG21023) and Reverse Transcription Kit (AG11730) were used. The universal genomic DNA extraction kit (AG21009) was purchased from Aikerui Biotechnology Co., Ltd.; the ChamQ Universal SYBR qPCR Master Mix (Q711-02) was purchased from Nanjing Novizan Biotechnology Co., Ltd.; and the IBV strain was provided by the Lingnan Modern Agricultural Science and Technology Guangdong Zhaoqing Branch.

[0038] Example 1

[0039] I. Design of sgRNA

[0040] 1. Based on the CALR gene, the following two sgRNAs were designed and screened. The nucleotide sequence of the CALR gene is shown in SEQ ID NO. 1.

[0041] sgRNA-F: CACCGGTAGACGGCAGGCTCGGCGA (SEQ ID NO.3);

[0042] sgRNA-R:TCGCCGAGCCTGCCGTCTACCGGTG (SEQ ID NO.4);

[0043] The aforementioned primers were sent to Qingke Biotechnology Co., Ltd. for synthesis.

[0044] 2. Add BBSL restriction sites to both ends of the sgRNA. The sequence after adding BBSL restriction sites is shown below:

[0045] sgRNA-F: CACCgCACCGGTAGACGGCAGGCTCGGCGA (SEQ ID NO.5);

[0046] sgRNA-R: AAACTCGCCGAGCCTGCCGTCTACCGGTG (SEQ ID NO.6); The above primers were sent to Qingke Biotechnology Co., Ltd. for synthesis.

[0047] II. Construction of Knockout Plasmids

[0048] 1. Phosphorylation and annealing of primers: Resuspend sgRNA in distilled water to a final concentration of 100 μM, add phosphate groups and anneal according to the method in Table 1.

[0049] Table 1 sgRNA phosphorylation modification and annealing

[0050] 2. The PX459 vector was digested with BBSL according to the system in Table 2;

[0051] Table 2 Enzyme digestion system

[0052] PX459 1ug FastDigest BBSL 1ul Fast AP 1ul 10X FastDigest Buffer 2ul <![CDATA[ddH2O]]> Xul Total 20ul

[0053] The enzyme digestion effect was detected by agarose gel electrophoresis, and the linearized fragments were recovered using a gel recovery kit.

[0054] 3. The sgRNA prepared according to the above method was ligated with linearized PX459 and ligated at room temperature for 30 min. The ligation system is shown in Table 3.

[0055] Table 3. sgRNA-PX459 Ligation System

[0056] Linearized PX459 (50ng) Xul processed sgRNA 1ul 2X Quick ligation Buffer 5ul Quick ligase 1ul <![CDATA[ddH2O]]> Xul Total 10ul

[0057] 4. The above ligation product was directly used to transform DH5α competent cells (Dalian Baori Biotechnology Co., Ltd.), and the transformation was carried out according to the manufacturer's instructions.

[0058] 5. Single-clone bacteria were selected and amplified. A portion was sent to a biotechnology company for sequencing verification, which confirmed the sequencing was correct. Plasmid DNA was extracted using the TIAN prepMini Plasmid Kit, and the plasmid was named PX459-CALR recombinant plasmid. The map of the PX459-CALR recombinant plasmid is shown below. Figure 1 As shown. Plasmid DNA extraction was performed entirely according to the kit instructions.

[0059] III. Cell Screening

[0060] 1. Drug Screening Concentration Test: The PX459 plasmid contains a puromycin resistance gene. Before cell screening, a drug screening concentration test must be performed, typically between 0.5 μg / ml and 10 μg / ml. H1299 cells were seeded in 12-well plates. Once the cell confluence reached 50%, the complete culture medium was replaced with puromycin at concentrations of 0.5 μg / ml, 1 μg / ml, 1.5 μg / ml, 2 μg / ml, 2.5 μg / ml, 3 μg / ml, 3.5 μg / ml, 4 μg / ml, 4.5 μg / ml, 5 μg / ml, 5.5 μg / ml, and 6 μg / ml, respectively. Different concentrations of puromycin were used for complete culture every three days. After one week, the optimal drug concentration was found to be 2 μg / ml.

[0061] 2. Cell Transfection: H1299 cells were seeded in 12-well plates with a negative control. Two replicate wells were set up for each group. Transfection was performed when the cells reached 60% confluency. The amount of plasmid used per well was 1 μg, and the ratio of plasmid to Nulen Plus Trans transfection reagent was 1:2. After 24 hours of transfection, the culture medium was replaced with 2 μg / ml puromycin for complete culture. Cell viability was observed every three days, and the culture medium was replaced with 2 μg / ml puromycin for complete culture. On day 11, after the control group cells had completely died, the surviving cells in the experimental group were trypsinized and transferred to 96-well plates.

[0062] 3. Single-clonal cell selection: Perform three groups. For each group, first aspirate 100 μL of cells into the first well of the first row of a 96-well plate, then aspirate 100 μL from the first well into the second well, and so on, diluting until the second row is reached. Observe under a microscope and circle the wells with approximately one hundred cells using a marker. Add 10 ml of complete culture medium (without drugs) to a large dish, add the circled cells to the medium, and after complete dilution, add them to the remaining wells of the 96-well plate using a multipipeline. Place the plate in an incubator and observe daily. After approximately twelve days, cell clusters will appear in the wells under a microscope. Circle the wells containing only single cell clusters using a marker. When the wells are confluent, trypsinize the cells and transfer them to 24-well plates. After confluent growth, transfer them to 12-well and 6-well plates.

[0063] IV. Evaluation of Gene Editing Effects

[0064] 1. Western Blot Identification

[0065] Cells were seeded into 6-well plates, divided into an experimental group (KO-CALR cells) and a negative control group (WT cells). When cell confluence reached over 70%, cells were washed twice with PBS, and 400 μL of cell lysis buffer was added. Lysis was performed on ice for 10 min, followed by centrifugation at 12,000 rpm for 8 min at 4°C. 40 μL of supernatant was collected, and 10 μL of 5x loading medium was added. The cells were boiled at 98°C for 10 min, followed by SDS-PAGE and membrane transfer. Following the protocol, the cells were incubated with CALR antibody using primary antibody and with HRP-labeled goat anti-rabbit IgG using secondary antibody.

[0066] The results are as follows Figure 2 As shown, Western blotting results indicated that the expression level of KO-CALR-2 cells was significantly reduced compared to WT cells, while KO-CALR-3, KO-CALR-4, and KO-CALR-5 cells showed no expression at all.

[0067] Figure 2 The image shows the Western Blot results of H1299 cell lines with CALR gene knockout. In the figure, M: protein marker; 1: WT cells; 2, 3, 4, 5: different H1299 cell lines with CALR knockout.

[0068] 2. Identification using Real-time Quantitative PCR Detecting System (RT-qPCR), with primers shown in Table 4;

[0069] Cells were seeded in 6-well plates and divided into an experimental group (KO-CALR cells) and a negative control group (WT cells). When cell confluence reached 70% or higher, the cells were washed twice with PBS, and RNA was extracted using the SteadyPure Rapid RNA Extraction Kit from Aikerui. RNA was then reverse transcribed using the Aikerui Evo M-MLV Reverse Transcription Kit (containing gDNA removal reagent for qPCR). The RT-qPCR procedure was performed using ChamQ Universal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), Q711-02, following the manufacturer's instructions.

[0070] Table 4 RT-qPCR Primer Sequence List

[0071] Human-ACTIN-F CACCATTGGCAATGAGCGGTTC SEQ ID NO.7 Human-ACTIN-R AGGTCTTTGCGGATGTCCACGT SEQ ID NO.8 Human CALR-F GAGCCTGCCGTCTACTTCAA SEQ ID NO.9 Human CALR-R TTGCCGGAACTGAGAACGAA SEQ ID NO.10 IBV S1-F TACAAGGGGGTGCTTATGCG SEQ ID NO.11 IBV S1-R CCATACCTGATGACGGTGCC SEQ ID NO.12

[0072] The results are as follows Figure 3As shown, RT-qPCR identification results showed that, compared with the WT cell line, the CALR mRNA levels of KO-CALR-1 and KO-CALR-2 were significantly reduced, followed by the CALR mRNA level of KO-CALR-3.

[0073] Figure 3 The figure shows the RT-qPCR identification results of the H1299 cell line with CALR gene knockout. In the figure, NC: WT cell line; KO-CALR-1, KO-CALR-2, and KO-CALR-3 cell lines are the three cell lines that did not express the gene as identified by Western Blot. ****P<0.0001, ***P<0.001.

[0074] 3. Sequencing of PCR products

[0075] Cell lines with knockout efficacy were selected through Western blotting and RT-qPCR identification, plated in 6-well plates, and cultured until cell confluence reached over 70%. Cell DNA was extracted using the SteadyPure Universal Genomic DNA Extraction Kit from the cells, and primers synthesized by Qingke were used: F: gtccgtactgcagag (SEQ ID NO.13); R: agttttgacacgtcgggtgcc (SEQ ID NO.14), with Takara Taq polymerase. PCR amplification was performed and the cells were then sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0076] The results are as follows Figure 4 As shown, compared with the wild-type CALR gene, nucleotide 126 (C) is transposed to (G). Nucleotides 121 (C), 122 (C), 123 (G), 129 (G) and 130 (C) of the mutant CALR gene are lost. The loss of these bases causes an amino acid frameshift mutation, which causes a frameshift and premature termination. The nucleotide sequence of the knockout CALR gene is shown in SEQ ID NO.2.

[0077] 5. Functional validation of the H1299 cell line with CALR gene knockout

[0078] 1. Effects of the CALR gene knockout H1299 cell line on IBV virus replication

[0079] Cells were seeded in 12-well plates, divided into an experimental group (KO-CALR cells) and a negative control group (WT cells), with two replicates per group. Five time points were observed: 0h, 8h, 12h, 16h, and 24h. When cell confluence exceeded 70%, cells were washed twice with PBS, inoculated with an appropriate amount of IBV virus solution, and allowed to adsorb for 1 hour. Cells were then washed twice with PBS, replaced with 2% PM1640 medium, and cultured in a 37°C, 5% CO2 incubator. Protein and RNA samples were collected from both the experimental and negative control groups at the five time points, and CALR mRNA and S1 mRNA levels were detected by Western blotting and RT-qPCR.

[0080] The results are as follows Figures 5-8 As shown, the cytopathic effect of KO-CALR cells was weaker than that of WT cells at 24h. At 16h and 24h, the expression of IBV S1 and IBV S1 in WT cells was significantly higher than that in KO-CALR cells, indicating that the H1299 cell line with the CALR gene knockout has an inhibitory effect on IBV virus replication. After simultaneously infecting WT and KO-CALR cells with IBV, the CALR mRNA expression level in the KO-CALR cell group was significantly reduced, and the IBV S1 mRNA was also reduced, even significantly lower than that in the WT cell group at 24h. It can be concluded that the CALR gene in H1299 cells has a reduced endogenous CALR expression level, which can inhibit IBV virus replication.

[0081] Figure 5 The lesion status of WT and KO-CALR cells at 8h, 12h, 16h and 24h after inoculation;

[0082] Figure 6 The expression of IBV S1 in WT and KO-CALR cells collected at different time points (8h, 12h, 16h, and 24h) after inoculation with the virus was investigated.

[0083] Figure 7 The expression levels of CALR mRNA in WT and KO-CALR cells after inoculation with the virus;

[0084] Figure 8 The expression level of IBV S1 mRNA in WT and KO-CALR cells after inoculation with the virus.

[0085] 2. Determination of IBV viral titer in H1299 cell lines with CALR gene knockout

[0086] KO-CALR and WT cell lines were seeded in 96-well plates, with three replicates for each. Once the cells reached over 70% confluence and were in good condition, 100 μL of IBV virus solution was mixed with 900 μL of serum-free culture medium and placed on ice to prepare 10^ -1 The virus solution was diluted to a certain concentration. This method was continued until a concentration of 10^6 was obtained. -10 Viral solutions of varying dilutions were prepared. 96-well plates confluent with KO-CALR and WT cells were washed twice with PBS. Then, 100 μL of viral solution of each dilution was added to each group of cells, with each dilution replicated in 8 wells. The plates were then incubated at 37°C with 5% CO2 for 7 days. The number of wells showing cytopathic effects was recorded, and the TCID of each sample was calculated accordingly. 50 value.

[0087] The results are as follows Figure 9 As shown, the viral titer of the H1299 cell line with the CALR gene knocked out was significantly lower than that of the WT group after infection.

[0088] Figure 9 TCID for IBV virus infection of WT and KO-CALR cell lines 50 The test results are shown in the figure. ***P<0.001.

[0089] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

Claims

1. A H1299 cell line in which the CALR gene is knocked out, characterized in that, The nucleotide sequence of the CALR gene before knockout in the H1299 cell strain is shown as SEQ ID NO. 1, and the nucleotide sequence of the CALR gene after knockout is shown as SEQ ID NO.

2.

2. The method of claim 1, wherein the H1299 cell line is constructed by transfecting H1299 cells with a plasmid containing a human KRAS gene and a plasmid containing a human EGFR gene. The method comprises the following steps: Step 1: two sgRNA primers, including sgRNA-F and sgRNA-R, are designed according to the CALR gene; after adding Bbsl enzyme cutting sites at both ends of the sgRNA primers, phosphorylation modification and annealing are performed; Step 2: the PX459 vector is linearized by Bbsl enzyme cutting and recovered; Step 3: the sgRNA primers are connected with the linearized PX459 vector; Step 4: the connection product is transformed into DH5a competent cells, single colony bacteria are picked and amplified, then sent for sequencing verification, and after sequencing is correct, the plasmid is extracted and named as PX459-CALR recombinant plasmid; Step 4: the PX459-CALR recombinant plasmid is subjected to drug screening, and the screened PX459-CALR recombinant plasmid is transfected into H1299 cells to obtain the H1299 cell strain.

3. The construction method of claim 2, wherein, The nucleotide sequence of the sgRNA-F is shown as SEQ ID NO. 3, and the nucleotide sequence of the sgRNA-R is shown as SEQ ID NO. 4; the nucleotide sequence of the sgRNA-F after adding the Bbsl enzyme cutting site is shown as SEQ ID NO. 5, and the nucleotide sequence of the sgRNA-R after adding the Bbsl enzyme cutting site is shown as SEQ ID NO.

6.

4. The use of the H1299 cell strain of claim 1 in the preparation of a drug for inhibiting the replication of IBV virus.

5. The use of the H1299 cell strain of claim 1 in the screening of a drug for inhibiting the replication of IBV virus.

6. The use of the H1299 cell strain of claim 1 in the study of the replication mechanism of IBV virus.

7. The use of a reagent for inhibiting or silencing the expression of CALR gene in the preparation of a drug for inhibiting the replication of IBV virus.

8. Use according to claim 7, characterized in that, The reagent includes sgRNA for targeting knockout of the CALR gene, and the sgRNA includes sgRNA-F and sgRNA-R, the nucleotide sequence of the sgRNA-F is shown as SEQ ID NO. 3, and the nucleotide sequence of the sgRNA-R is shown as SEQ ID NO.

4.

9. An sgRNA targeting knock-out of a CALR gene, characterized in that, The sgRNA includes sgRNA-F and sgRNA-R, the nucleotide sequence of the sgRNA-F is shown as SEQ ID NO. 3, and the nucleotide sequence of the sgRNA-R is shown as SEQ ID NO. 4.