Marker for diagnosing intestinal epithelial barrier injury induced by uremic toxin and application thereof

Abstract

The invention discloses a marker for diagnosing intestinal epithelial barrier injury induced by uremic toxin and application of the marker, and belongs to the technical field of biomedicine. Human colon cancer cells (Caco-2) are adopted to establish intestinal epithelial injury models under different urea treatment conditions, and the optimal concentration and time are screened through CCK-8 and immune blot. According to the present invention, RT-qPCR is adopted to detect the expression of lncRNANEAT1 and miR-122-5p, Westernblot and an immunofluorescence method are adopted to detect the expression of tight junction proteins Occludin, ZO-1 and Claudin-1, fluorescein sodium is adopted to detect the cell para-permeability of an intestinal epithelial injury model, and the combination of miR-122-5p with lncRNANEAT1 and Occludin is detected through bioinformatics analysis and dual-luciferase reporter gene analysis; the result shows that the lncRNANEAT1 can be used for protecting intestinal epithelial barrier injury induced by uremia toxin by regulating the miR-122-5p / Occludin axis. The discovery reveals an action mechanism of the lncRNANEAT1 in uremia toxin induced intestinal epithelial barrier injury, and provides a new thought and method for reducing complications of uremia patients and improving life quality.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to markers for diagnosing intestinal epithelial barrier damage induced by uremic toxins and applications thereof. Background Art

[0002] Chronic kidney disease (CKD) is a major public health problem that threatens human health. Globally, the prevalence of CKD is about 8% to 14%, affecting about 700 million to 840 million people. The long-term continuous progression of CKD will enter end-stage renal disease (ESRD), i.e., uremia. Currently, there is no effective treatment for uremia, and dialysis or kidney transplantation is the main treatment measure. Therefore, chronic kidney disease has brought a heavy economic burden to the global economy and healthcare. Recent studies have found that the intestinal barrier of CKD patients shows obvious dysfunction, which, together with the entry of intestinal bacteria and endotoxins into the blood, induces inflammatory responses, stimulates the immune system, causes oxidative stress and systemic inflammation, which is an important factor in aggravating the development of coronary heart disease and various complications such as cardiovascular disease, malnutrition, and osteoporosis, directly or indirectly affecting the quality of life and prognosis of CKD patients. Therefore, the strategy of "treating the kidney from the intestine" is one of the key targets to delay the progression of CKD.

[0003] As a mechanical barrier, the intestinal mucosal barrier is an important line of defense to prevent intestinal bacteria, endotoxins and antigens from entering the blood and lymph. Tight junctions (TJs) are the most important component of the intestinal mechanical barrier. TJs are composed of a variety of transmembrane proteins and intracellular scaffolding proteins, including Claudin-1, zone occludens, and zone occludens-1 (ZO-1). If the integrity of tight junction proteins (TJPs) is destroyed, the intestinal barrier will be damaged and intestinal permeability will increase. This situation can be improved after TJP repair. Some studies have preliminarily explored the role of uremic toxins, such as urea, indane sulfate, and homocysteine, in the destruction of intestinal TJPs and intestinal barrier function. However, the molecular mechanisms of these uremic toxins in intestinal epithelial barrier damage have not been fully elucidated.

[0004] LncRNA is a group of RNAs with a length of more than 200 nucleotides that cannot encode proteins. It exerts its regulatory functions through various mechanisms, such as acting as a decoy to bind proteins, as a sponge for miRNAs, and as a scaffold or guide to regulate the interaction between proteins and genes. LncRNA is also involved in a variety of pathophysiological processes, such as inflammation, apoptosis, and oxidative stress. Recent studies have shown that lncRNA regulates the expression of TJP in a variety of diseases. For example, in inflammatory bowel disease, LncRNA1 overexpression protects intestinal barrier function by regulating the expression of myc-related zinc finger proteins MAZ, ZO-1, and in. Another study reported that overexpression of lncRNAMALAT1 protects the integrity of vascular endothelial cells by upregulating TJPs ZO-1 and in. In ovarian cancer, lncRNA NEAT1 targets miR-1321 to regulate the expression of TJP-3, enhance epithelial-mesenchymal transition in ovarian cancer cells, and induce cell invasion. However, the role of lncRNA in the effect of uremia on intestinal TJP has not been explored.

[0005] MiRNA is a non-coding single-stranded RNA with a length of about 20 nucleotides. It inhibits the translation or degradation of mRNA by binding to the 3'UTR of mRNA, thereby mediating or silencing gene expression. Previous studies have found that miRNA plays an important role in regulating the body's barrier function. For example, inhibition of miR-155 can significantly inactivate the NF-κB signaling pathway and reduce intestinal inflammation and barrier dysfunction in septic mice. In a rat model of acute pancreatitis, miR-122 can regulate the expression of mycin, disrupt intestinal barrier function, and promote the development of acute pancreatitis. MiR-101 disrupts the permeability of the human blood-brain barrier under hypoxic conditions by changing the expression of VE-cadherin and Claudin-5. MiR-122-5p exosomes are significantly increased in LPS-induced neutrophils and increase the permeability of brain microvascular endothelial cells by targeting the downstream gene OCLN. In patients with oligospermia, the expression of miR-122-5p was negatively correlated with that of OCLN, suggesting that this target relationship may also exist in other organs, tissues or cells. According to bioinformatics analysis (https: / / starbase.sysu.edu.cn / ), miR-122-5p may be a potential target of lncRNA NEAT1. However, whether miR-122-5p is involved in the damage of intestinal epithelial cells TJP in the uremic environment is still unclear. Summary of the invention

[0006] In view of the above problems, the present invention aims to explore the mechanism of action of lncRNANEAT1 in uremic toxin-induced intestinal epithelial barrier damage.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] In one aspect, the present invention provides a marker for diagnosing uremic toxin-induced intestinal epithelial barrier damage, wherein the marker is lncRNA NEAT1.

[0009] On the other hand, the present invention also provides the role of lncRNA NEAT1 in the preparation of a drug for treating intestinal epithelial barrier damage induced by uremic toxins.

[0010] Specifically, lncRNA NEAT1 protects against uremic toxin-induced intestinal epithelial barrier damage by regulating the miR-122-5p / occludin axis.

[0011] Specifically, lncRNANEAT1 upregulated the expression of Occludin and ZO-1 proteins in uremic intestinal epithelial cells, and miR-122-5p was a target of Occludin.

[0012] Furthermore, the present invention also provides a research method for the application as described above, the research method comprising the following steps:

[0013] S1: Human colon cancer cells were used to establish an intestinal epithelial injury model under different urea treatment conditions;

[0014] S2: RT-qPCR was used to detect the expression of lncRNANEAT1 and miR-122-5p in cells;

[0015] S3: Western blot and immunofluorescence were used to detect the expression of tight junction proteins Occludin, ZO-1 and Claudin-1;

[0016] S4: Sodium fluorescein was used to detect paracellular permeability in the intestinal epithelial injury model;

[0017] S4: The binding of miR-122-5p with lncRNANEAT1 and Occludin was detected by bioinformatics analysis and dual-luciferase reporter gene assay.

[0018] On the other hand, the present invention also provides the use of a reagent for detecting the expression amount of LncRNANEAT1 in cells in the preparation of a serological detection reagent or a detection kit for diagnosing uremic toxin-induced intestinal epithelial barrier damage.

[0019] Specifically, the reagent for detecting the expression amount of lncRNA NEAT1 in cells includes: a probe, a gene chip, or a PCR primer that has detection specificity for lncRNA-NEAT1.

[0020] The beneficial effects of the present invention are:

[0021] The present invention clarifies the role and molecular mechanism of NEAT1 in uremia-induced intestinal barrier damage. Studies have found that overexpression of NEAT1 upregulates Occludin levels by inhibiting miR-122-5p, thereby protecting the intestinal epithelial damage induced by uremic toxins. The present invention emphasizes for the first time the importance of the interaction between NEAT1, miR-122-5p and Occludin. In addition, the NEAT1 / miR-122-5p / Occludin axis, as a promising therapeutic target, will provide new ideas and methods for reducing complications and improving the quality of life of patients with uremia. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 These are the results of CCK-8 assay of cell viability at 24 h, 48 h, and 72 h in the present invention.

[0023] Figure 2 The results of the Western blotting method in the present invention at 24 h evaluated the effects of different concentrations of urea treatment on the expression of TJPs ZO-1, Occludin, Claudin-1, and GAPDH proteins.

[0024] Figure 3 The results of the Western blotting method were used to evaluate the effects of different concentrations of urea on the expression of ZO-1, Occludin, Claudin-1, and GAPDH proteins in TJPs at 48 h in the present invention.

[0025] Figure 4 This is the RT-qRCR analysis of the expression of lncRNA NAET1 in urea-treated Caco-2 cells in the present invention.

[0026] Figure 5 These are the expression results of NEAT1 detected by RT-qPCR after LV-NEAT1 and LV-NC were transfected into Caco-2 cells in the present invention, as well as the permeability detection results of the monolayer Caco-2 model.

[0027] Figure 6 The results of Western blot detection of the relative levels of ZO-1, Occludin and Claudin-1 in different overexpressed Caco-2 cells in the present invention.

[0028] Figure 7 The results of immunofluorescence staining in the present invention are as follows: the expression of ZO-1, Occludin and Claudin-1 in different overexpressed Caco-2 cells.

[0029] Figure 8The results of the experiment of using lncRNANEAT1 as a sponge for miR 1225p in the present invention are as follows: (A) StarBase v2.0 predicted the binding site between NEAT1 and miR-122-5p. (B) The relative luciferase activity was determined by dual luciferase reporter gene assay. (C) The level of miR-122-5p was detected by qRT-PCR in 144 mg / dl urea for 48 hours. (D) After Caco-2 was infected with LV-NEAT1, the expression of miR-122-5p was detected by qRT-PCR.

[0030] Fig. 9 The results of the experiment that Occludin is a target gene of miR-122-5p in the present invention, in which (A) StarBase v2.0 predicted the binding site between miR-122-5p and Occludin. (B) The relative luciferase activity was determined by dual luciferase reporter gene. (C) The level of miR-122-5p in Caco-2 transfected with miR-122-5p mimics and miR-122-5p inhibitors was detected by qRT-PCR. (D-E) The relative level of Occludin was detected by Western blot. (F) The expression of Occludin was detected by immunofluorescence staining. (n=3, *P<0.05, **P<0.01) LncRNANEAT1, as a ceRNA of miR-122-5p, regulates the expression of Occludin in urea-induced damage in Caco-2.

[0031] Fig.10 The figures are partial experimental results of the present invention, in which LncRNA NEAT1, as the ceRNA of miR-122-5p, regulates the expression of Occludin in urea-induced damage in Caco-2 cells. (A) and (B) are the relative levels of Occludin detected by Western blot; (C) is the expression of Occludin detected by immunofluorescence staining. DETAILED DESCRIPTION

[0032] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0033] 1. Materials and methods

[0034] 1.1 Cell culture

[0035] Human embryonic kidney cells (HEK-293T) and human colon cancer cells (Caco-2) were purchased from Wuhan Procell Life Science Technology Co., Ltd. HEK-293T was aggregated in high-glucose DMEM medium containing 1% penicillin / streptomycin (Procell, China) and 10% fetal bovine serum (Procell, China). Caco-2 was aggregated in MEM medium containing 1% penicillin / streptomycin (Procell, China) and 20% fetal bovine serum (Procell, China). All cells were incubated at 37°C and 5% carbon dioxide.

[0036] 1.2 Lentiviral transfection

[0037] In this experiment, lncRNA NEAT1 (LV-NEAT1) and negative control (LV-NC) lentiviral vectors were designed and obtained from Gene Pharmaceuticals (Shanghai, China). LV-NEAT1 was subcloned into lentiviral plasmids and infected Caco-2 cells together with lentiviral plasmids. To identify cells stably overexpressing lncRNA NEAT1, cells were treated with 2 μg / mL puromycin for 48 h after transfection. miR-122-5p inhibitor, miR-122-5p mimic, inhibitor-NC, and mimic-NC were purchased from Gene Pharmaceuticals (Shanghai, China). Caco-2 cell lines were transfected using Lipofectamine 2000 (Shanghai, China).

[0038] 1.3 Permeability and polarity measurements in the Caco-2 monolayer model

[0039] The success of the monolayer model was evaluated by evaluating the polarity of the Caco-2 monolayer model and the permeability of sodium fluorescein at different times. 5 Cells were plated on 6.5 mm inserts containing 0.8 μm polyester membrane. Cells were cultured in culture medium for 21 days and fully differentiated. According to the manufacturer's instructions, alkaline phosphatase detection (AKP) kit (Nanjing, China) was used to evaluate the apical and basolateral alkaline phosphatase activity at different time points. The permeability of monolayer Caco-2 cells was measured by flux of sodium fluorescein (Sigma, USA). Sodium fluorescein (30 mg / L) was added at the top of the inset. After incubation for 1 hour, basolateral culture medium aliquots were collected for fluorescence measurement at 490 nm emission wavelength.

[0040] 1.4 Cell viability assay

[0041] The cytotoxicity of urea to Caco-2 cells was evaluated using the CCK-8 assay (Shanghai, China). Caco-2 cells were cultured at 2 × 10 3The cells were inoculated in a 96-well plate at a density of 10 μL / well and cultured for 24 h. The cells were then treated with different concentrations of urea for 24 h, 48 h, and 72 h. Then, 10 μL of CCK-8 solution was added and incubated for 2 h. The absorbance was measured at a wavelength of 450 nm using a microplate reader (PerkinElmer, US). Each experiment was performed three times.

[0042] 1.5 RT-qPCR analysis

[0043] Total RNA was isolated from cells using TRIzol reagent (Shanghai, China). mRNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan). For miRNA, reverse transcription was performed using a cDNA first-strand miRNA synthesis kit (KGIBio, China). qRT-PCR was performed using SYBR Green PCR MasterMix (Takara, Japan) and a fluorescent quantitative PCR miRNA kit (KGIBio, China). All responses were analyzed by a CFX connected real-time system (BIO-RAD). The relative expression was calculated using the 2-△△Ct method. The primer sequences are as follows: NEAT1 (forward TGGCATGCTCAGGGCTTCAG), (reverse TCTCCTTGCCAAGCTTCCTTC); GAPDH (forward GAAGGTGAAGGTCGGAGTC), (reverse GAAGATGGTGATGGGATTTC); miR-122-5p (forward TGGAGTGTGACAATGGTGTTTG), (reverse AGTGCAGGGTCCGAGGTATT); U6 (forward AACGAGACGACAGAC), (reverse GCAAATTCGTGAAGCGTTCCATA).

[0044] 1.6 Western blotting

[0045] Total protein was extracted from cells using RIPA lysis buffer (Kaikyl, Shanghai, China) and quantified using a BCA assay kit (Kaikyl, Shanghai, China) according to the manufacturer's instructions. Then, proteins were separated by 6-12% SDS-PAGE and transferred to PVDF membranes (Milwell, Billerica, MA, USA). After blocking with 5% skim milk at room temperature for 1 h, the membranes were incubated with ZO-1 (1:1000, China), Occludin (1:2000, China), Claudin-1 (1:1000, China), and GAPDH (1:10000, ZSBG-Bio, China) at 4°C overnight.

[0046] 1.7 Immunofluorescence analysis

[0047] The cells were cultured in 6-well plates and covered with glass slides and fixed with 4% paraformaldehyde for 10 to 15 minutes at room temperature. Then, the cells were permeabilized with 0.3% Triton X-100 for 10 minutes and incubated in a blocking buffer containing 5% BSA for 20 minutes. Primary antibodies such as Occludin (1:1000), ZO-1 (1:500) and Claudin-1 (1:500) were added and incubated with the cells overnight at 4°C. The labeled secondary antibodies (1:500) were incubated for 2 h at room temperature, and the cell nuclei were stained with DAPI. Finally, images were observed and collected using a Confocal immunofluorescence microscope (Olympus).

[0048] 1.8 Dual luciferase reporter gene analysis

[0049] NEAT1 wild-type and mutant reporter gene vectors (WT-NEAT1, MUT-NEAT1), Occludin wild-type and mutant reporter gene vectors (WT-Occludin, MUT-Occludin) were constructed, and then co-transfected with miR-122-5p mimics or miR-122-5pNC into HEK-293T cells for 48 h. Luciferase activity was then measured using a luciferase kit (Jima, Shanghai).

[0050] 1.9 Statistical analysis

[0051] All data are expressed as mean ± SD. Two or more groups were compared using independent sample t-test and one-way analysis of variance. P < 0.05 was considered statistically significant.

[0052] 2. Experimental results

[0053] 2.1 Urea damages Caco-2 TJPs and downregulates the expression of lncRNA NEAT1

[0054] To construct the Caco-2 intestinal epithelial barrier injury model, Caco-2 cells were treated with different concentrations of urea (0, 42, 72, and 144 mg / dl), and CCK-8 was used to detect the viability of the cells at 24 h, 48 h, and 72 h. The results are shown in the attached figure. Figure 1 As shown in the attached Figure 1 It can be seen that after the intervention of Caco-2 with gradient concentration and time of urea, the cell proliferation activity did not change.

[0055] Then, at 24 h and 48 h, the effects of different concentrations of urea treatment on the expression of ZO-1, Occludin, Claudin-1, and GAPDH proteins in TJPs were evaluated by Western blotting. The results are shown in the attached Figure 2 and attached Figure 3As shown, Figure 2 For 24h test results, Figure 3 This is the 48h test result.

[0056] From the attached Figure 2 and attached Figure 3 It can be seen that after 24 hours, different concentrations of urea had a damaging effect on Caco-2 cell ZO-1 (P<0.01), and Caco-2 cells treated with 144 mg / dl urea were significantly damaged (P<0.01), while Claudin-1 was not damaged. At 48 hours, different concentrations of urea had a damaging effect on ZO-1 and Occludin (P<0.01), and Claudin-1 protein was significantly destroyed (P<0.01). The results showed that urea at a concentration of 144 mg / dl could induce intestinal epithelial barrier damage in Caco-2 at 48 hours.

[0057] Furthermore, the present invention also analyzed the expression of lncRNA NAET1 in Caco-2 cells treated with urea by RT-qPCR. Figure 4 As shown in the attached Figure 4 As can be seen from the figure, the expression of lncRNA NAET1 was significantly downregulated in Caco-2 cells after urea treatment.

[0058] 2.2 Overexpression of lncRNA NEAT1 can repair urea-induced intestinal epithelial barrier damage

[0059] In order to further clarify the potential mechanism of NEAT1 on intestinal permeability, the present invention transfected LV-NEAT1 and LV-NC into Caco-2 cells, and detected the expression of NEAT1 by RT-qPCR. Figure 5 As shown in A, from the attached Figure 5 As can be seen in Figure A, compared with LV-NC, the expression of NEAT1 in Caco-2 cells treated with LV-NEAT1 was significantly upregulated, while after urea treatment, the expression of NEAT1 was significantly decreased.

[0060] After the Caco-2 monolayer cell model was established, the permeability of the monolayer Caco-2 model was evaluated using the sodium fluorescein transport method to assess the effect of NEAT1 on the permeability of the Caco-2 monolayer cell model. The results are shown in the attached figure. Figure 5 As shown in B. The results showed that the permeability of sodium fluorescein in Caco-2 cells was significantly reduced after urea treatment (P<0.01). The permeability of sodium fluorescein in the LV-NEAT1 group was lower than that in the LV-NC group, and the permeability in the LV-NEAT1+urea group was lower than that in the urea group (P<0.01).

[0061] Western blot was used to detect the relative levels of ZO-1, Occludin and Claudin-1 in different overexpressed Caco-2 cells. The results are shown in the attached figure. Figure 6 As shown in the attached Figure 6 It can be seen that the expression of ZO-1 and Occludin in the LV-NEAT1 group was significantly increased (P<0.01), while the expression of Claudin-1 did not change significantly (P>0.05). The expression levels of ZO-1 and Occludin in the LV-NEAT1+urea group were higher than those in the urea treatment group (P<0.01).

[0062] Furthermore, immunofluorescence staining was used to detect the expression of ZO-1, Occludin and Claudin-1. Figure 7 As shown in the figure, similar to the results of Western blot, in the LV-NEAT1 group, the fluorescence intensity of ZO-1 and Occludin increased significantly, while Claudin-1 did not change significantly. The fluorescence intensity of ZO-1 and Occludin in the LV-NEAT1+urea group was higher than that in the urea treatment group.

[0063] 2.3LncRNA NEAT1 as a sponge for miR-122-5p

[0064] StarBase v2.0 tool was used to predict miRNAs that may target NEAT1. The results showed that miR-122-5p had binding sites with NEAT1, as shown in the attached Figure 8 The results of the dual luciferase reporter gene experiment are shown in the attached Figure 8 As shown in Figure B, the results showed that miR-122-5p mimics could significantly inhibit the luciferase activity of WT-NEAT1, but transfection of miR-122-5p mimics could not downregulate the luciferase activity of mutant plasmid NEAT1-MUT. In addition, the RT-qPCR method was used to detect the level of miR-122-5p after 48 hours of treatment with 144 mg / dl urea. The results are shown in the attached figure. Figure 8 As shown in C, from the attached Figure 8 As can be seen from Figure C, 144 mg / dl urea treatment for 48 h significantly promoted the expression of miR-122-5p. After Caco-2 cells were infected with LV-NEAT1, qRT-PCR was used to detect the expression of miR-122-5p. The results are shown in the attached figure. Figure 8 As shown in middle D, the results showed that NEAT1 overexpression significantly reduced the expression of miR-122-5p.

[0065] 2.4 Occludin is a target gene of miR 122-5p

[0066] In the present invention, the binding site between miR-122-5p and Occludin was predicted by StarBase v2.0 tool. The results are shown in the attached figure. Fig. 9 Further, the results of the dual luciferase reporter gene experiment are shown in the attached Fig. 9 As shown in B, the results showed that miR-122-5p bound to Occludin in a targeted manner.

[0067] The level of miR-122-5p in Caco-2 cells transfected with miR-122-5p mimics and miR-122-5p inhibitor was detected by qRT-PCR. Fig. 9 As shown in middle C, the results showed that after transfection of miR 1225p mimics, the expression of Occludin protein was downregulated, and the addition of urea further reduced the expression of Occludin.

[0068] The relative expression level of Occludin was detected by Western blot and immunofluorescence. The results are shown in the attached Fig. 9 As shown in Figure DF, D-E Western blot method was used to detect the relative level of Occludin; F was used to detect the expression of Occludin by immunofluorescence staining. Fig. 9 As can be seen from the DF, when the miR-122-5p inhibitor was transfected, the opposite effect was observed, the expression of Occludin protein was significantly increased, and the fluorescence intensity was significantly enhanced.

[0069] 2.5LncRNA NEAT1 acts as a ceRNA for miR-122-5p and regulates occludin expression in urea-induced injury in Caco-2

[0070] In order to further explore whether NEAT1 regulates the expression of occludin as a ceRNA of miR-122-5p, the present invention transfected LV-NEAT1, miR-122-5p mimics, and LV-NEAT1+miR-122-5p into Caco-2 cells. The relative level of occludin was detected by Western blot. The results are shown in the attached figure. Fig.10 As shown in A and B, the expression level of mycin was detected by immunofluorescence staining. The results are shown in the attached Fig.10 As shown in C.

[0071] From the attached Fig.10As can be seen in the figure, NEAT1 overexpression promoted the expression of occludin, while miR-122-5p mimics or urea treatment reduced the expression of occludin. In addition, overexpression of miR-122-5p significantly inhibited the effect of NEAT1 on occludin formation. These results indicate that NEAT1 positively regulates the expression of occludin by targeting miR-122-5p.

[0072] In summary, overexpression of NEAT1 upregulates occludin levels by inhibiting miR122-5p, thereby protecting the intestinal epithelial damage induced by uremic toxins. This invention emphasizes for the first time the importance of the interaction between NEAT1, miR-122-5p and occludin. In addition, the NEAT1 / miR-122-5p / occludin axis, as a promising therapeutic target, will provide new ideas and methods for reducing complications and improving the quality of life of patients with uremic syndrome.

[0073] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A marker for diagnosing uremic toxin-induced intestinal epithelial barrier damage, characterized in that: The marker is lncRNA NEAT1.

2. The role of LncRNANEAT1 in the preparation of drugs for the treatment of intestinal epithelial barrier damage induced by uremic toxins.

3. The effect according to claim 2, characterized in that: lncRNA NEAT1 protects against uremic toxin-induced intestinal epithelial barrier damage by regulating the miR-122-5p / occludin axis.

4. The use according to claim 3, characterized in that: lncRNANEAT1 upregulates the expression of Occludin, ZO-1, and Claudin-1 proteins in uremic intestinal epithelial cells, and miR-122-5p is a target of Occludin.

5. The research method of application according to any one of claims 2 to 4, characterized in that: The research method comprises the following steps: S1: Human colon cancer cells were used to establish an intestinal epithelial injury model under different urea treatment conditions; S2: RT-qPCR was used to detect the expression of lncRNANEAT1 and miR-122-5p in cells; S3: Western blot and immunofluorescence were used to detect the expression of tight junction proteins Occludin, ZO-1 and Claudin-1; S4: Sodium fluorescein was used to detect paracellular permeability in the intestinal epithelial injury model; S4: The binding of miR-122-5p with lncRNANEAT1 and Occludin was detected by bioinformatics analysis and dual-luciferase reporter gene assay.

6. Use of a reagent for detecting the expression of lncRNA NEAT1 in cells in the preparation of a serological detection reagent or detection kit for diagnosing uremic toxin-induced intestinal epithelial barrier damage.

7. The use according to claim 6, characterized in that: The reagents for detecting the expression amount of lncRNA NEAT1 in cells include: probes, gene chips, or PCR primers with detection specificity for lncRNA-NEAT1.

Images