Application of specific primers in identification of euphausia superba oil from other oils
By designing specific primers and ionic liquid phase separation technology, the problem of Antarctic krill oil identification was solved, and rapid and accurate oil identification was achieved, avoiding phospholipid hydration and astaxanthin interference, with high sensitivity and strong operability.
Patent Information
- Application Number
- CN202510039341.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-10
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2045-01-10
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify Antarctic krill oil from other oils, especially fish oil and vegetable oil. Conventional methods cause phospholipid hydration or astaxanthin to interfere with detection, and there is a lack of effective identification methods.
By designing specific primers and combining them with ionic liquid and phase separation technology, the oil sample is treated with a solvent system to enrich the bioinformatics substances in Antarctic krill oil. The primers are then used for specific recognition and amplification to achieve rapid identification.
It achieves high-sensitivity identification of Antarctic krill oil and other oils, avoids interference from phospholipid hydration and astaxanthin, and can complete batch sample testing within 40 minutes, with strong operability.
Smart Images

Figure CN119710030B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the field of food chemistry and analytical technology, and in particular to application of specific primers in identification of Antarctic krill oil and other oils. BACKGROUND
[0002] Antarctic krill oil is a marine oil extracted from Antarctic krill or Antarctic krill powder, which is rich in active substances such as polyunsaturated fatty acids, phospholipids and astaxanthin, and has the effects of anti-inflammation, anti-oxidation and improvement of cardiovascular function. Compared with other edible oils, Antarctic krill oil is rich in phosphatidylcholine, and the esterification mode is mainly unsaturated fatty acid esterification, such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), which has significant advantages in transmembrane transport and active release. At the same time, the astaxanthin in Antarctic krill oil is mainly left-handed, which has strong anti-oxidation activity and anti-inflammatory effect. Therefore, Antarctic krill oil is highly recognized by consumers and is widely used in food, health care products and cosmetics.
[0003] In recent years, with the rapid development of the Antarctic krill oil market, some unscrupulous vendors have imitated Antarctic krill oil by using other cheap animal / vegetable oils to make a profit, which greatly infringes the legal rights and health of consumers. At present, there are few reports on the detection and identification methods of Antarctic krill oil at home and abroad, and the detection and identification methods of fish oil or vegetable oil are not suitable for Antarctic krill oil. The main reasons include: (1) Antarctic krill oil retains the phospholipid component due to its unique polyunsaturated fatty acid esterified phospholipid, so the conventional separation or enrichment method will cause the phospholipid to hydrate and cannot carry out subsequent work; (2) the presence of astaxanthin in Antarctic krill oil makes the oil appear bright red or dark red, which interferes with some detection methods based on wavelength absorption or colorimetry, and it is difficult to realize the rapid identification of Antarctic krill oil. Therefore, it is urgent to establish a processing method and detection method based on the physicochemical characteristics of Antarctic krill oil. SUMMARY
[0004] The application provides application of specific primers in identification of Antarctic krill oil and other oils, which is characterized in that a pair of specific primers is designed according to the biological information of Antarctic krill, and then the ion liquid and phase separation technology are used to realize enrichment of biological information substances in Antarctic krill oil and separation of interference items, so as to realize rapid identification of Antarctic krill oil.
[0005] The application is realized by the following technical scheme:
[0006] The application of specific primers in identifying Antarctic krill oil from other oils, the primers being F: 5'-GTATTTTGACCGTGCAAAGG-3', R: 5'-ATAGGGTCTTATCGTCACTT-3', and the other oils being salmon, tuna, cod and soybean oils.
[0007] Further, the application method is:
[0008] Step one, preparation of a solution system: stirring the oil sample to be tested and a non-polar solvent at room temperature until completely dissolved;
[0009] Step two, enrichment and phase separation of biological information substances: adding ionic liquid to the solution system prepared in step one, vortex mixing at room temperature, and then standing and separating;
[0010] Step three, separation and purification of biological information substances: removing the non-polar layer in step one, repeatedly washing the ionic liquid layer with a polar solvent, and centrifuging to retain the precipitate;
[0011] Step four, information identification and identification: using the specific primers to complete the detection and identification of the precipitate in step three.
[0012] Further, the non-polar solvent in step one includes but is not limited to n-hexane, chloroform, dichloromethane, cyclohexane and petroleum ether, etc., which can be used as a solvent for oil dissolution and subsequent phase separation;
[0013] Further, in step one, the ratio of sample to non-polar solvent is 1:(0.5-100), and the mixing temperature is 4-100°C, the mixing method including but not limited to stirring, vortexing, ultrasonic, etc.
[0014] Further, in step two, the types of ionic liquid include but are not limited to quaternary ammonium salt (such as [TBA][Cl]), imidazole (such as [BMIM][BF4]) and pyridine (such as [BuPy][Cl]) and other ionic liquids, and the anions can be formate, acetate, tetrafluoroborate and halogen ions, etc.
[0015] Further, in step two, the liquid mixing method includes but is not limited to stirring, vortexing, ultrasonic, etc., and the mixing temperature is 4-100°C, and the separation method includes but is not limited to standing, centrifugation and cooling induction, etc.
[0016] Further, in step three, the polar solvent includes but is not limited to ethanol, isopropyl alcohol and methanol, etc., which can effectively dissolve ionic liquid and precipitate DNA.
[0017] Further, in step four, the detection includes but is not limited to PCR, qPCR, dPCR and LAMP reaction, etc.
[0018] Compared with the prior art, the present application has the following advantages:
[0019] (1) The Antarctic krill oil contains trace amounts of biological information substances (such as DNA fragments) similar to other oils (such as fish oil and vegetable oil), which are usually present in extremely low concentrations in the oil matrix, and the separation and detection thereof are hindered due to the complexity of the oil matrix. The present application is based on the fact that the biological information substances in the Antarctic krill oil are mainly negatively charged, and the van der Waals surface electrostatic potential (ESP) of different ionic liquids is calculated and analyzed to complete the preliminary screening of the ionic liquids. The present application realizes the effective enrichment and separation of the target substances by virtue of the affinity of the ionic liquids for the biological information substances and the phase separation characteristics between the ionic liquids and the non-polar solvents. In addition, the choline-based ionic liquid can form a hydrogen bond with a specific base pair in the DNA, thereby enhancing the stability of the double-stranded DNA and improving the enrichment effect.
[0020] (2) The present application uses a non-polar solvent to realize phase separation. Not only is the DNA and other substances insoluble in the non-polar solvent, but also the colored substances such as astaxanthin in the Antarctic krill oil can be effectively dissolved in the non-polar solvent layer, thereby avoiding interference with the subsequent experiments. Then, the ionic liquid is repeatedly washed with a polar solvent (such as ethanol). Since the ionic liquid is dissolved in the polar solvent, the insoluble precipitate is collected after centrifugation. Here, the precipitate is mainly DNA.
[0021] (3) The present application is based on the conserved sequence of the Antarctic krill gene, and the specific recognition and amplification of the target sequence are realized by primer design. The present application has the characteristics of high sensitivity and strong operability. In addition, in combination with certain rapid color reaction, such as LAMP, the detection of batch samples can be completed within 40 minutes. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 The Antarctic krill oil is treated by a conventional method to cause the hydration of phospholipids;
[0023] Figure 2 The schematic diagram of the calculation results of the surface electrostatic potential (ESP) of different ionic liquids;
[0024] Figure 3 The effect diagram of the dissolution of the Antarctic krill oil in a non-polar solvent and the phase separation of the ionic liquid;
[0025] Figure 4 The electrophoresis diagram of the specific recognition of the Antarctic krill gene conserved sequence by primers, wherein 1 is Antarctic krill, 2 is tuna, 3 is cod, 4 is salmon, and 5 is soybean;
[0026] Figure 5 The result diagram of the specific implementation case, wherein 1 is Antarctic krill oil, 2 is tuna oil, 3 is cod oil, 4 is salmon oil, and 5 is soybean oil. DETAILED DESCRIPTION
[0027] The technical solutions of the present application are further explained below by examples, but the protection scope of the present application is not limited in any form by the examples.
[0028] Example 1 Different methods for treating Antarctic krill oil result in phospholipid hydration
[0029] This example is to prove the difference between fish oil and Antarctic krill oil, and the use of pure aqueous solution to enrich bio-information substances in oil in the prior art. This method is applicable to fish oil and other plant oils, etc., but not applicable to Antarctic krill oil.
[0030] Take appropriate amount of fish oil and Antarctic krill oil (5g) and place them in a transparent glass bottle, add appropriate amount of water (5mL), stir uniformly and stand still. Fish oil is rich in glycerides and can quickly separate from aqueous solution. Compared with fish oil, Antarctic krill oil has a high phospholipid content and is gelatinous at room temperature. After adding water, the phospholipids are easily hydrated, and effective separation cannot be achieved. At the same time, astaxanthin in Antarctic krill oil is red, and after the hydration of phospholipids, astaxanthin will be unevenly dispersed in the system, which will interfere with subsequent colorimetric detection methods.
[0031] Example 2, specific primer design and optimization: for 16S rRNA in Antarctic krill gene, using DNAMAN and other software, through 16S rRNA comparison between different species, the conserved sequence of Antarctic krill gene is screened and the related primer is designed. The primer sequence is: GTATTTTGACCGTGCAAAGG, ATAGGGTCTTATCGTCACTT. The optimized PCR conditions are: 98℃ pre-denaturation for 2 minutes, then 98℃ denaturation for 10 seconds, then 56℃ annealing for 15 seconds, 72℃ extension for 4 seconds, a total of 30 cycles. The specific recognition of the primer to the conserved sequence of the Antarctic krill gene is shown in the electrophoretogram Figure 4 , and the target band length should be 157bp.
[0032] Example 3
[0033] The samples are Antarctic krill oil, tuna oil, cod oil, salmon oil and soybean oil.
[0034] Step one, preparation of solution system: take 5g of oil sample to be tested, add 25mL of n-hexane, and stir magnetically at 25℃ until completely dissolved;
[0035] Step two, enrichment and phase separation of bio-information substances: add 5mL of ionic liquid to the reaction system, vortex mix at 25℃, and then stand still to separate; calculate the surface electrostatic potential (ESP) of various ionic liquids according to quantum chemistry theory, and the results are shown in Figure 2The ionic liquid [Ch][For] formed by choline cation and formate anion shows obvious positive charge distribution, and the cationic part accounts for 56.0%, which is preferred as the extraction solvent and is consistent with the experimental results.
[0036] Step three, separation and purification of biological information material: due to the difference in polarity and density, the choline ionic liquid [Ch][For] and n-hexane solution are layered, wherein astaxanthin and other colored substances are enriched in the upper n-hexane solution, as shown in Figure 3 , and the DNA and other biological information materials are adsorbed by the choline ionic liquid [Ch][For] in the lower layer. After removing the n-hexane solution, the ionic liquid is repeatedly washed with pre-cooled anhydrous ethanol solution, centrifuged at 12000 rpm for 3 minutes, and the precipitate is retained;
[0037] Step four, information identification and identification: dissolve the precipitate in step three in 20 microliters of TE buffer, then take 1 microliter to amplify using the primers and PCR reaction program of Example 2, and detect the experimental results by agarose electrophoresis. The results are shown in Figure 5 .
[0038] The above is only a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the present application, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.
Claims
1. A method for distinguishing Antarctic krill oil from other oils and fats, characterized in that: The method described is: Step 1: Preparation of solution system: Stir the oil sample to be tested with the non-polar solvent n-hexane at room temperature until completely dissolved; Step 2, enrichment and phase separation of bioinformatics: adding an ionic liquid to the solution system prepared in step 1, vortex mixing at room temperature, and then standing to separate layers; the ionic liquid is [Ch][For]; Step 3, separation and purification of the bioinformatic substance: remove the non-polar layer in step 1 above, repeatedly rinse the ionic liquid layer with a polar solvent, and centrifuge to retain the precipitate; the polar solvent includes but is not limited to ethanol, isopropanol and methanol; Step 4: Information identification and identification: Detect and identify the precipitated material in step 3 using specific primers; The specific primers are F: 5'-GTATTTTGACCGTGCAAAGG-3', R: 5'-ATAGGGTCTTATCGTCACTT-3', and the other oils are salmon, tuna, cod and soybean oils.
2. The method according to claim 1, characterized in that In the step 1, the volume ratio of the sample to the non-polar solvent is 1:(0.5-100).
3. The method according to claim 1, characterized in that In the fourth step, the detection method is a PCR reaction.
Citation Information
Patent Citations
Real time fluorescent PCR detecting primer and probe for food sensibiligen shrimp component, kit and detecting method
CN101748216A
Method for identifying palm oil mixed in fish oil
CN109536637A