Method for detecting meaustralian type monilinia coerulea based on RPA / CRISPR-bio-dCas9

Abstract

The invention discloses a method for detecting meaustralian type monilinia sclerotiorum based on RPA / CRISPR-bio-dCas9. The method comprises the following steps: designing RPA specific primers, constructing an RPA reaction system, designing an sgRNA sequence, constructing bio-dCas9 protein, carrying out RPA / Crispr-bio-dCas9 reaction, and reading a result of lateral flow chromatography test paper. The RPA isothermal amplification method and the lateral flow chromatography test strip are combined, real-time detection of the meaustralian type rock fruit brown rot pathogen can be achieved, the specificity is high, the sensitivity is high, the minimum detection limit is 4 copies / microliter, the detection time is short, and the detection efficiency is high. Meanwhile, reagents such as probes and reporter molecules do not need to be additionally added, the detection cost can be greatly reduced, popularization and application of the technology are facilitated, and powerful technical support is provided for rapid diagnosis of the pathogenic bacteria in different scenes such as customs ports and markets.

Description

Technical Field

[0001] The present invention relates to the technical field of fungal detection, and in particular to a method for rapidly detecting American-Australian type drupe brown rot pathogens based on RPA / CRISPR-bio-dCas9 lateral flow chromatography test paper. Background Art

[0002] Brown rot caused by the American-Australian type stone fruit brown rot fungus (Monilinia fructicola (G. Winter) Honey) is a devastating disease in the world. The pathogen has a wide host range and can infect plants such as peach, pear, apple, papaya, hawthorn, loquat, and grape, seriously affecting the production of peach, plum, apricot, and apple in my country. It can cause serious losses before and after production, and can also harm fruits during storage. It is urgent to establish a rapid and accurate detection technology for the pathogen to achieve accurate detection and early monitoring of the pathogen.

[0003] At present, the detection of this pathogen is mainly based on morphological observation and molecular detection methods such as PCR and LAMP. Traditional methods are time-consuming and labor-intensive, inefficient, and difficult to accurately distinguish from similar species. The established molecular detection methods have played a positive role in the detection and identification of American and Australian stone fruit brown rot pathogens, but there are also some shortcomings: PCR operation is cumbersome and requires high requirements for instruments and equipment; LAMP primer design is complex and has a high false positive rate; RPA has lower specificity than PCR in identifying similar species, and its sensitivity needs to be improved.

[0004] In recent years, due to its strong specificity and high sensitivity, the CRISPR-Cas system has shown great value in molecular diagnosis. The use of this technology in combination with other nucleic acid amplification methods (such as LAMP, RPA, etc.) can further increase specificity and sensitivity, and its products are detected using lateral flow chromatography test strips, color methods, and other methods to achieve instant detection of pathogenic fungi. Existing research on detection technology for plant pathogenic fungi based on the CRISPR-Cas system is mostly based on CRISPR-Cas12, which has strong specificity and high sensitivity, but high cost, which limits its scope of application. Therefore, the development of a rapid, accurate, and low-cost detection method for American and Australian stone fruit brown rot fungus is crucial for the rapid and accurate detection and effective prevention and control of the pathogen. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a method for rapidly detecting American and Australian type stone fruit brown rot pathogens based on RPA / CRISPR-bio-dCas9 lateral flow chromatography test paper.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] The present invention provides a method for detecting American-Australian type stone fruit brown rot pathogens based on RPA / CRISPR-bio-dCas9, comprising the following steps:

[0008] (1) Using the characteristic sequence amplification region MO368 of the American-Australian stone fruit brown rot pathogen as the target DNA sequence, RPA primers were designed, and specific primers were obtained through RPA amplification screening, and the forward primer or reverse primer in the specific primer was FAM-labeled;

[0009] (2) Constructing the RPA reaction system: Combined with the RPA isothermal amplification method, take the sample DNA to be tested, add the specific primers labeled with FAM, shake and mix, and set aside;

[0010] (3) using the specific primers described in step (1), performing RPA amplification on the target DNA sequence, and designing the sgRNA sequence according to the position of the PAM sequence in the RPA amplified fragment;

[0011] (4) Using AviTag plasmid and BirA plasmid, the dCas9 protein is labeled with biotin to obtain bio-dCas9 protein;

[0012] (5) Vortex and mix the sgRNA sequence, bio-dCas9 protein and reaction buffer to obtain a mixed solution, which is placed at room temperature for later use;

[0013] (6) After the RPA reaction system in step (2) is shaken and mixed, the mixed solution in step (5) is added to perform RPA / Crispr-bio-dCas9 reaction;

[0014] (7) After the reaction is completed, add buffer, shake and mix, insert into the lateral flow chromatography test strip, and read the result after time T.

[0015] Preferably, in step (1), the forward primer sequence of the specific primer is shown as SEQ ID NO.1; the reverse primer sequence of the specific primer is shown as SEQ ID NO.2;

[0016] Preferably, in step (1), the forward primer sequence after FAM labeling is: FAM / CATTACCGCGTCGTTTAGTTCGCTAGCCATCTTAC;

[0017] Preferably, in step (2), the RPA reaction system is 70 μL; including: 29.5 μL rehydration buffer, 28.7 μL enzyme-free sterile water, 2.4 μL of 10 μM forward primer of specific primer, 2.4 μL of 10 μM reverse primer of specific primer, 4.5 μL of sample DNA to be tested, and 2.5 μL of magnesium acetate;

[0018] Preferably, in step (3), the sgRNA sequence is as shown in SEQ ID NO.3;

[0019] Preferably, in step (4), the sequence of the bio-dCas9 protein is as shown in SEQ ID NO.4;

[0020] Preferably, in step (5), the concentration of the sgRNA sequence added to the mixed solution is 75 nM, and the volume is 10 μL; the concentration of the bio-dCas9 protein added is 150 nM, and the volume is 15 μL; the volume of the reaction buffer added is 5 μL;

[0021] Preferably, in step (5), the reaction buffer is NEBuffer 2;

[0022] Preferably, in step (6), during the RPA / Crispr-bio-dCas9 reaction, the mixture is first placed in a 37°C constant temperature reactor for reaction for 20 min, then taken out and shaken for mixing, and then placed in a 37°C constant temperature reactor for reaction for 5 min;

[0023] Preferably, in step (7), the lateral flow chromatography test strip contains an anti-FAM antibody labeled with nanogold;

[0024] Preferably, in step (7), the buffer is a test strip detection buffer, the volume of the added buffer is 80 μL, and the time T is 2 min;

[0025] Preferably, in step (7), if both the T line and the C line of the test strip have bands, it indicates a positive sample; if the C line of the test strip has a band and the T line has no band, it indicates a negative sample; if the C line of the test strip has no band, the test is invalid and needs to be repeated.

[0026] The technical solution of the present invention achieves the following beneficial technical effects:

[0027] The present invention develops a rapid and accurate detection method for the American and Australian type drupe brown rot pathogen using a test strip based on RPA / CRISPR-bio-dCas9. The characteristic sequence amplification region MO368 of the American and Australian type drupe brown rot pathogen is used as the target DNA sequence, RPA specific primers are designed, and one of the specific primers is labeled with FAM, and the RPA isothermal amplification method is combined to construct an RPA reaction system; at the same time, the sgRNA sequence is designed according to the Cas9 protein, and the dCas9 protein is labeled with biotin to further construct the RPA / Crispr-bio-dCas9 reaction system, and combined with the lateral flow chromatography technology, the detection of the American and Australian type drupe brown rot pathogen is realized. Among them, the present invention conducts single-factor experiments on factors such as the concentration of RPA specific primers, RPA reaction time, bio-dCas9 concentration, bio-dCas9 / sgRNA concentration ratio, CRISPR-bio-dCas9 reaction time, and the selection of reaction buffer to optimize the best detection system. That is, the present invention combines the RPA isothermal amplification method and the lateral flow chromatography test strip to realize the instant detection of American and Australian type stone fruit brown rot fungi, which has strong specificity, high sensitivity (the minimum detection limit is 4 copies / μL), short detection time and improved detection efficiency.

[0028] The present invention performs biotin labeling on dCas9, and only requires FAM labeling on one of the specific primers (forward or reverse), without the need to add additional probes, reporter molecules and other reagents, which can greatly reduce the detection cost, is beneficial to the promotion and application of the technology, and provides strong technical support for the rapid diagnosis of the pathogen in different scenarios such as customs ports and markets. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The specific implementation modes of the present invention will be further described in detail below in conjunction with the accompanying drawings.

[0030] Figure 1 Schematic diagram of the RPA / CRISPR-bio-dCas9 reaction of the present invention;

[0031] Figure 2 The results of RPA primer screening in Example 1 of the present invention;

[0032] Wherein, M represents DL2000 Marker; 1. American-Australian type stone fruit brown rot fungus (M.fructicola); 2. Stone fruit brown rot fungus (M.laxa); 3. Asian brown rot fungus (M.polystroma); 4. Fruit chain sclerotinia (M.fructigena); CK represents the control with water added;

[0033] Figure 3Figure 2 shows the results of SDS-PAGE and Western blotting of the purified bio-dCas9 protein in Example 2 of the present invention;

[0034] Among them, A is SDS-PAGE; B is Western blotting; Bd represents purified bio-dCas9 protein; MK represents standard control; Ctrl+ represents positive control;

[0035] Figure 4 Activity verification result diagram of sgRNA in Example 3 of the present invention; wherein, M represents DL2000Marker; "+" represents the component added in the reaction; "-" represents the component not added in the reaction; "sgRNA" represents the sgRNA designed in this experiment; "Target DNA" represents the product of PCR amplification of DNA of American-Australian stone fruit brown rot fungus using primer pair Mo368-5F / Mo368-10R.

[0036] Figure 5 Gel electrophoresis results of different RPA primer concentrations in Example 5 of the present invention;

[0037] Among them, M represents DL2000 Marker; CK represents the control with water added;

[0038] Figure 6 Gel electrophoresis results of different RPA reaction times in Example 5 of the present invention;

[0039] Among them, M represents DL2000 Marker; CK represents the control with water added;

[0040] Figure 7 Detection results of different bio-dCas9 concentrations in Example 5 of the present invention;

[0041] Wherein, A is the test strip test result; B is the relative band intensity result of the test strip test strip;

[0042] Figure 8 Detection results of different bio-dCas9 / sgRNA concentration ratios in Example 5 of the present invention;

[0043] Wherein, A is the test strip test result; B is the relative band intensity result of the test strip test strip;

[0044] Fig. 9 Detection results of different CRISPR-bio-dCas9 reaction times in Example 5 of the present invention;

[0045] Wherein, A is the test strip test result; B is the relative band intensity result of the test strip test strip;

[0046] Fig.10 The test results of different reaction buffers in Example 5 of the present invention;

[0047] Wherein, A is the test strip test result; B is the relative band intensity result of the test strip test strip;

[0048] Fig.11 Sensitivity test results of the RPA / CRISPR-bio-dCas9 detection system in Example 7 of the present invention;

[0049] Among them, A is the test results of different copy number test strips; B is the relative band intensity results of different copy number test strips; C is the real-time fluorescence PCR test results of different copy numbers;

[0050] Fig.12 Specificity test results of the RPA / CRISPR-bio-dCas9 detection system in Example 8 of the present invention;

[0051] Among them, A is the gel electrophoresis result; B is the test strip test result; M represents DL2000 Marker; T. American and Australian type drupe brown rot fungus (M.fructicola); 1. Drupe brown rot fungus (M.laxa); 2. Asian brown rot fungus (M.polystroma); 3. Fruit chain sclerotinia (M.fructigena); 4. Sclerotinia sclerotiorum; 5. Soybean southern stem canker fungus (Diaporthe aspalathi); 6. Fusarium moniliforme; 7. Rhizoctonia solani; 8. Verticillium theobromae; 9. Colletotrichum fructicola; 10. Curvularia lunata; 11. Stagonosporopsis cucurbitacearum; 12. Exserohilum turcicum; 13. Cladosporium sp.; 14. Botrysphaeria dothidea; 15. Bipolaris bicolor; 16. Alteranaria alternata; 17. Nigrospora oryze; 18. Epicoccum nigrum; 19. Phomaherbarum; 20. Aspergillosis sp.; 21. Botrytis cinerea; 22. Stemphylium lycopersici; 23. Water; 24. Peach DNA; 25. Apple DNA;

[0052] Fig.13 The test strip detection results of the RPA / CRISPR-bio-dCas9 detection system on actual samples in Example 9 of the present invention. DETAILED DESCRIPTION

[0053] Some of the materials and reagents used in the embodiments of the present invention are as follows:

[0054] The recombinase polymerase amplification (RPA) kit was purchased from TwistDX, UK ( Basic); dCas9 protein was purchased from Shanghai Jinan Technology Co., Ltd.; AviTag (short peptide tag) was purchased from Shanghai Jinan Technology Co., Ltd.; BirA (biotin ligase) was purchased from Shanghai Jinan Technology Co., Ltd.; TwistAmp rehydration buffer was purchased from TwistDX, UK; enzyme-free sterile water was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Milenia-biotec MGHD 1HybriDetect, including: lateral flow chromatography test strips and test strip detection buffer (dipstick assay buffer), was purchased from Beijing Langbo Lide Trading Co., Ltd.; Guide-it TM The Complete sgRNA Screening System kit was purchased from Beijing Liuhetong Economic and Trade Co., Ltd.

[0055] Example 1 Recombinase polymerase amplification (RPA) primer design and reaction system

[0056] According to the primer design principle of RPA, the sequence characterized amplified region (SCAR) MO368 (https: / / doi.org / 10.1094 / PDIS.2004.88.11.1219) of the reported American and Australian stone fruit brown rot pathogen was used as the target DNA sequence to design specific primers. The Basic kit (TwistDx) describes that each reaction system of 50 μL contains 29.5 μL TwistAmp rehydration buffer, 8.65 μL enzyme-free sterile water, 2.4 μL of upstream and downstream primers (10 μM), an appropriate amount of purified DNA template (DNA of American and Australian stone fruit brown rot pathogen), and 2.5 μL of magnesium acetate (MgAc). The reaction system was amplified at a constant temperature of 37°C in a nucleic acid amplifier for 20 minutes, and the RPA reaction was performed. The amplified product was observed by electrophoresis on a 2% agarose gel. After RPA amplification screening, a pair of specific primers were finally screened out. The primer length was 35 bp, and the amplified fragment size was 201 bp. The amplification results are as follows: Figure 2 The primer sequence information is shown in Table 1 (forward primer: Mfla368-FAM-17F; reverse primer: Mfla368-17R). The forward primer of the screened primer pair was labeled with FAM.

[0057] Table 1 Sequence information

[0058]

[0059] Example 2 Bio-dCas9 protein expression and purified protein verification

[0060] The AviTag (short peptide tag) coding sequence was cloned downstream of the dCas9 sequence in the pET28a plasmid and in the same reading frame to construct the pET28a-dCas9-AviTag plasmid. The constructed plasmid was then transformed into the Escherichia coli BL21 (DE3) strain together with the BirA plasmid (biotin ligase) for protein expression. Bacterial cells were cultured at 37 ° C in 2xYT medium containing 50 mg / L kanamycin sulfate. When OD600 reached 0.7, protein expression was induced with 0.5mM β-D-thiogalactopyranoside (IPTG), and 100μM biotin was added to promote biotinylation of dCas9-AviTag fusion protein. Subsequently, the culture was incubated at 18 ° C for 16 hours. After incubation, the bacteria were collected by centrifugation at 6000 g for 20 minutes and then lysed in a buffer containing lysozyme, Tris-HCl (pH 7.5), sodium chloride, imidazole, NP-40, PMSF, glycerol, and a protease inhibitor cocktail. The lysate was then purified using an AKTA Pure system to obtain purified bio-dCas9 protein.

[0061] The purified bio-dCas9 protein sequence information is shown below. The purified bio-dCas9 protein was verified by SDS-PAGE Coomassie Brilliant Blue staining and Western blotting. Figure 3 As shown, the protein molecular weight is about 166.3KD.

[0062] Bio-dCas9 sequence information (SEQ ID NO.4):

[0063]

[0064] Example 3 sgRNA design and activity verification

[0065] The protospacer adjacent motif (PAM) is a short sequence in the CRISPR / Cas system, usually located downstream of the protospacer sequence, and is the target for Cas protein recognition. The special PAM sequence of Cas9 protein is NGG, specific primers (SEQ ID NO.1 / SEQ ID NO.2), target DNA sequence: the characteristic sequence amplification region MO368 of the American and Australian stone fruit brown rot pathogen, the RPA amplification fragment is 201bp, and the target sequence (CTACGGTACTTGCTGTACTA) is designed according to the position of the PAM sequence in this fragment, and sgRNA is synthesized by Qingke Biotechnology Co., Ltd. (sequence information is shown in Table 1).

[0066] Using Guide-it TM The activity of sgRNA was verified using the Complete sgRNA Screening System kit. DNA of the American-Australian stone fruit brown rot fungus was amplified by PCR using a reported specific primer pair (Mo368-5F / Mo368-10R) (https: / / doi.org / 10.1094 / PDIS.2004.88.11.1219). The PCR reaction system was 50 μL, including 25 μL 2X Terra PCR Direct Buffer (with Mg2+, dNTP), 1.5 μL each of the forward and reverse primers, 1 μL Terra PCRDirect Polymerase Mix (1.25U / μL), 19 μL enzyme-free sterile water, and 2 μL DNA of the American-Australian stone fruit brown rot fungus. The reaction conditions were pre-denaturation at 98°C for 2 min; 35 cycles, each cycle condition was denaturation at 98°C for 10 s, annealing at 60°C for 15 s, and extension at 68°C for 30 s; kept at 4°C until removed. The sgRNA activity was verified using PCR amplification products (100 ng).

[0067] sgRNA activity verification: Mix 1μL of the designed sgRNA (50ng / μL) with 0.5μL of Guide-itRecombinant Cas9 Nuclease (500ng / μL) in the kit, incubate at 37℃ for 5min, and then place at 4℃ for use. The sgRNA activity verification system is 15μL, including 5μL PCR amplification product, 1μL 15X Cas9 Reaction Buffer, 1μL 15X BSA, 1.5μL Cas9 / sgRNA mixture (the mixture in the above steps) and 6.5μL enzyme-free sterile water. The reaction system was reacted at 37℃ for 1h, and then at 80℃ for 5min. The reaction product was subjected to 2% agarose gel electrophoresis to observe the cutting activity of sgRNA. The results are as follows Figure 4 shown.

[0068] Example 4 Construction of RPA / CRISPR-bio-dCas9 lateral flow chromatography one-step detection system

[0069] (1) Mix 10 μL 75 nM sgRNA, 15 μL 150 nM bio-dCas9 protein and 5 μL NEBuffer 2 by oscillation to obtain a bio-dCas9-sgRNA-NEBuffer 2 mixed solution, which was placed at room temperature for later use.

[0070] (2) Add 29.5 μL of TwistAmp rehydration buffer, 28.7 μL of enzyme-free sterile water, 2.4 μL (10 μM) of each upstream and downstream primer (specific primer in Example 1), 4.5 μL of purified DNA template (DNA of American and Australian drupe brown rot fungus), and finally add 2.5 μL of magnesium acetate (MgAc), a total of 70 μL, shake and mix, and quickly add the bio-dCas9-sgRNA-NEBuffer 2 mixture to the top of the centrifuge tube.

[0071] (3) RPA / CRISPR-bio-dCas9 reaction: The centrifuge tube was placed in a 37°C thermostatic reactor for reaction for 20 min (RPA reaction), and then the centrifuge tube was taken out and shaken for mixing, and then placed in a 37°C thermostatic reactor again for reaction for 5 min (CRISPR-bio-dCas9 reaction).

[0072] (4) After the reaction is complete, add 80 μL of test strip detection buffer, shake to mix, and insert the lateral flow chromatography test strip. After 2 minutes, read the result and take a photo for storage.

[0073] If both the T line and the C line of the test strip have bands, it indicates that the sample is positive; if the C line of the test strip has a band and the T line has no band, it indicates that the sample is negative; if the C line of the test strip has no band, the test is invalid and needs to be repeated.

[0074] In this detection method, sgRNA guides the biotin-labeled bio-dCas9 protein to bind to the FAM-labeled RPA amplified fragment. The formed FAM-DNA-bio-dCas9-sgRNA complex binds to the anti-FAM antibody labeled with nanogold (Au) when passing through the test strip injection port, and is captured by streptavidin on the T detection line, thereby presenting a positive band (such as Figure 1 shown).

[0075] Example 5 Optimization of the RPA / CRISPR-bio-dCas9 lateral flow chromatography one-step detection system

[0076] Based on the detection system of Example 4, the optimal dosage relationship of the detection system of the present invention was obtained through single-factor experiments on factors such as RPA primer concentration, RPA reaction time, bio-dCas9 concentration, bio-dCas9 / sgRNA concentration ratio, CRISPR-bio-dCas9 reaction time, and selection of reaction buffer.

[0077] Among them, when a certain factor is a variable, the parameter values ​​of other variable factors are: RPA primer concentration 10μM, RPA reaction time 20min, bio-dCas9 concentration 150nM, bio-dCas9 / sgRNA concentration ratio 1:0.5, CRISPR-bio-dCas9 reaction time 5min, and NEBuffer 2 is selected as the reaction buffer.

[0078] (1) Optimization of RPA primer concentration

[0079] The RPA reaction was performed using different primer concentrations (2 μM, 4 μM, 6 μM, 8 μM, and 10 μM). After the reaction was completed, the reaction product was observed by electrophoresis on a 2% agarose gel. The results are as follows: Figure 5 The results showed that the band was brightest and clearest when the primer concentration was 10 μM (see Figure 5 ).

[0080] (2) Optimization of RPA response time

[0081] The RPA reaction was allowed to react for different time periods (5 min, 10 min, 15 min, 20 min, 25 min, 30 min). After the reaction was completed, the reaction product was observed by electrophoresis on a 2% agarose gel. The results were as follows: Figure 6 The results showed that bright and clear bands were visible after 20 minutes of reaction (see Figure 6).

[0082] (3) Optimization of bio-dCas9 concentration

[0083] Different concentrations of bio-dCas9 (0nM, 50nM, 150nM, 200nM, 400nM, 800nM) were used for the reaction. The results showed that when the bio-dCas9 concentration was 150nM, a clear band was visible on the test line (see Figure 7 ).

[0084] Image and data analysis of lateral flow assay: Relative band intensity was analyzed using ImageJ software. The images of lateral flow assay were first converted to grayscale and then inverted to enhance the visibility of the bands. The relative band intensity was determined by calculating the ratio of the mean grayscale value of the test band to the mean grayscale value of the control band. The obtained data were statistically analyzed using R (version 4.4.1) software. The data normality was assessed using the shapiro.test function, and the data homogeneity of variance was assessed using the bartlett.test function. After the data satisfied normal distribution and homogeneity of variance, analysis of variance was performed using the aov function. When significant differences were found, the LSD.test function was used for comparison between groups.

[0085] (4) Optimization of bio-dCas9 / sgRNA concentration ratio

[0086] The reaction was carried out using different bio-dCas9 / sgRNA concentration ratios (0:0, 1:0.2, 1:0.5, 1:1, 1:2, 1:5, 1:10). The results showed that when the bio-dCas9 / sgRNA concentration ratio was 1:0.5, a clear band was visible on the test line (see Figure 8 ).

[0087] (5) CRISPR-bio-dCas9 reaction time optimization

[0088] Using different CRISPR / dCas9 reaction times (0min, 2min, 5min, 7min, 10min, 15min), the results showed that when the reaction time was 5min, clear bands were visible on the test line (see Fig. 9 ). (6) Optimization of NEB buffer for CRISPR-bio-dCas9 detection

[0089] The reaction was performed using different NEB buffers (No buffer, NEBuffer 2, NEBuffer 2.1, NEBuffer 3.1, NEBuffer 4). The results showed that when NEB buffer 2 was used, a clear band was visible on the test line (see Fig.10 ).

[0090] Example 6 Method for detecting American and Australian stone fruit brown rot pathogens based on RPA / CRISPR-bio-dCas9

[0091] This embodiment provides a method for detecting American-Australian stone fruit brown rot pathogens based on RPA / CRISPR-bio-dCas9, comprising the following steps:

[0092] (1) Mix 10 μL 75 nM sgRNA, 15 μL 150 nM bio-dCas9 protein and 5 μL NEBuffer 2 by oscillation to obtain a bio-dCas9-sgRNA-NEBuffer 2 mixed solution, and place it at room temperature for later use;

[0093] (2) The RPA reaction system is 70 μL, including: 29.5 μL TwistAmp rehydration buffer, 28.7 μL enzyme-free sterile water, specific primer mixture (including: forward primer 2.4 μL, 10 μM, reverse primer 2.4 μL, 10 μM), 4.5 μL sample DNA to be tested, and 2.5 μL magnesium acetate;

[0094] (3) After the RPA reaction system is shaken and mixed, the bio-dCas9-sgRNA-NEBuffer 2 mixed solution is added to the top of the RPA reaction system to obtain the RPA / CRISPR-bio-dCas9 reaction system; the system is placed in a 37°C thermostatic reactor for RPA reaction for 20 min, and then taken out and shaken and mixed, and then placed in a 37°C thermostatic reactor for CRISPR-bio-dCas9 reaction for 5 min;

[0095] (4) After the reaction is completed, add 80 μL of test strip detection buffer, shake to mix, and then insert the lateral flow chromatography test strip. Read the result after 2 minutes.

[0096] If both the T line and the C line of the test strip have bands, it indicates that the sample is positive; if the C line of the test strip has a band and the T line has no band, it indicates that the sample is negative; if the C line of the test strip has no band, the test is invalid and needs to be repeated.

[0097] Example 7 Sensitivity test of RPA / CRISPR-bio-dCas9 detection reaction

[0098] Based on the detection method of Example 6 of the present invention, the sensitivity of the method was determined. The established RPA / CRISPR-bio-dCas9 method was used to detect DNA samples of different copy numbers of American and Australian stone fruit brown rot pathogens (0.5 copies / μL, 2 copies / μL, 4 copies / μL, 5 copies / μL, 50 copies / μL, 500 copies / μL). The results showed that the minimum detection limit of the method was 4 copies / μL (see Fig.11 A&B). For comparative analysis, the primers (SZMfC-F / SZMfC-R) and probes (SZMfc-Pb) in the industry standard for American and Australian stone fruit brown rot pathogens "SN / T 3581-2013 Real-time fluorescence PCR detection method for American and Australian stone fruit brown rot pathogens" were used to perform real-time fluorescence PCR detection on DNA samples with different copy numbers (0.5 copies / μL, 2 copies / μL, 4 copies / μL, 5 copies / μL, 50 copies / μL, 500 copies / μL). The reaction system was 10 μL, including 1 μL DNA sample, 5 μL 2×PerfectStartIIProbe qPCR SuperMix UDG, primers and probes with final concentrations of 0.1 μmol / L, and 3 μL ddH2O. The cycling conditions of real-time fluorescence PCR were 50°C for 2 min, 95°C for 10 min, and then 40 cycles, each cycle was 95°C for 15 s and 60°C for 1 min. The fluorescence signal was detected using a Roche LightCycler 480 instrument. The results showed that the minimum detection limit of this method was 4 copies / μL (see Fig.11 C).

[0099] Example 8 RPA / CRISPR-bio-dCas9 detection system specificity test

[0100] Based on the detection method of Example 6 of the present invention, specific detection was performed using DNA of American-Australian stone fruit brown rot pathogen and its similar strains, apple DNA, and peach DNA. After the RPA / CRISPR-bio-dCas9 reaction was completed, the reaction product was observed by electrophoresis on a 2% agarose gel. The results are as follows: Fig.12 As shown in A. The color development result of the test strip is as follows Fig.12 As shown in B.

[0101] The results showed that only positive bacteria of American and Australian drupe brown rot pathogens had amplification bands when amplified by RPA / CRISPR-bio-dCas9, and only positive bacteria of American and Australian drupe brown rot pathogens had clear bands at the test line when detected by RPA / CRISPR-bio-dCas9 (see Fig.12 ).

[0102] Example 9 Actual sample detection of RPA / CRISPR-bio-dCas9 detection reaction

[0103] Based on the detection method of Example 6 of the present invention, DNA of different samples was detected. Artificially inoculated peach and apple fruits and collected cherry positive samples were used to evaluate the applicability of the RPA / CRISPR-bio-dCas9 detection method to plant samples.

[0104] The surface of apples and peaches was disinfected with 70% ethanol, and two 2-mm-thick holes were punched on the surface of the fruit with a 5-mm-diameter drill. 2 μL of 1×10 6 The spore suspension of 1000 g / mL was injected into the wells, and the fruits inoculated with sterile water were used as blank controls. Three replicates were set for each experiment. After inoculation, the fruits were cultured at 25°C for 4 to 5 days. For each fruit, DNA was extracted from tissue 2 cm away from the two inoculation points. DNA from cherry positive samples was also extracted and tested using the developed RPA / CRISPR-bio-dCas9 system. The results showed that all positive samples showed clear bands (see Fig.13 ).

[0105] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the claims of this patent application.

Claims

1. A method for detecting American-Australian stone fruit brown rot pathogens based on RPA / CRISPR-bio-dCas9, characterized in that: The following steps are involved: (1) Using the characteristic sequence amplification region of the American-Australian stone fruit brown rot pathogen as the target DNA sequence, RPA primers were designed, and specific primers were obtained through RPA amplification screening, and the forward primer or reverse primer in the specific primer was FAM-labeled; (2) Constructing the RPA reaction system: Combined with the RPA isothermal amplification method, take the sample DNA to be tested, add the specific primers labeled with FAM, shake and mix, and set aside; (3) using the specific primers described in step (1), performing RPA amplification on the target DNA sequence, and designing the sgRNA sequence according to the position of the PAM sequence in the RPA amplified fragment; (4) Using AviTag plasmid and BirA plasmid, the dCas9 protein is labeled with biotin to obtain bio-dCas9 protein; (5) Vortex and mix the sgRNA sequence, bio-dCas9 protein and reaction buffer to obtain a mixed solution, which is placed at room temperature for later use; (6) After the RPA reaction system in step (2) is shaken and mixed, the mixed solution in step (5) is added to perform RPA / Crispr-bio-dCas9 reaction; (7) After the reaction is completed, add buffer, shake and mix, insert into the lateral flow chromatography test strip, and read the result after time T.

2. The method according to claim 1, characterized in that In step (1), the forward primer sequence of the specific primer is shown as SEQ ID NO.1; the reverse primer sequence of the specific primer is shown as SEQ ID NO.

2.

3. The method according to claim 1, characterized in that In step (2), the RPA reaction system is 70 μL; including: 29.5 μL rehydration buffer, 28.7 μL enzyme-free sterile water, 2.4 μL of 10 μM forward primer, 2.4 μL of 10 μM reverse primer, 4.5 μL of sample DNA to be tested, and 2.5 μL of magnesium acetate.

4. The method according to claim 1, characterized in that In step (3), the sgRNA sequence is shown as SEQ ID NO.

3.

5. The method according to claim 1, characterized in that In step (4), the sequence of the bio-dCas9 protein is shown in SEQ ID NO.

4.

6. The method according to claim 1, characterized in that In step (5), the concentration of the sgRNA sequence added to the mixed solution was 75 nM and the volume was 10 μL; the concentration of the bio-dCas9 protein added was 150 nM and the volume was 15 μL.

7. The method according to claim 1, characterized in that In step (5), the reaction buffer is NEBuffer 2; the volume of the reaction buffer added is 5 μL.

8. The method according to claim 1, characterized in that In step (6), during the RPA / Crispr-bio-dCas9 reaction, the mixture was first placed in a 37°C constant temperature reactor for reaction for 20 min, then taken out and shaken to mix, and then placed in a 37°C constant temperature reactor for reaction for 5 min.

9. The method according to claim 1, characterized in that In step (7), the lateral flow chromatography test strip contains anti-FAM antibody labeled with nanogold; the buffer is a test strip detection buffer, and the volume of the added buffer is 80 μL; and the time T is 2 min.

10. The method according to claim 1, characterized in that In step (7), if both the T line and the C line of the test strip have bands, it indicates that the sample is positive; if the C line of the test strip has a band and the T line has no band, it indicates that the sample is negative; if the C line of the test strip has no band, the test is invalid and needs to be repeated.

Images