RT-PSR (Reverse Transcription-Polymerase Chain Reaction) detection kit for coxsackie virus A6

Abstract

The invention discloses an RT-PSR (Reverse Transcription-Polymerase Chain Reaction) detection kit for coxsackie virus A6 in the technical field of PSR rapid detection kits. The RT-PSR detection kit for coxsackie virus A6 is high in sensitivity, and the detection limit of the coxsackie virus A6 is as low as 1 * 10 < 1 > copies / mu L; the detection time is short, the detection result can be obtained within 60 minutes, while the common fluorescent quantitative PCR takes 120 minutes; the method has low requirements on instruments and equipment, does not need complex detection instruments such as a PCR instrument and a sensor, and judges whether amplification occurs only through color change of an indicator; compared with an immunological technology, the cost is lower, and the sensitivity is higher; the operation is simple, the process does not need to operate complex instruments, and the reaction can be completed only through water bath or metal bath.

Description

Technical Field

[0001] The invention relates to the technical field of PSR rapid detection kits, and in particular to a RT-PSR detection kit for Coxsackievirus A6 type. Background Art

[0002] Coxsackievirus A6 (CVA6) enterovirus is a common virus that infects the human body through the respiratory and digestive tracts. It belongs to the genus Enterovirus of the family Picornaviridae. In 1949, the prototype strain of CVA6, Gdula (GenBank No.: AY421764), was first isolated in the United States.

[0003] The clinical symptoms of children infected with CVA6 are mostly herpangina (HA) and hand, foot and mouth disease (HFMD). In addition, CVA6 infection can cause symptoms such as worsening eczema, varicella zoster, and epididymitis. In some cases, CVA6 infection can also lead to severe meningitis and encephalitis. Unlike Coxsackievirus A16 (CVA16) and Enterovirus 71 (EV71), CVA6 is not only easy to infect children, but also has a high infection rate in adults with normal immune function, and often manifests as atypical HFMD. Israel reported 5 adult cases of CVA6 infection, all of which had symptoms such as fever and severe vasculitis-like rash. In Italy, 10 adults were infected with CVA6 due to contact with children and developed HFMD, of which one patient had onychomycosis and epididymitis.

[0004] In the past, we believed that CVA16 and EV71 were the most common enterovirus genotypes known to cause HFMD. In recent years, due to the use of EV71 vaccines and other factors, the detection rate of EV71 has decreased year by year, while the detection rates of other types of enterovirus, such as CVA6, CVA10, CVA5, and CVA2, have increased year by year, especially CVA6, which has gradually become the main pathogen of hand, foot and mouth disease outbreaks at home and abroad.

[0005] Vaccines are one of the most important measures to prevent infectious diseases. Currently, there are no reports of vaccines targeting diseases caused by CVA6. Due to the diverse clinical manifestations of CVA6 infection, laboratory tests for CVA6 have become a necessary means to diagnose and treat patients in a timely manner and to effectively isolate them. Currently, the commonly used laboratory detection methods mainly include virus isolation and culture, serological testing, and nucleic acid testing. Isolation of enterovirus from clinical samples (throat swabs, feces or anal swabs, herpes fluid, etc.) is the "gold standard" for diagnosing diseases, but virus isolation and culture must be carried out in at least a level II or higher biosafety laboratory. The operation is complicated and time-consuming, and it is not suitable for large-scale clinical pathogen screening. Compared with virus isolation and culture, serological testing is simple to operate and has a short detection time. It is the most commonly used detection method for on-site instant detection, but the results are easily interfered by other substances in the specimen and the sensitivity is not high. The nucleic acid detection method has good specificity and high sensitivity. It can amplify trace amounts of target gene fragments by millions of times in a short period of time. It is currently the most commonly used detection method for clinical detection of CVA6. Nucleic acid detection can be divided into variable temperature nucleic acid amplification technology and isothermal nucleic acid amplification technology according to the reaction temperature. The most commonly used enterovirus detection method in clinical laboratories is real-time fluorescent quantitative reverse transcriptase-polymerase chain reaction (rRT-PCR), which requires repeated temperature cycles of high temperature denaturation, low temperature annealing and appropriate temperature extension. This method has high sensitivity and specificity and needs to be carried out in a specific laboratory. The reagent cost is relatively expensive. It is difficult to carry out related tests in townships, community grassroots hospitals and on-site disease sites with limited experimental conditions. To this end, the present application provides an RT-PSR detection kit for Coxsackievirus A6, which does not require large-scale detection instruments and combines indicators at the downstream end of the amplification for visual detection, providing new ideas for the detection of CVA6. Summary of the invention

[0006] The present invention aims to provide a RT-PSR detection kit, a method of use and application of Coxsackievirus A6, and provides a PSR primer set, a kit and a detection method for detecting Coxsackievirus A6, which can perform specific and rapid on-site detection, thereby improving the disadvantages of the original technology of complicated and time-consuming operation.

[0007] In order to achieve the above object, the present invention provides the following technical solutions: A RT-PSR detection kit for Coxsackievirus A6, comprising the following primers: Upstream primer S1: 5′-acgattcgtacatagaagtatagAACCTCAATGACA GCACGAC-3′; Downstream primer S2: 5′-gatatgaagatacatgcttagcaAAACCACTGATAAGC CGTTG-3′.

[0008] Optimally, the kit further comprises the following reagents: 10×Isothermal Amplification Buffer reaction buffer, dNTPs, MgSO4, BcaBEST DNA polymerase, WarmStart RTx reverse transcriptase, betaine, HNB color development reagent, DEPC water and template RNA.

[0009] Optimized, the Mg 2+ The concentration is 8 mmol / L.

[0010] Optimally, the concentration of the upper primer and the lower primer is 2.4 μmol / L.

[0011] Optimized, also includes a gene sequence positive control containing the CVA6 standard.

[0012] Optimized, the gene sequence of the CVA6 standard is as follows: TTCGTGCAACAGCGGCGCAAGCTAGAGTTGTCAACATACATGCGCTTTGATGCCGAGTTCACTTTTGTGTCCAACCTCAATGACAGCACGACGCCCGGGATGTTGCTGCAGTACATGTATGTGCCACCAGGGGCC CCTAAGCCAGATAGCAGGAAGTCATATCAATGGCAGACTGCTACTAACCCATCGGTATTCGCAAAATTGAGTGATCCACCCCCTCAGGTATCTGTCCCGTTCATGTCGCCAGCAACGGCTTATCAGTGGTTTTAT.

[0013] A method for using a RT-PSR detection kit for Coxsackievirus A6, comprising the following steps: (1) designing and synthesizing the RT-PSR primer set described in claim 1; (2) Prepare an RT-PSR reaction system, wherein the final concentration of the RT-PSR reaction system is: 25 μL, the final concentration of the isothermal amplification buffer is 1×, and the final concentration of Mg 2+The concentration of 8 mmol / L, dNTP Mixture concentration of 1.4 mmol / L, forward primer concentration of 2.4 μmol / L, reverse primer concentration of 2.4 μmol / L, 8U BcaBEST DNA polymerase and 7.5U WarmStartRTx reverse transcriptase, 2 μL of 1.5 mmol / L HNB solution; DEPC water was added to make the total volume of the reaction system reach 25 μL; (3) amplifying the RT-PSR reaction system, performing an amplification reaction on the RT-PSR reaction system at a reaction temperature of 65° C. for 60 min; (4) Amplification product detection: Observe the color change in the reaction tube.

[0014] The invention discloses an RT-PSR detection kit for Coxsackievirus A6 and its application in detecting Coxsackievirus A6.

[0015] Working principle and beneficial effects of the present invention: The present invention has high sensitivity, and the detection limit of Coxsackie virus A6 is as low as 1×10 1 copies / μL; the detection time is short, and the test results can be obtained in 60 minutes, while the commonly used fluorescent quantitative PCR takes 120 minutes; the requirements for instruments and equipment are low, and no complex detection instruments are required, such as: PCR instrument, sensor, etc., and the occurrence of amplification can be judged only by the color change of the indicator; compared with immunological technology, the cost is lower and the sensitivity is higher; the operation is simple, and this process does not require the operation of complex instruments, and only a water bath or metal bath is required to complete the reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Agarose gel electrophoresis of RT-PSR amplification products with different concentrations of primers; Figure 2 Agarose gel electrophoresis diagram of primer amplification products at different reaction temperatures; Figure 3 Agarose gel electrophoresis of RT-PSR amplification products at different reaction times; Figure 4 When HNB is used as an indicator, the color changes before and after the reaction of different concentrations of Mg2+ in the reaction system; Figure 5 To visualize the specificity of the CVA6 RT-PSR detection method; Figure 6 To visualize the sensitivity of the CVA6 RT-PSR detection method; Figure 7 Results for visualizing RT-PSR reactions in clinical samples. DETAILED DESCRIPTION

[0017] The following is further described in detail through specific implementation methods: Example: 1. Design and synthesis of RT-PSR primers PCR primers were designed for the conservative sequence of the CVA6 VP1 gene using Oligo 7 software, and the primer sequences were uploaded to NCBI's online tool Primer Blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast) for verification. The results showed that the primers had good specificity and no cross-reaction with other genes, and could be used for specific amplification of CVA6 enterovirus. The two plant-derived nucleotide sequences downloaded from the literature were verified using NCBI's Primer Blast. The results showed that these two plant-derived sequences could not amplify CVA6 and could be used for spiral amplification of RT-PSR. The two plant-derived sequences were connected to the 5′-end of the above-mentioned PCR primers to obtain RT-PSR primers. The primers were synthesized by Shanghai Invitrogen Gene Co., Ltd. and purified by high-performance liquid chromatography. The sequences are as follows: Upstream primer S1: 5′-acgattcgtacatagaagtatagAACCTCAATGACAGCACGAC-3′; Downstream primer S2: 5′-gatatgaagatacatgcttagcaAAACCACTGATAAGCCGTTG-3′.

[0018] 2. Viral gene extraction Clinical enterovirus nucleic acid-positive samples were extracted using the RNA extraction kit for virus detection produced by Beijing Tiangen Biochemical Technology Co., Ltd.

[0019] 3. Establishment of RT-PSR reaction system, see Table 1 below: Table 1

[0020] 4. Optimization of RT-PSR Amplification Conditions The optimization of primer concentration ratio is as follows: prepare RT-PSR reaction system according to the table, add 1.6 μL, 2.0 μL, 2.4 μL, 2.8 μL, 3.2 μL, and 3.6 μL of 50 μmol / L primer mixture to each PCR reaction tube, respectively. Except for the primer concentration, other reaction components and reaction conditions of each PCR reaction tube remain unchanged. The final concentrations of primers in the 25 μL reaction system are 1.6 μmol / L, 2.0 μmol / L, 2.4 μmol / L, 2.8 μmol / L, 3.2 μmol / L, and 3.6 μmol / L, respectively. DEPC water is used as a negative control. The reaction is carried out at 63°C for 60 min on a PCR instrument. The amplification product is analyzed by 1.5% agarose gel electrophoresis. Figure 1 As shown, NC: RNase-Free ddH2O negative control; 1-6: RT-PSR amplification products corresponding to 1.6 μmol / L, 2.0 μmol / L, 2.4 μmol / L, 2.8 μmol / L, 3.2 μmol / L and 3.6 μmol / L primer 1, respectively; M: 2000 bp DNA Marker.

[0021] The optimization of reaction temperature is as follows: Reaction temperature is an important factor affecting the efficiency of RT-PSR amplification. In order to determine the appropriate reaction temperature for the detection method, this study performed temperature gradient RT-PSR amplification in the temperature range of 59 to 68 °C. The amplified products were analyzed by 1.5% agarose gel electrophoresis. Figure 2 As shown, 1-8: amplification products corresponding to reaction temperatures of 59°C, 59.6°C, 60.8°C, 62.4°C, 64.5°C, 66.2°C, 67.3°C and 68.0°C, respectively; M: 2000 bp DNA Marker.

[0022] The optimization of reaction time is as follows: In order to determine the shortest time for RT-PSR amplification, this study set four different reaction times of 30 min, 40 min, 50 min and 60 min. After the reaction, the amplified products were analyzed by agarose gel electrophoresis to determine the shortest time required for the reaction. Figure 3 As shown, 1-4: RT-PSR amplification products corresponding to reaction times of 30 min, 40 min, 50 min and 60 min, respectively; M: 2000 bp marker.

[0023] Reaction Mg 2+ The concentration of is optimized as follows: In order to quickly interpret the RT-PSR results, 2 μL of 1.5 mmol / L metal ion indicator HNB was added to the established reaction system to assist in the rapid interpretation of the results. The color change of HNB was related to the Mg 2+ concentration, while Mg 2+ It is an important condition for nucleic acid specific amplification, so further investigation on Mg 2+ The concentration was optimized and the Mg in the reaction system was adjusted. 2+ The concentrations were 2 mmol / L, 4 mmol / L, 6 mmol / L, 8 mmol / L, 10 mmol / L and 12 mmol / L. After the reaction, the color change of the reaction system was observed to determine the optimal Mg 2+ Concentration. Figure 4 As shown, 1: No Mg 2+ Negative control; 2: Mg 2+ The final concentration is 2 mmol / L; 3: Mg 2+ The final concentration is 4 mmol / L; 4: Mg 2+ The final concentration is 6 mmol / L; 5: Mg 2+ The final concentration is 8 mmol / L; 6: Mg 2+ The final concentration is 10 mmol / L; 7: Mg 2+ The final concentration is 12 mmol / L.

[0024] 5. Observation of reaction results The above reaction was monitored by gel electrophoresis and real-time color change. Considering the primer concentration of 2.4 μmol / L, Mg 2+ The best amplification effect and color change effect were obtained when the concentration was 8 mmol / L, the reaction temperature was 65℃ and the reaction time was 60 min.

[0025] 6. Specificity Evaluation The specificity of this test method was evaluated as follows: CVA10, CVA16, EV71, which are highly related to CVA6 enterovirus, and several common viruses with high infection rates in children (rotavirus, respiratory syncytial virus, hepatitis C virus, hepatitis B virus, cytomegalovirus) were used as reaction templates to evaluate the specificity of the detection method. The results of the clinical standard diagnostic experiments for the above 8 non-target viruses were all positive and can be used for specific detection. The nucleic acids were extracted from the above viruses, and the detection method established in this study was used to perform parallel detection of the above viral nucleic acids and CVA6 enterovirus nucleic acids, and DEPC water was set as a negative control. After the reaction, the color of the reaction system was observed to determine the results. Figure 5As shown, 1-9: HBV, HCV, RSV, CMV, EV71, CVA10, CVA16, CVA6, RV; NC: RNase-Free ddH2O negative control. The present invention has good specificity.

[0026] 7. Sensitivity evaluation The sensitivity of this detection method was evaluated as follows: (1) Preparation of plasmid standard: The recombinant plasmid standard containing the conservative fragment of CVA6 VP1 gene was prepared by TaKaRa's EASY Dilution was prepared into a 36.6 ng / μL solution, and the number of copies of the plasmid standard was calculated according to the following formula: number of copies (copies / μL) = (6.02×1023)×(ng / uL×10-9) / (DNAlength×660). The prepared plasmid standard solution was diluted 10 times to 101 copies / μL and stored at -20℃ for later use.

[0027] (2) The sensitivity of the established detection method was evaluated using a plasmid standard solution of 108-101 copies / μL, and RNase-Free ddH2O was used as a negative control for parallel reactions. After amplification, the amplified products were analyzed by agarose gel electrophoresis. Figure 6 As shown, A: 1-8: 108-101 copies / μL CVA6 plasmid standard; NC: RNase-Free ddH2O negative control. B: 1-8: M: 2000 bp Marker; 1-8: 108-10 1 copies / μL CVA6 plasmid standard; NC: RNase-Free ddH2O negative control. The sensitivity of the present invention is 1×10 1 copies / μL.

[0028] 8. Clinical sample validation The present invention is used to perform clinical sample verification, as follows: A total of 142 pharyngeal swab samples were collected from children who visited the Third Affiliated Hospital of Zunyi Medical University from March 2022 to May 2022 and were clinically diagnosed with HFMD / HA. Viral nucleic acid was extracted according to the instructions of the viral nucleic acid extraction kit. The detection method established in this study was used for detection, and the commercialized CVA6 enterovirus nucleic acid detection kit (fluorescent probe method) was used as a control method for detection. The number of positive and negative cases of the two detection methods were counted respectively, and the positive coincidence rate, negative coincidence rate, total coincidence rate and Youden index between the detection method established in this study and the control method were calculated, and the Kappa coefficient was used to analyze the consistency between the two detection methods. Using qRT-PCR as a control, it was calculated that the negative coincidence rate of this study was 100%, the positive coincidence rate was 100%, the total coincidence rate was 100%, the Youden index was 1, and the Kappa coefficient was 1 (Table 2). The above data show that the detection results of the detection method established in this study are highly consistent with qRT-PCR. Figure 7 As shown, 1-142 represent clinical samples 1-142 respectively; NC: RNase-Free H2O negative control; Pos: 108 copies / μL CVA6 plasmid standard.

[0029] Table 2 RT-PSR and qRT-PCR detection of 142 clinical samples

[0030] In summary, the present invention has high sensitivity, and the detection limit of Coxsackievirus A6 is as low as 1×10 1 The detection time is short, and the test results can be obtained in 60 minutes, while the commonly used fluorescent quantitative PCR takes 120 minutes. The requirements for instruments and equipment are low, and no complex detection instruments are required, such as PCR instruments, sensors, etc., and the occurrence of amplification can be judged only by the color change of the indicator. Compared with immunological technology, it has lower cost and higher sensitivity. The operation is simple, and this process does not require the operation of complex instruments, and only a water bath or metal bath is required to complete the reaction.

Claims

1. A RT-PSR detection kit for Coxsackievirus A6, characterized in that: Contains the following primers: Upstream primer S1: 5′-acgattcgtacatagaagtatagAACCTCAATGACA GCACGAC-3′; Downstream primer S2: 5′-gatatgaagatacatgcttagcaAAACCACTGATAAGC CGTTG-3′.

2. The RT-PSR detection kit for Coxsackievirus A6 according to claim 1, characterized in that: The kit also includes the following reagents: 10×Isothermal Amplification Buffer reaction buffer, dNTPs, MgSO4, BcaBEST DNA polymerase, WarmStart RTx reverse transcriptase, betaine, HNB color development reagent, DEPC water and template RNA.

3. The RT-PSR detection kit for Coxsackievirus A6 according to claim 2, characterized in that: The Mg 2+ The concentration is 8 mmol / L.

4. The RT-PSR detection kit for Coxsackievirus A6 according to claim 3, characterized in that: The concentration of the upper primer and the lower primer is 2.4 μmol / L.

5. The RT-PSR detection kit for Coxsackievirus A6 according to claim 4, characterized in that: A gene sequence positive control comprising a CVA6 standard was also included.

6. The RT-PSR detection kit for Coxsackievirus A6 according to claim 5, characterized in that: The gene sequence of the CVA6 standard is as follows: TTCGTGCAACAGCGGCGCAAGCTAGAGTTGTCAACATACATGCGCTTTGATGCCGAGTTCACTTTTGTGTCCAACCTCAATGACAGCACGACGCCCGGGATGTTGCTGCAGTACATGTATGTGCCACCAGGGGCC CCTAAGCCAGATAGCAGGAAGTCATATCAATGGCAGACTGCTACTAACCCATCGGTATTCGCAAAATTGAGTGATCCACCCCCTCAGGTATCTGTCCCGTTCATGTCGCCAGCAACGGCTTATCAGTGGTTTTAT.

7. The method for using the RT-PSR detection kit for Coxsackievirus A6 according to claim 6, characterized in that: The following steps are involved: (1) designing and synthesizing the RT-PSR primer set described in claim 1; (2) Prepare an RT-PSR reaction system, wherein the final concentration of the RT-PSR reaction system is: 25 μL, the final concentration of the isothermal amplification buffer is 1×, and the final concentration of Mg 2+ The concentration of 8 mmol / L, dNTP Mixture concentration of 1.4 mmol / L, forward primer concentration of 2.4 μmol / L, reverse primer concentration of 2.4 μmol / L, 8U BcaBEST DNA polymerase and 7.5U WarmStart RTx reverse transcriptase, 2μL of 1.5 mmol / L HNB solution; DEPC water was added to make the total volume of the reaction system reach 25 μL; (3) amplifying the RT-PSR reaction system, performing an amplification reaction on the RT-PSR reaction system at a reaction temperature of 65° C. for 60 min; (4) Amplification product detection: Observe the color change in the reaction tube.

8. Use of the RT-PSR detection kit for Coxsackievirus A6 according to any one of claims 1 to 7 in detecting Coxsackievirus A6.

Images