Fluorescent probe, nucleic acid detection product, nucleic acid detection method and application thereof

Abstract

The invention discloses a fluorescent probe, a nucleic acid detection product, a nucleic acid detection method and application thereof, and belongs to the field of in-vitro diagnosis. The invention provides a fluorescent probe which comprises a fluorescent reporter group marked at the 5'end of the probe and an MGB SQ group marked at the 3 'end of the probe, and the MGB SQ group retains the characteristics of an MGB group and is also connected with a quenching group. Through the marks, the background signal of the fluorescent probe can be obviously reduced, so that the substrate fluorescence value of the fluorescent probe is lower. In addition, through the labeling, the detection fluorescence increment of the fluorescent probe can be improved, and the threshold period (Ct) value is advanced. Therefore, the fluorescent probe provided by the invention has the advantages of high detection specificity, good repeatability, high sensitivity and the like, and has a wide application prospect in actual nucleic acid detection. The method is especially suitable for low-level HIV detection.

Description

Technical Field

[0001] The present invention relates to the field of in vitro diagnostic technology, and in particular to a fluorescent probe, a nucleic acid detection product, a nucleic acid detection method and applications thereof. Background Art

[0002] Human Immunodeficiency Virus (HIV) is the main pathogen that causes Acquired Immunodeficiency Syndrome (AIDS). HIV is a slow virus that infects human immune system cells, destroying the body's T lymphocytes, causing partial or complete loss of immune function, leading to the occurrence of various diseases and ultimately AIDS. At present, AIDS has become an important public health issue that seriously threatens the health of the public nationwide. The number of AIDS patients and deaths has been on the rise in recent years, which has brought great pressure and challenges to the prevention, detection and blood screening of AIDS. Therefore, it is necessary to detect HIV early and carry out antiviral treatment in a timely manner.

[0003] At present, HIV screening methods mainly include enzyme-linked immunosorbent assay (ELISA), chemiluminescence, rapid tests (colloidal gold, colloidal selenium, immunochromatography, etc.), gelatin particle agglutination test, etc. Supplementary tests include Western blotting (WB), strip immunoassay and immunofluorescence test such as enzyme-linked immunosorbent assay, but nucleic acid detection is currently the most sensitive means of HIV detection. Nucleic acid detection is the detection of HIV genes using PCR or transcription-based serial replication methods. It has the advantages of rapidity, efficiency, sensitivity and specificity. It has been used in the early diagnosis of HIV infection and AIDS research. Among them, real-time fluorescence quantitative PCR technology is often used in nucleic acid detection, and MGB ECLIPSE probe is widely used due to its short probe length, good quenching effect, low fluorescence background of the reaction solution, and high resolution.

[0004] In recent years, combined antiretroviral therapy or highly active antiretroviral therapy can effectively block viral replication in patients infected with human immunodeficiency virus, making the viral load in plasma below the detection limit of general testing. Reported results show that the virus may continue to replicate in some patients, but the viral level is too low to be detected. At the same time, it was found that when treatment is interrupted, the plasma viral load will rebound rapidly.

[0005] Therefore, there is an urgent need in this field to develop a viral nucleic acid detection method with low background signal, high sensitivity and accuracy, which is of great significance for the effective prevention and control of HIV.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide a fluorescent probe, a nucleic acid detection product, a nucleic acid detection method and applications thereof to solve the above-mentioned technical problems.

[0008] The present invention is achieved in that:

[0009] In the first aspect, the present invention provides a fluorescent probe, which includes: a fluorescent reporter group labeled at the 5' end of the probe, and MGB SQ labeled at the 3' end of the probe. The MGB SQ group has the characteristics of traditional MGB and is also connected to a quencher group, which can quench the 5' end fluorescent group.

[0010] In a second aspect, the present invention also provides the use of fluorescent probes in the preparation of nucleic acid detection products.

[0011] In a third aspect, the present invention further provides a nucleic acid detection product, which includes the above-mentioned fluorescent probe, and the nucleic acid detection product is selected from a reagent, a kit, a gene chip, an antibody probe or a detector.

[0012] In a fourth aspect, the present invention further provides a method for nucleic acid detection using the fluorescent probe or the nucleic acid detection product, the method is not intended for disease diagnosis, and comprises the following steps:

[0013] (1) Establishing a standard curve between the concentration or copy number of the positive standard and the fluorescence signal intensity;

[0014] (2) Obtaining the fluorescence signal of the sample to be tested, and obtaining the target gene level of the sample to be tested according to the fluorescence signal intensity of the sample to be tested and the standard curve.

[0015] In a fifth aspect, the present invention further provides a method for nucleic acid detection using the fluorescent probe or the nucleic acid detection product, the method is not intended for disease diagnosis, and comprises the following steps:

[0016] The fluorescence signal of the fluorescent probe of the target gene of the sample to be tested and the fluorescence signal of the fluorescent probe of the internal reference gene of the sample to be tested are obtained, and the relative expression level of the target gene of the sample to be tested is obtained according to the difference between the fluorescence signals of the two.

[0017] The present invention has the following beneficial effects:

[0018] The present invention provides a fluorescent probe, wherein the 3' end of the probe is labeled with MGB, and a SQ quenching group is connected to the MGB by covalent bonding. The inventors found that the background signal of the fluorescent probe can be significantly reduced by the above-mentioned labeling, so that the basal fluorescence value of the fluorescent probe is lower. In addition, the above-mentioned labeling helps to increase the detection fluorescence increment of the fluorescent probe, and the threshold cycle (Ct) value is advanced. Therefore, the fluorescent probe provided by the present invention has the advantages of high detection specificity, good repeatability and high sensitivity, and has broad application prospects in actual nucleic acid detection. It is particularly suitable for low-level HIV detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0020] Figure 1 A schematic diagram of the standard curve results established by using the probe of the comparative example group of the present invention to perform qPCR amplification on templates with different copy numbers (A is the standard curve; B is the ΔRn curve diagram);

[0021] Figure 2 It is a fluorescence intensity curve diagram after qPCR amplification of templates with different copy numbers using the probe of the comparative example group of the present invention;

[0022] Figure 3 A schematic diagram of the standard curve results established by using the probes of the embodiment group of the present invention to perform qPCR amplification on templates with different copy numbers (A is the standard curve; B is the ΔRn curve diagram);

[0023] Figure 4 is a fluorescence intensity curve diagram after qPCR amplification of templates with different copy numbers using the probes of the embodiment group of the present invention;

[0024] Figure 5 The concentration of the standard sample in the present invention is 2×10 7 When the number of copies / μL was 20, the probes of the embodiment group and the comparative group were used to perform qPCR detection results (the left figure is a ΔRn (fluorescence increment at a time point) curve; the right figure is a fluorescence intensity curve);

[0025] Figure 6 The concentration of the standard sample in the present invention is 2×10 6When the number of copies / μL was 20, the probes of the embodiment group and the comparative group were used to perform qPCR detection results (the left figure is a ΔRn (fluorescence increment at a time point) curve; the right figure is a fluorescence intensity curve);

[0026] Figure 7 The concentration of the standard sample in the present invention is 2×10 5 When the number of copies / μL was 20, the probes of the embodiment group and the comparative group were used to perform qPCR detection results (the left figure is a ΔRn (fluorescence increment at a time point) curve; the right figure is a fluorescence intensity curve);

[0027] Figure 8 The concentration of the standard sample in the present invention is 2×10 4 When the number of copies / μL was 20, the probes of the embodiment group and the comparative group were used to perform qPCR detection results (the left figure is a ΔRn (fluorescence increment at a time point) curve; the right figure is a fluorescence intensity curve);

[0028] Fig. 9 The concentration of the standard sample in the present invention is 2×10 3 When the number of copies / μL was 20, the probes of the embodiment group and the comparative group were used to perform qPCR detection results (the left figure is a ΔRn (fluorescence increment at a time point) curve; the right figure is a fluorescence intensity curve);

[0029] Fig.10 The concentration of the standard sample in the present invention is 2×10 2 When the number of copies / μL was 20, the probes of the embodiment group and the comparative group were used to perform qPCR detection results (the left figure is a ΔRn (fluorescence increment at a time point) curve; the right figure is a fluorescence intensity curve);

[0030] Fig.11 The amplification curve results of qPCR detection of target biological samples using the probes of the example group and the comparative example group are shown. DETAILED DESCRIPTION

[0031] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0032] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0033] In the first aspect, the present invention provides a fluorescent probe, which includes: a fluorescent reporter group labeled at the 5' end of the probe, an MGB labeled at the 3' end of the probe, and a quencher group covalently linked to the MGB, the quencher group being SQ. The MGB SQ group has the characteristics of the traditional MGB and is also linked to a quencher group, which can quench the 5' end fluorescent group.

[0034] The inventors found that by labeling MGB at the 3' end of the probe and covalently linking MGB to the SQ quenching group, the covalently linked quenching group can improve the fluorescence quenching effect, effectively reduce the background signal, and improve the sensitivity of detection. In addition, compared with labeling MGB ECLIPSE at the 3' end, the 3' end of the probe provided by the present invention labeled with MGB and SQ quenching group can more effectively reduce non-specific binding and background signals, can provide higher fluorescence intensity and specific binding, and improve the detection fluorescence increment. The length of the probe has more selectivity and can meet the design length requirements of the probe with a length of 13-30bp. In addition, the probe provided by the present invention can be applied to multiplex PCR.

[0035] Minor Groove Binder (MGB) is a dihydrocyclopyrrole tripeptide that can selectively bind to the minor groove of DNA molecules, that is, the shallow groove in the DNA helix.

[0036] In a preferred embodiment of the present invention, the fluorescent reporter group includes but is not limited to one or more of carboxyfluorescein (FAM), hexachloro-6-methylfluorescein (HEX), carboxy-X-rhodamine (ROX), cyanine dyes (CY3 or CY5), green fluorescence (VIC), tetrachloro-6-carboxyfluorescein (TET), and 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE).

[0037] In the present invention, MGB SQ is used for quenching in the range of 400-750 nm, and it is feasible as long as the emission wavelength of the fluorescent group is within the above quenching wavelength range.

[0038] In a preferred embodiment of the present invention, cyanine dyes include but are not limited to CY3 or CY5.

[0039] In a preferred embodiment of the present invention, the fluorescent reporter group is FAM.

[0040] In a second aspect, the present invention also provides the use of fluorescent probes in the preparation of nucleic acid detection products.

[0041] In a preferred embodiment of the present invention, the nucleic acid detection product includes but is not limited to a reagent, a kit, a gene chip, an antibody probe or a detector.

[0042] Gene chips include but are not limited to: microfluidic chips, etc.

[0043] The gene chip is selected from the group consisting of a DNA array, a DNA microarray, a DNA chip and a whole genome genotyping array.

[0044] In a preferred embodiment of the present invention, the nucleic acid detection product includes a solid phase, and the probe is coated on the solid phase. The solid phase includes but is not limited to microspheres, plates and membranes; microspheres include but are not limited to: magnetic beads, latex microspheres, etc. Membranes include but are not limited to nitrocellulose membranes, cellulose acetate membranes, etc. Plates include but are not limited to: glass plates, ELISA plates, etc.

[0045] In a preferred embodiment of the present invention, nucleic acid detection is used for nucleic acid detection of microorganisms, animals or plants.

[0046] Microorganisms include but are not limited to bacteria, fungi, viruses, actinomycetes, rickettsia, mycoplasma, chlamydia, and spirochetes.

[0047] In a preferred embodiment of the present invention, the microorganism is selected from bacteria, fungi, viruses, and actinomycetes that can infect a host (plant, animal, or microorganism).

[0048] In a preferred embodiment of the present invention, the microorganism is HIV, including but not limited to HIV-1 and HIV-2.

[0049] In a preferred embodiment of the present invention, the nucleic acid detection product performs nucleic acid detection through a qPCR amplification reaction, and the reaction system of the qPCR amplification reaction includes: a fluorescent probe, an upstream primer, a downstream primer, a qPCR reaction premix and a template DNA.

[0050] qPCR reaction master mix A premixed qPCR reaction system, usually containing PCR buffer, Mg 2+ , stabilizer, and one or more DNA polymerases. For example, it is selected from 2×qPCR Mix (UDG), "2×" means that this is a double concentrated Mix, which needs to be diluted according to the instructions before use. The "UDG" in brackets refers to the inclusion of uracil-DNA glycosylase (Uracil-DNA Glycosylase), which can prevent the re-amplification of PCR products and improve the specificity of qPCR.

[0051] In a preferred embodiment of the present invention, the procedure of the qPCR amplification reaction includes: 50°C ± 0.5°C, 1-2 min; 95°C, 3 min; 95°C, 15 s, 60°C, 30 s, and 45 cycles.

[0052] In one embodiment, keeping the reaction conditions consistent helps ensure the repeatability of the experiment and the reliability of the results. Using the same system and procedure to perform qPCR on standards and samples can ensure that the quantitative results obtained from the standard curve are directly related to the sample results. Consistent conditions help reduce variables, thereby improving the accuracy of the experiment. In qPCR experiments, using a unified reaction system and procedure can improve the efficiency of experimental operations. In addition, unified conditions enable the standard curve established based on the fluorescence signal of the standard to be accurately applied to the quantitative analysis of the sample.

[0053] In a third aspect, the present invention further provides a nucleic acid detection product, which includes the above-mentioned fluorescent probe, and the nucleic acid detection product includes but is not limited to reagents, kits, gene chips, antibody probes or detectors.

[0054] The product form of the above reagents can be powder, liquid preparation, or semi-solid preparation.

[0055] In a preferred embodiment of the present invention, the nucleic acid detection product includes a solid phase, and the probe is coated on the solid phase. The solid phase includes but is not limited to microspheres, plates and membranes.

[0056] In a preferred embodiment of the present invention, the solid phase includes but is not limited to magnetic microspheres, plastic microspheres, plastic microparticles, latex microspheres, microplates, glass, capillaries, nylon and nitrocellulose membranes.

[0057] In a preferred embodiment of the present invention, nucleic acid detection is used for nucleic acid detection of microorganisms, animals or plants;

[0058] In a preferred embodiment of the present invention, the pathogenic microorganism is HIV;

[0059] In a preferred embodiment of the present invention, the nucleotide sequence of the fluorescent probe is as shown in SEQ ID NO.1: GCTCTCTGGCTAACTAGGGAA.

[0060] In a preferred embodiment of the present invention, the nucleic acid detection product further comprises an upstream primer and a downstream primer;

[0061] In a preferred embodiment of the present invention, the upstream primer is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:3.

[0062] SEQ ID NO:2:GGGTCTCTCTGGTTAGACCAGATC;

[0063] SEQ ID NO: 3: GACGGGCACACACTACTTTGAG.

[0064] In other embodiments, the specificity, sensitivity or stability of amplification brought about by adding or subtracting 1-5 bases to the above-mentioned primer or probe sequence is improved or decreased compared with the present invention, which is also within the scope of protection of the present invention.

[0065] In a fourth aspect, the present invention further provides a method for nucleic acid detection using the fluorescent probe or the nucleic acid detection product, the method is not intended for disease diagnosis, and comprises the following steps:

[0066] (1) Establishing a standard curve between the concentration or copy number of the positive standard and the fluorescence signal intensity;

[0067] (2) Obtaining the fluorescence signal of the sample to be tested, and obtaining the target gene level of the sample to be tested according to the fluorescence signal intensity of the sample to be tested and the standard curve.

[0068] A standard curve is established through a series of standards with known concentrations. This curve shows the relationship between the fluorescence signal intensity and the target DNA concentration (or copy number), allowing the concentration of unknown samples to be accurately quantified. In order to ensure the exact concentration of each standard, the standards can be diluted in a gradient. Accordingly, different experiments require the detection of target DNA in different concentration ranges. Through gradient dilution, a series of standards covering a wide concentration range can be created to meet different detection (absolute quantification) requirements.

[0069] The method for establishing a standard curve specifically includes the following steps:

[0070] A qPCR reaction system comprising primers and probes is used to perform a qPCR amplification reaction on the positive standard after absolute quantification to obtain the fluorescence signals of the positive standard at different concentrations (or copy numbers), and a standard curve is established based on the fluorescence signals at different concentrations (or copy numbers).

[0071] In a fifth aspect, the present invention further provides a method for nucleic acid detection using the fluorescent probe or the nucleic acid detection product, the method is not intended for disease diagnosis, and comprises the following steps:

[0072] The fluorescence signal of the fluorescent probe of the target gene of the sample to be tested and the fluorescence signal of the fluorescent probe of the internal reference gene of the sample to be tested are obtained, and the relative expression level of the target gene of the sample to be tested is obtained according to the difference between the fluorescence signals of the two.

[0073] In addition, the fluorescent probe or nucleic acid detection product provided by the present invention can be used for both quantitative and qualitative analysis, that is, whether human immunodeficiency virus exists.

[0074] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0075] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0076] Example 1

[0077] This embodiment provides a fluorescent probe for detecting HIV, the nucleotide sequence of the probe is shown in SEQ ID NO: 1, specifically:

[0078] 5'-GCTCTCTGGCTAACTAGGGAA-3'.

[0079] The probe was labeled with a FAM group at the 5' end and a MGB SQ group at the 3' end. The probe was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0080] Example 2

[0081] 1. This embodiment provides a kit for HIV detection, which includes: the MGB SQ probe prepared in Example 1, an upstream primer (detection primer-F) and a downstream primer (detection primer-R).

[0082] Upstream primer (SEQ ID NO:2-F):

[0083] 5'-GGGTCTCTCTGGTTAGACCAGATC-3';

[0084] Reverse primer (SEQ ID NO:3-R):

[0085] GACGGGCACACACTACTTTGAG-3'.

[0086] All primers and probes used were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0087] 2. Reaction system

[0088] (1) Prepare a positive standard with known concentration or copy number.

[0089] The positive standard was quantified using a UV-visible spectrophotometer. 4 Up to 10 9 times the sample to obtain the copy number or concentration of the positive standard.

[0090] Specifically, the steps are as follows:

[0091] a. Perform gradient dilution of the positive standard:

[0092] In order to establish a standard curve for qPCR, a series of positive standards with known concentrations are required. The stored positive standards (materials known to contain the target DNA sequence) are diluted to the preset concentration required for the experiment to obtain the diluted positive standards as the basis for establishing the standard curve, ensuring that the concentration range of the standards covers the dynamic range of the experimental detection.

[0093] The nucleotide sequence of the positive standard is shown in SEQ ID NO:4, and is as follows:

[0094] GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCT CTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTT GCCTTGAGTGCTCAAAGTAGTGTGTGCCCGTC.

[0095] The specific dilution can be performed using a precise pipette and the concentration of the positive standard can be determined using a UV-Vis spectrophotometer.

[0096] b. According to the concentration of the positive standard determined by UV-visible spectroscopy, take samples of the positive standard with different concentrations and continue to dilute them to 10 4 Up to 10 9 times to obtain a series of dilution samples with different concentrations for qPCR analysis.

[0097] This step is used to establish a standard curve in order to obtain a concentration gradient spanning multiple orders of magnitude. A wide range of concentration gradients is generated in this step, which helps to draw an accurate standard curve. Specifically, the amount of diluent required to be added can be calculated by the dilution formula and operated using a pipette.

[0098] Specifically, the copy number or concentration of the positive standard was quantified according to the following steps: The positive standard was quantified using a UV-visible spectrophotometer, and the copy number or concentration of the positive standard was calculated by the formula: 4 Up to 10 9 times the sample copy number or concentration.

[0099] c. Perform serial dilutions of positive standards with known copy number or concentration.

[0100] The steps include:

[0101] Prepare tube 1, the dilution ratio is 10 μL tube 1 add 90 μL DNA diluent, the final concentration is 2×10 10copies / μL;

[0102] According to tube 1, tubes 2 to 10 are sequentially prepared, including:

[0103] Prepare tube 2 according to tube 1. The dilution ratio is 10 μL of tube 1 plus 90 μL of DNA diluent, and the final concentration is 2×10 9 copies / μL;

[0104] Prepare tube 3 based on tube 2. The dilution ratio is 10 μL of tube 2 plus 90 μL of DNA diluent, with a final concentration of 2×10 8 copies / μL;

[0105] Prepare tube 4 based on tube 3. The dilution ratio is 10 μL of tube 3 plus 90 μL of DNA diluent, with a final concentration of 2×10 7 copies / μL;

[0106] Prepare tube 5 according to tube 4. The dilution ratio is 10 μL of tube 4 plus 90 μL of DNA diluent, and the final concentration is 2×10 6 copies / μL;

[0107] Prepare tube 6 based on tube 5. The dilution ratio is 10 μL of tube 5 plus 90 μL of DNA diluent, and the final concentration is 2×10 5 copies / μL;

[0108] Prepare tube 7 according to tube 6. The dilution ratio is 10 μL of tube 6 plus 90 μL of DNA diluent, and the final concentration is 2×10 4 copies / μL;

[0109] Prepare tube 8 based on tube 7. The dilution ratio is 10 μL of tube 6 plus 90 μL of DNA diluent, with a final concentration of 2×10 3 copies / μL;

[0110] Prepare tube 9 based on tube 8. The dilution ratio is 10 μL of tube 6 plus 90 μL of DNA diluent, with a final concentration of 2×10 2 copies / μL;

[0111] In the serial dilution process, the final concentration was 2×10 7 The target concentration was 200 copies / μL-200 copies / μL.

[0112] As mentioned above, firstly, the required amount needs to be calculated, which can be calculated according to the carrier for the reaction. In the embodiment of the present application, a micro-reaction plate is used as the reaction carrier, such as a 96-well plate.

[0113] The total amount of Mix required is calculated based on the number of reaction wells. The calculation method can be: Mix = (number of reaction wells + 3) × (10 + 0.4 + 0.4 + 0.2 + 4) μL; where the number of reaction wells + 3 represents the loss of 3 wells. Three replicate wells are made for each test sample. The specific concentration of each tube in the gradient dilution process can be referred to Table 1.

[0114] Table 1 Serial dilution of positive standard

[0115] Dilution tube Dilution ratio Final concentration Tube 1 10μL positive standard + 90μL DNA dilution solution <![CDATA[2×10 10 copies / μL]]> Tube 2 10μL tube 1 + 90μL DNA dilution buffer <![CDATA[2×10 9 copies / μL]]> Tube 3 10μL tube 2 + 90μL DNA dilution buffer <![CDATA[2×10 8 copies / μL]]> Tube 4 10μL tube 3 + 90μL DNA dilution buffer <![CDATA[2×10 7 copies / μL]]> Tube 5 10μL tube 4 + 90μL DNA dilution buffer <![CDATA[2×10 6 copies / μL]]> Tube 6 10μL tube 5 + 90μL DNA dilution buffer <![CDATA[2×10 5 copies / μL]]> Tube 7 10μL tube 6 + 90μL DNA dilution buffer <![CDATA[2×10 4 copies / μL <!-- 7 -->]]> Tube 8 10μL tube 7 + 90μL DNA dilution buffer <![CDATA[2×10 3 copies / μL]]> Tube 9 10μL tube 8 + 90μL DNA dilution buffer <![CDATA[2×10 2 copies / μL]]>

[0116] (2) Take a dilution of 10 4 Up to 10 9 The positive standard samples were tested by qPCR.

[0117] Select an appropriate dilution factor to ensure that it is within the sensitivity range of qPCR detection. Take the dilution factor of step (1) b and dilute it by 10 4 Up to 10 9 The samples were diluted to different times for qPCR detection, so as to obtain the fluorescence signal data at different dilution times for absolute quantification. This step is used to ensure that the concentration of the selected samples is suitable for qPCR detection, and to avoid inaccurate quantification due to too high or too low concentration.

[0118] Prepare the reaction system:

[0119] a. Prepare the template-free qPCR reaction mix first. The reaction system is shown in Table 2. After mixing, dispense 15 μL / well into a 96-well plate;

[0120] Table 2 qPCR Mix reaction system

[0121] Components Volume (μL) 2×qPCR Mix (UDG) 10 Detection primer-F (10 μM) 0.4 Detection primer-R (10 μM) 0.4 MGB SQ probe (10μM) 0.2 <![CDATA[ddH2O]]> 4

[0122] b. Dilute the concentration in Table 1 to 2×10 7 Positive standards ranging from copies / μL to 200 copies / μL were added to the qPCR Mix in a 96-well plate, with 5 μL (DNA sample) added to each well, and 3 replicates were performed for each concentration.

[0123] The total amount of Mix solution required needs to be calculated according to the number of reaction wells, and the calculation method can be: Mix solution = (number of reaction wells + 3) × (10 + 0.4 + 0.4 + 0.2 + 4) μL; the number of reaction wells + 3 represents the loss amount of 3 wells. Three replicate wells are made for each test sample.

[0124] c. Program settings:

[0125] 1) Create a detection probe, select the reporter group as "FAM", the quencher group as "NFQ-MGB", and the reference fluorescence as "None".

[0126] 2) In the "Assign target(s) to the selected wells" panel, set the "Task" column of the standard curve wells to "Standard", and assign values ​​of 10000000, 10000000, 1000000, 100000, 10000, 1000 (meaning the number of DNA copies per well, in copies) in the "Quantity" column, and name the corresponding "Samplename" column according to the corresponding concentration.

[0127] 3) Set the amplification program, see Table 3: reaction volume 20 μL, start the run after setting.

[0128] Table 3. Amplification procedures

[0129]

[0130]

[0131] Comparative Example 1

[0132] The primer set used in the comparative example group is:

[0133] MGB probe: 5'-GCTCTCTGGCTAACTAGGGAA-3'; FAM is labeled at the 5' end of the probe, and MGB Eclipse is labeled at the 3' end of the probe. MGB Eclipse pairs a minor groove binder (MGB) tripeptide with a dark quencher. MGB enhances the hybridization reaction, and Eclipse has a wide absorption range and is an important group for synthesizing hydrolysis probes.

[0134] The upstream and downstream primers are the same as those in Example 2.

[0135] It should be noted that the dilution method and detection method of this comparative example are the same as those of Example 2, and the only difference is that the probe labeling group is different.

[0136] Experimental Example 1

[0137] The experimental data of Example 2 and Comparative Example 1 are compared.

[0138] In this experimental example, firstly, a standard curve for human immunodeficiency virus detection was established using different probes, and then the results of the embodiment group and the comparative example group were compared from the dimensions of the linear relationship of the standard curve, the qPCR fluorescence increment, and the probe basal fluorescence value.

[0139] Based on the comparative analysis of qPCR data, ΔRn was used to compare the fluorescence increments of the two probes, and Fluorescence was used to compare the basal fluorescence values ​​of the two probes.

[0140] (1)Reference Figure 1 Middle (A), Figure 3 As can be seen in (A), the standard curves established by the two probes have good linear relationships and can both be used to establish standard curves for human immunodeficiency virus detection.

[0141] (2) Figure 2 The probe basal fluorescence value of the control group was high. Figure 4 The basal fluorescence value of the MGB SQ probe used in the present application is significantly lower, and the light gain increment is also higher than that of the control group probe, which is more conducive to result analysis.

[0142] (3) Furthermore, the qPCR results at each concentration of the standard were analyzed and the fluorescence increment and basal fluorescence values ​​of the two probes were compared. 7 Detection results of the standard with concentrations ranging from copies / μL to 200 copies / μL.

[0143] Reference Figure 5 , Figure 6 , Figure 7 , Figure 8 , Fig. 9 and Fig.10 ,It can be seen from the results that compared with the MGB probe in the comparative example group, the MGB SQ probe in Example 2 has a lower basal fluorescence value and a significantly better fluorescence intensity.

[0144] Example 3

[0145] In this embodiment, the synthesized single-stranded DNA sample is detected.

[0146] 1. Experimental methods:

[0147] Referring to the reaction system and procedure of Example 2, qPCR reaction was performed on the synthesized single-stranded DNA sample, and different primer sets were used to set different experimental groups (example group and comparative example group).

[0148] 2. Result analysis:

[0149] like Fig.11 As shown, compared with the MGB probe in the comparative example group, the MGB SQ probe in the example group detected a higher fluorescence intensity of the target sample and had better sensitivity.

[0150] The logarithmic value of the copy number obtained according to the concentration of the positive standard is the horizontal axis, and the CT value measured by the positive standard is the vertical axis. The standard curve is drawn, and the CT value of the measured sample is input into the equation to obtain the copy number of the sample.

[0151] In summary, by comparing the standard curves, basal fluorescence values, fluorescence increments, etc. established for the two probes (example group and comparative example group), the MGB SQ probe in the example group has lower background fluorescence, better fluorescence increment, and an earlier CT value. By analyzing and comparing the test results, it is concluded that the MGB SQ probe in the example group is superior, and its higher fluorescence increment is more conducive to result analysis. When observing test samples of different concentrations, the comparison is obvious and easy to analyze, thereby improving the accuracy and sensitivity of the experiment. It is worth noting that the MGB probe selected in the comparative example group also has a similar detection effect, but is inferior to the MGB SQ probe.

[0152] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A fluorescent probe, characterized in that It includes: The probe is labeled with a fluorescent reporter group at the 5' end and MGB SQ at the 3' end.

2. The fluorescent probe according to claim 1, characterized in that The fluorescent reporter group is selected from one or more of FAM, HEX, ROX, CY5, VIC, TET, and JOE.

3. The fluorescent probe according to claim 2, characterized in that The length of the probe is 13-30 bp.

4. Use of the fluorescent probe as described in any one of claims 1 to 3 in the preparation of nucleic acid detection products.

5. The use according to claim 4, characterized in that: The nucleic acid detection product is selected from reagents, test kits, gene chips, antibody probes or detectors.

6. The use according to claim 4, characterized in that: The nucleic acid detection product comprises a solid phase, the probe is coated on the solid phase, and the solid phase is selected from microspheres, plates and membranes; Preferably, the nucleic acid detection is for nucleic acid detection of microorganisms, animals or plants; Preferably, the pathogenic microorganism is HIV.

7. The use according to claim 4, characterized in that: The nucleic acid detection product performs nucleic acid detection through a qPCR amplification reaction, and the reaction system of the qPCR amplification reaction includes: the fluorescent probe, an upstream primer, a downstream primer, a qPCR reaction premix and a template DNA; Preferably, the procedure of the qPCR amplification reaction includes: 50°C±0.5°C, 1-2 min; 95°C-98°C, 3-5 min; 95°C, 15 s, 60°C, 30 s, 45 cycles.

8. A nucleic acid detection product, characterized in that: It comprises the fluorescent probe according to any one of claims 1 to 3, wherein the nucleic acid detection product is selected from a reagent, a kit, a gene chip, an antibody probe or a detector; Preferably, the nucleic acid detection product comprises a solid phase, the probe is coated on the solid phase, and the solid phase is selected from microspheres, plates and membranes; Preferably, the nucleic acid detection is for nucleic acid detection of microorganisms, animals or plants; Preferably, the microorganism is HIV; Preferably, the nucleotide sequence of the fluorescent probe is as shown in SEQ ID NO.1; Preferably, the nucleic acid detection product further comprises an upstream primer and a downstream primer; Preferably, the upstream primer is as shown in SEQ ID NO:2, and the downstream primer is as shown in SEQ ID NO:

3.

9. A method for nucleic acid detection using the fluorescent probe according to any one of claims 1 to 3 or the nucleic acid detection product according to claim 8, wherein the method is not intended for disease diagnosis, and is characterized in that: It includes the following steps: (1) Establishing a standard curve between the concentration or copy number of the positive standard and the fluorescence signal intensity; (2) Obtaining a fluorescence signal of the sample to be tested, and obtaining a target gene level of the sample to be tested according to the fluorescence signal intensity of the sample to be tested and the standard curve.

10. A method for nucleic acid detection using the fluorescent probe according to any one of claims 1 to 3 or the nucleic acid detection product according to claim 8, wherein the method is not intended for disease diagnosis, and is characterized in that: It includes the following steps: The target biological sample is amplified using a qPCR amplification reaction system to obtain fluorescence signal data of the target biological sample.

Images