Intelligent dual-mode substance detection method based on divalent nucleic acid aptamer

Abstract

The invention discloses an intelligent dual-mode substance detection method based on a divalent nucleic acid aptamer, which comprises a fluorescence detection mode and a colorimetric detection mode, and belongs to the technical field of analytical chemistry. The divalent aptamer with a double-hairpin structure is complementary with a complementary sequence of the divalent aptamer, and under the action of sodium borohydride and silver nitrate, the divalent aptamer and the complementary sequence of the divalent aptamer are subjected to fluorescence detection and colorimetric detection to obtain the intelligent dual-mode substance detection method based on the divalent nucleic acid aptamer. And respectively forming the DNA silver nano-cluster and the DNA adsorbed silver nano-particles at different time and at different temperatures. In the two detection modes, the divalent aptamers are molecular recognizers, the complementary sequences of the divalent aptamers are signal enhancement probes, rapid and ultra-sensitive detection is achieved by detecting fluorescence and absorbance and analyzing R + B values of colorimetric images through a smartphone APP, the detection method is easy and convenient to operate, efficient and sensitive, the recovery rate and the anti-interference capacity are good in labeling actual sample detection, and the detection method is suitable for large-scale popularization and application. The method has a good application prospect in qualitative and quantitative analysis of aminoglycoside antibiotic compounds.

Description

Technical Field

[0001] The present invention relates to a dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, which can perform highly sensitive and rapid determination of aminoglycoside antibiotic compounds in food, aquatic products, medicines and outdoor environmental samples, and belongs to the technical field of analytical chemistry. Background Art

[0002] Kanamycin, an aminoglycoside antibiotic, is effective in treating Gram-negative bacteria and Gram-negative bacterial infections. Its good anti-infection ability makes it a key component in biomedicine, agriculture, animal husbandry and food industry. However, with the widespread use of kanamycin, researchers have found that its ototoxicity and nephrotoxicity have a higher incidence among aminoglycoside antibiotics, second only to neomycin. Some technicians pointed out that kanamycin is the main cause of deafness in children, which is mostly caused by excessive dosage or long course of treatment. Therefore, excessive doses of kanamycin will have adverse effects on the human body. In order to prevent the excessive use of kanamycin in medical treatment and the enrichment caused by kanamycin residues in animal-derived foods, it is necessary to develop a highly sensitive and specific kanamycin detection method to ensure medical and health care and food safety.

[0003] So far, the detection methods of kanamycin include high performance liquid chromatography (HPLC), gas chromatography (GC), capillary band electrophoresis (CE), microbial analysis, immunoassay, etc., but these methods are not easy to operate and require highly skilled personnel and complex sample pretreatment. Nucleic acid aptamers are a short oligonucleotide sequence or short polypeptide obtained by in vitro screening, which has high affinity and strong specificity for the target molecule. They are usually screened from the nucleic acid sequence library by exponential enrichment ligand system evolution technology. In recent years, there have been a large number of reports on antibiotic detection methods based on nucleic acid aptamers. From the end of the 20th century to the present, nucleic acid aptamers have been widely used in the field of biosensing and are often used as recognition probes for constructing biosensors. Some researchers have constructed more sophisticated and efficient aptamer sensors by dividing a complete aptamer into two split aptamers. Other researchers have also proven that assembling two independent aptamers into a bivalent aptamer as a recognition probe is effective. Generally speaking, compared with monovalent aptamers, multivalent aptamers have higher affinity and the constructed sensor has higher sensitivity. Therefore, the development of multivalent aptamer biosensors has become a new development trend.

[0004] DNA sequences can form two different nanomaterials by mixing with sodium borohydride (NaBH4) and silver nitrate (AgNO3) at different reaction times and temperatures. DNA can form DNA silver nanoclusters (DNA-AgNCs) with NaBH4 and AgNO3 at 0℃ for 4h. DNA-AgNCs are a type of silver nanoclusters synthesized using DNA as a template. Due to their good fluorescence properties, stability and simple synthesis process, they have been widely reported in the field of biosensing. DNA reacts with NaBH4 and AgNO3 at room temperature for 5min to form DNA-adsorbed silver nanoparticles (AgNPs). AgNPs are a good optical nanomaterial that turns dark gray when aggregated and yellow when separated, so they are often used in the construction of colorimetric biosensors.

[0005] The present invention constructs a dual-mode material intelligent detection method based on bivalent nucleic acid aptamers to detect the kanamycin content in aquatic products. In the fluorescence mode, Bivalent Apt is complementary to cDNA bases, making the cytosine position of the Bivalent Apt sequence more dispersed, resulting in weak fluorescence of the synthesized DNA-AgNCs. After adding kanamycin, the conformation of Bivalent Apt changes, so that the fluorescence of the synthesized DNA-AgNCs is significantly enhanced. In the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized silver nanoparticles AgNPs, thereby preventing AgNPs from aggregating. After adding kanamycin, Bivalent Apt falls off the surface of AgNPs, so that the synthesized AgNPs aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. Rapid and ultra-sensitive detection is achieved by detecting fluorescence, absorbance and analyzing the R+B value of the colorimetric image by a smartphone APP. Summary of the invention

[0006] The purpose of the present invention is to propose a dual-mode substance detection method based on bivalent nucleic acid aptamers, which can achieve high sensitivity, high selectivity and portable quantitative detection of kanamycin in complex samples. The detection limit (LOD) of the fluorescence detection mode is 5.98fmol / L, the fluorescence detection mode has high detection sensitivity, the detection process is easy to control, the energy consumption is low, the prepared DNA-AgNCs have good reproducibility, the detection cost is low, the actual detection sample does not require a cumbersome pretreatment process, and the technical requirements for the experimenter are not high. The colorimetric mode has a fast detection speed, mild synthesis conditions, convenient and intuitive results, and a wide detection range. The R+B value of the colorimetric image is measured by a smartphone App, and the portable quantitative analysis of kanamycin is realized in the linear range of 0 to 500μmol / L. The two operation modes verify each other, further reduce the generation of false positive results, and effectively improve the accuracy and precision of the method. A dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers constructed by the present invention has great application potential in Chinese shrimp meat, seawater, fresh water and milk.

[0007] In order to achieve the above object, the present invention discloses a dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, and the specific technical scheme adopted is as follows:

[0008] A dual-mode material intelligent detection method based on bivalent nucleic acid aptamers includes a fluorescence detection mode and a colorimetric detection mode. In the fluorescence detection mode, Bivalent Apt is complementary to cDNA bases, making the cytosine position of the Bivalent Apt sequence more dispersed, resulting in weak fluorescence of the synthesized DNA-AgNCs. After adding kanamycin, the conformation of Bivalent Apt changes, thereby significantly enhancing the fluorescence of the synthesized DNA-AgNCs. The minimum detection limit of this fluorescence mode is as low as 5.98fmol / L; in the colorimetric detection mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized AgNPs, thereby preventing the aggregation of AgNPs. After adding kanamycin, Bivalent Apt falls off the surface of AgNPs, causing the synthesized AgNPs to aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. Rapid and ultra-sensitive detection was achieved by detecting fluorescence, absorbance, and analyzing the R+B value of colorimetric images using a smartphone APP. This colorimetric mode enabled portable rapid quantitative analysis of kanamycin within a linear range of 0 to 500 μmol / L.

[0009] Furthermore, the sequences of Bivalent Apt and cDNA were purchased from Shanghai Shenggong Biotechnology Co., Ltd. The Bivalent Apt sequence is shown in SEQ ID NO.1:

[0010] GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC; the cDNA sequence is shown in SEQ ID NO.2: TAAACCAAGTCCG

[0011] Furthermore, the fluorescence detection mode includes the following steps:

[0012] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge and centrifuge at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for future use.

[0013] (2) Complementation of Bivalent Apt sequence and cDNA sequence: Take 10 μL Bivalent Apt and cDNA respectively, dissolve in 85 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.0), place in a constant temperature metal bath for heating and denaturation, and slowly renature to form a dsDNA structure;

[0014] (3) Recognition of Bivalent Apt and Kanamycin: 10 μL of kanamycin solution of different concentrations was added to the complex of step (2) above, and the mixture was reacted at 37° C. for 60 min, wherein the kanamycin concentration was 500 fmol / L to 50 nmol / L;

[0015] (4) Preparation of DNA-AgNCs signal probe: Add 2 μL of silver nitrate AgNO3 solution to the solution in step (3), shake vigorously for 5 min, and then place it in an ice bath for 90 min. Then, add 2 μL of sodium borohydride NaBH4 solution to the solution and place it in an ice bath in the dark for 240 min to obtain the DNA-AgNCs signal probe, completing the operation of the fluorescence detection mode based on DNA-AgNCs.

[0016] Furthermore, the colorimetric detection mode comprises the following steps:

[0017] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge and centrifuge at 8000 rpm / min for 30 seconds. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for future use.

[0018] (2) Complementation of Bivalent Apt sequence and cDNA sequence: Take 20 μL Bivalent Apt and cDNA respectively, dissolve in 40 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5), place in a constant temperature metal bath for heating and denaturation, and slowly renature to form dsDNA;

[0019] (3) Recognition of Bivalent Apt and Kanamycin: Add different concentrations of kanamycin solution to the complex of step (2), and react at 25° C. for 120 min, wherein the kanamycin concentration is 0 μmol / L to 500 μmol / L;

[0020] (4) Preparation of aptamer-templated silver nanoparticles Apt-templated AgNPs signal probe: add 60 μL of AgNO3 solution to the solution in step (3) and shake to mix, then add 60 μL of NaBH4 solution after ice bath, shake to mix and then react in the dark for 5 min;

[0021] (5) Smartphone analysis of image R+B value: The R+B value of the synthesized image under different concentrations of kanamycin solution was measured by a smartphone app to obtain the correlation between kanamycin concentration and R+B value, thus completing the construction of kanamycin colorimetric smart aptamer sensor based on aptamer-templated silver nanoparticles Apt-templated AgNPs.

[0022] Furthermore, in the fluorescence detection mode step (2), the Bivalent Apt concentration is 4 μmol / L, the cDNA concentration is 2 μmol / L, the Bivalent Apt and cDNA are mixed and heated at 95°C for 5 min, ice bathed for 5 min, the temperature condition for forming the dsDNA conformation is 37°C, and incubated for 120 min.

[0023] Furthermore, in the fluorescence detection mode step (4), the concentration of the AgNO3 solution is 60 μmol / L, and the concentration of the NaBH4 is 60 μmol / L.

[0024] Furthermore, in the colorimetric detection mode step (2), the concentration of Bivalent Apt is 2.5 μmol / L, and the concentration of cDNA is 2 μmol / L.

[0025] Furthermore, in the colorimetric detection mode step (4), the concentration of the AgNO3 solution is 3 mmol / L, and the concentration of the NaBH4 solution is 3 mmol / L.

[0026] Furthermore, in the colorimetric detection mode step (2), Bivalent Apt is mixed with cDNA and placed in a constant temperature metal bath and heated to 95° C. for denaturation for 5 min. The temperature for forming the dsDNA conformation is 37° C. and the incubation time is 120 min.

[0027] The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers disclosed in the present invention has the following advantages compared with the prior art:

[0028] (1) The present invention first designed Bivalent Apt-cDNA as the DNA-AgNCs substrate synthesis sequence, and obtained for the first time a high-sensitivity, high-specificity and high-stability dual-mode material intelligent detection method based on bivalent nucleic acid aptamers. Its fluorescence detection mode combines the principle that the addition of kanamycin causes the conformational change of bivalent Apt, which significantly enhances the fluorescence of synthesized DNA-AgNCs, and the significant affinity of Bivalent Apt for kanamycin. It can detect the kanamycin content in complex samples with high sensitivity, high selectivity and high stability, and the detection limit is as low as 5.98fmol / L.

[0029] (2) Fluorescence detection mode By combining aptamer recognition technology with DNA-AgNCs, a sensing system with dynamic fluorescence enhancement as the kanamycin concentration increases was constructed, and it was used for high-sensitivity and high-specificity detection of kanamycin in Chinese shrimp meat, aquaculture water samples and milk. Compared with other kanamycin detection methods, this kanamycin fluorescence detection mode has the advantages of high sensitivity and fast detection speed, and can be applied to the detection of antibiotics in biomedicine.

[0030] Secondly, the colorimetric detection mode of the present invention opens the double hairpin structure of Bivalent Apt based on the complementary chain formed by Bivalent Apt and cDNA, making Bivalent Apt more easily adsorbed on the surface of synthetic AgNPs, thereby preventing the aggregation of AgNPs. After adding kanamycin, Bivalent Apt falls off the surface of AgNPs, causing the synthetic AgNPs to aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. By detecting the absorbance and analyzing the R+B value of the colorimetric image through a smartphone APP, rapid portable detection is achieved, with a detection limit as low as 0.37μmol / L. The colorimetric detection mode combines aptamer recognition technology with aptamer-templated silver nanoparticle Apt-templated AgNPs colorimetric signal probes to construct a sensing system in which the color of the reaction system gradually deepens as the kanamycin concentration increases, and the extinction coefficient and R+B value dynamically decrease, and is used for high-sensitivity and high-specificity detection of kanamycin in Chinese shrimp meat, two aquaculture water samples and milk.

[0031] In summary, the present invention discloses a dual-mode intelligent material detection method based on bivalent nucleic acid aptamers, in which the two detection modes verify each other, further prevent the generation of false positive results, and effectively improve the accuracy and confidence of the detection. At the same time, the feasibility of kanamycin multivalent aptamers is proved, and the application potential of kanamycin nucleic acid aptamers is deepened; in the fluorescence mode, the hybridization of cDNA and Bivalent Apt sequences makes the position of Bivalent Apt cytosine more dispersed, resulting in weak fluorescence of the synthesized DNA-AgNCS. The addition of kanamycin changes the conformation of Bivalent Apt, thereby significantly enhancing the fluorescence of the synthesized DNA-AgNCs. In the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized AgNPs, thereby preventing AgNPs from aggregating. After adding kanamycin, Bivalent Apt falls off the surface of AgNPs, causing the synthesized AgNPs to aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. Rapid and ultra-sensitive detection is achieved by detecting fluorescence, absorbance and analyzing the R+B value of the colorimetric image through a smartphone APP. The fluorescence method and colorimetric method of this scheme are independent. Their integration not only fully utilizes the advantages of each method, but also improves the accuracy and confidence of the analysis by using dual-mode signals as self-calibration. The present invention is further integrated into a smartphone through clever sequence design and the synthesis of two signal probes, DNA silver nanoclusters DNA-AgNCs and aptamer templated silver nanoparticles Apt-templated AgNPs. This dual-mode material intelligent detection method based on bivalent nucleic acid aptamers has high sensitivity for kanamycin detection and can achieve portable rapid quantitative detection. It has good research value in the field of food safety detection. The dual-mode intelligent detection method is used to detect the kanamycin content of real samples in shrimp meat, lake water, sea water and milk products, which has far-reaching significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is the detection principle diagram.

[0033] Figure 2 It is the fluorescence spectrum of the sensing system with different concentrations of kanamycin added.

[0034] Figure 3 It is the standard curve diagram of the fluorescence detection mode of the sensing system.

[0035] Figure 4 It is the standard curve diagram of the colorimetric detection mode of the sensing system.

[0036] Figure 5 It is the standard curve of the intelligent detection mode of the sensing system. DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with the accompanying drawings: A dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, the detection principle of which is as follows Figure 1 As shown, first, two oligonucleotide chains were designed, one of which was a kanamycin bivalent aptamer: Bivalent Apt, and the other cDNA sequence was designed to be partially complementary to Bivalent Apt. The present invention used Bivalent Apt-cDNA as a template sequence for synthesizing DNA-AgNCs for the first time.

[0038] A dual-mode material intelligent detection method based on bivalent nucleic acid aptamers includes a fluorescence detection mode and a colorimetric detection mode, wherein the synthesized signal probe DNA-AgNCs in the fluorescence detection mode has the characteristic of high fluorescence intensity, which is mainly due to the sophisticated design of the DNA template, such as Figure 1 As shown, the 3' end of Bivalent Apt is a G-rich sequence. In the fluorescence mode, cDNA and Bivalent Apt bases are complementary, making the position of Bivalent Apt cytosine more dispersed, resulting in weak fluorescence of synthesized DNA-AgNCS. The addition of kanamycin changes the conformation of Bivalent Apt, thereby significantly enhancing the fluorescence of synthesized DNA-AgNCs.

[0039] In the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making it easier for Bivalent Apt to adsorb on the surface of synthesized AgNPs, thereby preventing AgNPs from aggregating. After adding kanamycin, Bivalent Apt falls off the surface of AgNPs, causing the synthesized AgNPs to aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. Rapid portable detection is achieved by detecting fluorescence, absorbance, and analyzing the R+B value of the colorimetric image through a smartphone APP.

[0040] Furthermore, the fluorescence detection mode comprises the following steps:

[0041] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge and centrifuge at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store it in a refrigerator at 4°C for later use.

[0042] (2) Complementation of Bivalent Apt sequence with cDNA sequence: 10 μL of 4 μmol / L Bivalent Apt and 10 μL of 2 μmol / L cDNA were dissolved in 85 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.0), heated at 95°C for 5 min, placed on ice for 5 min, and then renatured at 37°C for 120 min to form a dsDNA structure;

[0043] (3) Recognition of Bivalent Apt and Kanamycin: 10 μL of kanamycin solution of different concentrations was added to the complex of step (2) above, and the mixture was reacted at 37° C. for 60 min, wherein the kanamycin concentration was 500 fmol / L to 50 nmol / L;

[0044] (4) Preparation of DNA-AgNCs signal probe: Add 2 μL of 60 μmol / L AgNO3 solution to the solution in step (3), shake vigorously for 5 min, and then place in an ice bath for 90 min. Then, add 2 μL of 60 μmol / L ice-cold NaBH4 solution to the solution, mix well, and place in an ice bath for 240 min. The DNA-AgNCs signal probe can be prepared, and the operation of the fluorescence detection mode based on DNA-AgNCs is completed.

[0045] Furthermore, the colorimetric detection mode comprises the following steps:

[0046] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge and centrifuge at 8000 rpm / min for 30 seconds. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store it in a refrigerator at 4°C for later use.

[0047] (2) Complementation of Bivalent Apt sequence with cDNA sequence: Take 20 μL of 2.5 μmol / L Bivalent Apt and 20 μL of 2 μmol / L cDNA, respectively, dissolve in 40 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5), place in a constant temperature metal bath and heat to 95°C for denaturation for 5 min, then cool to 37°C and incubate for 120 min to form dsDNA conformation;

[0048] (3) Recognition of Bivalent Apt and Kanamycin: Add different concentrations of kanamycin solution to the solution in step (2) above, and react at 25° C. for 120 min, wherein the kanamycin concentration is 0 μmol / L to 500 μmol / L;

[0049] (4) Preparation of aptamer-templated silver nanoparticle Apt-templated AgNPs signal probe: add 60 μL of 3 mmol / L AgNO3 solution to the solution in step (3) and shake to mix, then add 60 μL of 3 mmol / L NaBH4 solution after ice bath, shake to mix and then stand at room temperature for 5 min to obtain aptamer-templated silver nanoparticle Apt-templated AgNPs colorimetric probe;

[0050] (5) Analysis of image R+B value using smartphone: The R+B value of the synthesized aptamer-templated silver nanoparticles (Apt-templated AgNPs) images under different concentrations of kanamycin solution was measured using the smartphone APP “Color picker” to infer the linear relationship between kanamycin concentration and R+B value, thus completing the construction of a kanamycin colorimetric smart aptamer sensor based on aptamer-templated silver nanoparticles (Apt-templated AgNPs).

[0051] Wherein, Bivalent Apt and cDNA were purchased from Shanghai Shenggong Biotechnology Co., Ltd., and the sequence of Bivalent Apt is shown in SEQ ID NO.1:

[0052] GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC; the cDNA sequence is shown in SEQ ID NO.2: TAAACCAAGTCCG.

[0053] Example 1: Drawing of a standard curve for dual-mode intelligent aptamer sensor detection

[0054] (1) Drawing of standard curve for fluorescence detection mode

[0055] Under the optimal detection conditions, the sensitivity of the aptamer sensor was evaluated. The fluorescence emission spectra of kanamycin at concentrations of 500fmol / L, 1pmol / L, 10pmol / L, 100pmol / L, 500pmol / L, 1nmol / L, 10nmol / L and 50nmol / L at an excitation wavelength of 260nm were recorded. The dynamic detection range of the aptamer sensor was determined with the concentration of kanamycin as the horizontal axis and the fluorescence intensity as the vertical axis. Figure 2, and the linear relationship between kanamycin concentration and fluorescence intensity, the linear equation and the detection limit LOD of the aptamer sensor were obtained by calculation.

[0056] Detection procedure: First, take 10 μL of 4 μmol / L Bivalent Apt and 10 μL of 2 μmol / L cDNA and dissolve them in 85 μL TE buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.0), heated at 95°C for 5 min, then ice-bathed for 5 min, renatured at 37°C for 120 min, then added 10 μL of 500 fmol / L, 1 pmol / L, 10 pmol / L, 100 pmol / L, 500 pmol / L, 1 nmol / L, 10 nmol / L and 50 nmol / L kanamycin solutions, reacted at 37°C for 60 min, then added 2 μL of 60 μmol / L AgNO3 solution, vigorously shaken for 5 min, then ice-bathed for 90 min, then added 2 μL of 60 μmol / L ice-cold NaBH4 solution to the solution, mixed and then ice-bathed in the dark for 240 min, then used Infinite-M100PRO multifunctional microplate reader at an excitation wavelength of 260 nm and an emission wavelength of 321 nm to detect the fluorescence intensity of the reaction system, the excitation and emission slits were both 10 nm, and the automatic scanning speed was set to 2000 nm / min. The recovery rate and relative standard deviation were obtained by calculation.

[0057] DNA-AgNCs were synthesized by chemical reduction method. The synthesis process was mainly divided into two steps: first, the dsDNA template chain was mixed with AgNO3, and then NaBH4 was used to trigger the ssDNA and Ag reduction reaction. + Reduction reaction. The specific operation is as follows: First, take 10μL, 4μmol / L Bivalent Apt, and 10μL, 2μmol / L cDNA and dissolve them in 85μL TE buffer (10mmol / L Tris-HCl, 1mmol / L EDTA, pH8.0), heat at 95℃ for 5min, ice bath for 5min, renature at 37℃ for 120min, then add 2μL, 60μmol / L AgNO3 solution, shake vigorously for 5min, ice bath for 90min, then add 2μL, 60μmol / L ice-cold NaBH4 solution, shake and mix, and ice bath in the dark for 240min. Then use Infinite-M100PRO multifunctional microplate reader to detect the fluorescence intensity of the reaction system at an excitation wavelength of 260nm and an emission wavelength of 321nm. The excitation and emission slits are both 10nm, and the automatic scanning speed is set to 2000nm / min. The recovery rate and relative standard deviation are obtained by calculation.

[0058] The performance of the fluorescence detection mode was studied under optimal detection conditions. Figure 3 It can be seen that within the concentration range of 0 to 50 nmol / L, the fluorescence intensity of the fluorescent aptamer sensor increases with the increase of kanamycin concentration. The linear response range between fluorescence intensity and kanamycin concentration (1 pmol / L to 1 nmol / L) was quantitatively derived, and the regression equation was y = 6.098*C + 69377 (R 2 =0.988), where y represents the fluorescence intensity and C represents the kanamycin concentration, see Figure 2 , LOD was determined to be 5.98 fmol / L, which indicates that the fluorescent aptamer sensor we constructed has excellent detection sensitivity and extremely low detection limit.

[0059] (2) Drawing of the standard curve for colorimetric detection mode

[0060] Under the optimal detection conditions, the detection sensitivity of the colorimetric detection mode was evaluated. The absorbance values ​​of kanamycin at a wavelength of 395 nm were recorded at concentrations of 0 μmol / L to 500 μmol / L. The dynamic detection range of the aptamer sensor and the linear relationship between kanamycin concentration and absorbance were determined with the concentration of kanamycin as the horizontal axis and the absorbance as the vertical axis. The linear equation and the detection limit LOD of the colorimetric aptamer sensor were obtained by calculation.

[0061] Detection procedure: First, take 20μL of 2.5μmol / L Bivalent Apt and 20μL of 2μmol / L cDNA, dissolve in 40μLTE buffer (10mmol / L Tris-HCl, 1mmol / L EDTA, pH8.5), add 10μL of 0μmol / L~500μmol / L kanamycin solution after denaturation treatment, and react at room temperature for 120min, then add 60μL of 3mmol / L AgNO3 solution, shake and mix, then add 60μL of 3mmol / L NaBH4 solution, mix and let stand at room temperature for 5min, then use a full-wavelength microplate reader to detect the absorbance of the reaction system at a wavelength of 395nm.

[0062] Aptamer-templated silver nanoparticles Apt-templated AgNPs were synthesized by chemical reduction method. The specific synthesis process is as follows: first, 20 μL of 2.5 μmol / L Bivalent Apt and 20 μL of 2 μmol / L cDNA were dissolved in 40 μL TE buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5), mixed and renatured, and 60 μL of 3 mmol / L AgNO3 solution was added under continuous stirring. After oscillation and mixing, 60 μL of 3 mmol / L NaBH4 solution was added and stirred continuously until the color of the solution changed from colorless to uniform golden yellow. Finally, the solution was purified with a microporous filter membrane (0.45 μm) and kept at 4°C for use.

[0063] The detection performance of this colorimetric detection mode was studied under the optimal detection conditions. Figure 4 It can be seen that within the concentration range of 0 to 500 μmol / L, the absorbance of the aptamer sensor at 395 nm decreases with the increase of kanamycin concentration. The linear response range between absorbance and kanamycin concentration (50 μmol / L to 500 μmol / L) was quantitatively derived, and the regression equation was Y = -0.0005706*C + 2.083 (R 2 =0.992), where Y represents the absorbance value and C represents the kanamycin concentration. Figure 4 As shown in Fig. 1, the LOD was determined to be 17.77 μmol / L.

[0064] Furthermore, the R+B values ​​of the colorimetric images were analyzed using the smartphone APP “Color picker”. Figure 5 It can be seen that within the concentration range of 0 to 500 μmol / L, the R+B value of the colorimetric image decreases with the increase of kanamycin concentration. The corresponding range between the R+B value and the kanamycin concentration (0 μmol / L to 500 μmol / L) was quantitatively derived, and the regression equation was Y = -0.2853*C+213.6(R 2 =0.995), where Y represents the R+B value, and C represents the kanamycin concentration. Figure 4 The LOD was determined to be 0.37 μmol / L.

[0065] Example 2: Detection of the dual-mode intelligent material detection method in actual samples

[0066] In order to investigate the detection capability of the dual-mode intelligent substance detection method in actual samples, the kanamycin content in real samples was detected by spiking real samples with kanamycin, and the recovery rate and relative standard deviation were measured to analyze the detection performance in actual samples.

[0067] First, we selected two aquaculture water samples, seawater and freshwater, for spike recovery experiments. The seawater was taken from Liandao, Haizhou District, Lianyungang, and the freshwater was taken from Jingsi Lake, Jiangsu Ocean University. The two aquaculture water samples were filtered multiple times using a 0.22μm sterile filter membrane before use to remove particulate matter, and then the pH of the water samples was adjusted to neutral with sodium acetate buffer. 10μL of water samples with different concentrations of kanamycin (final concentrations were 50pmol / L, 100pmol / L, 50μmol / L, and 100μmol / L, respectively) were taken for spike recovery experiments.

[0068] Pretreatment of milk: Milk samples were purchased from a local supermarket. 20% acetic acid was added dropwise to 50 mL of milk sample until its pH dropped to 4.6. The sample was then placed in a 45 °C water bath for 20 min to precipitate casein, and then centrifuged at 10,000 rpm for 20 min to remove protein and fat coagulation. The supernatant was collected and filtered with a 0.22 μm filter membrane to remove lipids. The kanamycin solution was then added to the prepared milk supernatant and the experimental procedures were followed.

[0069] Before the experiment, the shrimp meat was pretreated. Fresh Chinese shrimp purchased from the Lianyungang seafood market were cleaned and minced with a meat grinder. Then 5g of the sample was mixed with 5mL of ultrapure water. The resulting supernatant was collected, centrifuged at 10000rpm for 2min, and filtered through a 0.22μm filter membrane to remove impurities. The supernatant was used to dilute the kanamycin standard solution to obtain kanamycin dilutions with final concentrations of 50pmol / L, 100pmol / L, 50μmol / L, and 100μmol / L. The detection signal was analyzed by a fluorescent / colorimetric smart aptamer sensor.

[0070] By analyzing the detection signal results, we found that the dual-mode intelligent detection method based on bivalent nucleic acid aptamers had a recovery rate of 94.1% to 104.6.1% for 50pmol / L and 100pmol / L kanamycin in seawater, freshwater, Chinese shrimp meat and milk in the fluorescence detection mode. The corresponding relative standard deviation (RSD) ranged from 3.95% to 6.07%. In the colorimetric detection mode, the recovery rates of 50μmol / L and 100μmol / L kanamycin in seawater, freshwater, Chinese shrimp meat and milk were 95.09% to 104.41%. The corresponding relative standard deviation (RSD) ranged from 3.99% to 6.15%. All the results confirmed that the dual-mode intelligent detection method based on bivalent nucleic acid aptamers constructed by us has excellent detection performance and practical application value in complex samples.

[0071] The specific samples and test results are shown in Table 1:

[0072] Table 1 Actual sample test table

[0073]

[0074] The above are all preferred embodiments of the present invention. For ordinary technicians in this technical field, without departing from the principle of the present invention, various equivalent modifications to the present invention belong to the protection scope of the claims attached to this application.

Claims

1. A dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, characterized in that: The dual-mode material intelligent detection method based on bivalent nucleic acid aptamers includes a fluorescence detection mode and a colorimetric detection mode. In the fluorescence mode, the bivalent aptamer Bivalent Apt complements the complementary DNA cDNA base, so that the cytosine position of the Bivalent Apt sequence is more dispersed, resulting in weak fluorescence of the synthesized DNA silver nanocluster DNA-AgNCs. After adding kanamycin, the conformation of Bivalent Apt changes, so that the fluorescence of the synthesized DNA-AgNCs is significantly enhanced; in the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of the synthesized silver nanoparticles AgNPs, thereby preventing the aggregation of AgNPs. After adding kanamycin, Bivalent Apt falls off the surface of AgNPs, so that the synthesized AgNPs aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. Rapid and ultra-sensitive detection is achieved by detecting fluorescence, absorbance and analyzing the R+B value of the colorimetric image by a smartphone APP.

2. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: The Bivalent Apt sequence is shown in SEQ ID NO.1: GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC; the cDNA sequence is shown in SEQ ID NO.2: TAAACCAAGTCCG.

3. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: The minimum detection limit of the fluorescence detection mode is 5.98 fmol / L, and the fluorescence detection mode includes the following steps: (1) Preparation of DNA mother solution: balance the centrifuge tube containing DNA powder and place it in a centrifuge for centrifugation at 8000 rpm / min for 30 s. After the centrifugation, add double distilled water and shake to mix well so that the DNA powder is fully dissolved. Accurately quantify the DNA sample solution to 100 μmol / L and store it at 4°C for later use. (2) Complementation of Bivalent Apt sequence with cDNA sequence: 10 μL of Bivalent Apt and cDNA were taken respectively, dissolved in 85 μL of buffer for reaction to form a dsDNA structure, wherein the pH value of the buffer was 8.0; (3) Recognition of Bivalent Apt and kanamycin: 10 μL of kanamycin solution of different concentrations was added to the complex of step (2), and the reaction was carried out at 37°C for 60 min. The kanamycin concentration was 500 fmol / L~50 nmol / L. (4) Preparation of DNA-AgNCs signal probe: Add 2 μL AgNO3 solution to the solution in step (3), shake vigorously for 5 min, and then place on ice for 90 min. Then, add 2 μL NaBH4 solution to the solution and place on ice for 240 min in the dark to obtain the DNA-AgNCs signal probe, thus completing the operation of the fluorescence detection mode based on DNA-AgNCs.

4. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: The colorimetric detection mode comprises the following steps: (1) Preparation of DNA stock solution: balance the centrifuge tube containing DNA powder and place it in a centrifuge for centrifugation at 8000 rpm / min for 30 seconds. After the centrifugation, add double distilled water and shake to mix well to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for later use. (2) Complementation of Bivalent Apt sequence with cDNA sequence: Take 20 μL of Bivalent Apt and cDNA respectively, dissolve them in 40 μL of buffer to react to form a dsDNA structure, the pH value of the buffer is 8.5; (3) Recognition of Bivalent Apt and kanamycin: adding kanamycin solutions of different concentrations to the complex of step (2) and reacting at 25°C for 120 min, wherein the kanamycin concentration is 0 μmol / L to 500 μmol / L; (4) Preparation of aptamer-templated silver nanoparticles (Apt-templated AgNPs) signal probe: add 60 μL of AgNO3 solution to the solution in step (3) and shake to mix well. After ice bath, add 60 μL of NaBH4 solution, shake well and react in the dark for 5 min. (5) Analysis of image R+B value using smartphone: The R+B value of the synthesized aptamer-templated silver nanoparticles (Apt-templated AgNPs) images in different concentrations of kanamycin solution were measured using a smartphone app to obtain the correlation between kanamycin concentration and R+B value, thus completing the construction of a kanamycin colorimetric smart aptamer sensor based on aptamer-templated silver nanoparticles (Apt-templated AgNPs).

5. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 3, characterized in that: In the step (2), the concentration of Bivalent Apt is 4 μmol / L, and the concentration of cDNA is 2 μmol / L. After the Bivalent Apt and cDNA are mixed, they are heated at 95° C. for 5 min and ice-bathed for 5 min. The temperature condition for forming the dsDNA conformation is 37° C. and incubated for 120 min.

6. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 3, characterized in that: In the step (4), the concentration of the AgNO3 solution is 60 μmol / L, and the concentration of the NaBH4 is 60 μmol / L.

7. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 4, characterized in that: In step (3), the concentration of Bivalent Apt is 2.5 μmol / L, and the concentration of cDNA is 2 μmol / L.

8. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 4, characterized in that: In the step (4), the concentration of the AgNO3 solution is 3 mmol / L, and the concentration of the NaBH4 solution is 3 mmol / L.

9. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 4, characterized in that: In the step (2), Bivalent Apt and cDNA are mixed and placed in a constant temperature metal bath and heated to 95°C for denaturation for 5 minutes. The temperature for forming the dsDNA conformation is 37°C and the incubation time is 120 minutes.

Images