Edible lactobacillus for relieving pulmonary fibrosis and application thereof

Abstract

The invention is applicable to the technical field of biology, and provides edible lactobacillus for relieving pulmonary fibrosis and application thereof, the edible lactobacillus for relieving pulmonary fibrosis provided by the embodiment of the invention is named as lactobacillus plantarum ZYHL3, is preserved in China Center for Type Culture Collection (CCTCC), has a preservation number of CCTCC No: M 2025127, has a preservation number of CCTCC No: M 2025127, and has a preservation number of CCTCC No: M 2025127, a preservation number of CCTCC No: M 2025127, a preservation number of CCTCC No: M 2025127, a preservation number of CCTCC No: M 2025127, and a preservation number of CCTCC No: M 2025127. Lung inflammation and pulmonary fibrosis of mice can be remarkably relieved and disease prognosis can be improved by adjusting intestinal flora diversity and metabolic profiles, so that a new thought can be provided for preventing and treating pulmonary fibrosis diseases such as idiopathic pulmonary fibrosis and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an edible lactobacillus for alleviating pulmonary fibrosis and an application thereof. Background Art

[0002] Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive interstitial lung disease and the most common pulmonary fibrosis. Its main pathological features are diffuse alveolitis, alveolar structural disorder, and pulmonary fibrosis. Clinically, it often manifests as dry cough and progressively worsening dyspnea. IPF often occurs in the elderly, with a median survival of 2-5 years after diagnosis, and a 5-year survival rate of 20%-25%. IPF is difficult to diagnose in the early stages, and there is currently no effective clinical treatment, and the prognosis is extremely poor. At present, except for lung transplantation, existing drugs and treatments can only relieve the symptoms of IPF patients or delay the progression of the disease, and cannot fundamentally reverse the condition and cure the disease.

[0003] Changes in intestinal microbes can affect the immune function of the lungs, and the lung immune system can also affect the microbial community in the intestine through blood circulation. The interaction between them is called the "gut-lung" axis. Metagenomic studies have found that the intestinal flora of patients with pulmonary fibrosis is unbalanced, and animal experiments have confirmed that intervention in the intestinal flora can effectively treat bleomycin-induced pulmonary fibrosis model mice.

[0004] Probiotics are a type of active microorganisms that are beneficial to the host by colonizing in the human body and changing the composition of the bacterial flora in a certain part of the host. Lactobacillus from natural plant sources, as a safe and edible probiotic, has shown potential therapeutic value in animal models of diseases such as non-alcoholic fatty liver disease, obesity, and colon cancer. Therefore, it is urgent to find an edible probiotic that can treat pulmonary fibrosis to solve the above technical problems. Summary of the invention

[0005] The object of the present invention is to provide an edible lactobacillus for alleviating pulmonary fibrosis, aiming to solve the problems raised in the background technology.

[0006] In view of the above problems, the present invention is implemented in this way: an edible lactobacillus for alleviating pulmonary fibrosis is provided, which is named Lactobacillus plantarum (Lactiplantibacillus sp.) ZYHL3, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC No: M 2025127, and a deposit address of Wuhan University, Wuhan, China, and a deposit date of January 14, 2025.

[0007] Another object of the present invention is to provide an application of the above-mentioned edible lactobacillus in the preparation of a medicine for preventing and treating pulmonary fibrosis.

[0008] Preferably, the edible lactobacillus is used to significantly reduce lung inflammation and pulmonary fibrosis in mice by regulating the diversity and metabolic profile of intestinal flora.

[0009] Preferably, the pulmonary fibrosis disease comprises idiopathic pulmonary fibrosis.

[0010] Another object of the present invention is to provide a drug for preventing and treating pulmonary fibrosis, comprising a pharmaceutically acceptable carrier and the above-mentioned edible lactobacillus.

[0011] Preferably, the pulmonary fibrosis disease comprises idiopathic pulmonary fibrosis.

[0012] Preferably, the carrier is physiological saline.

[0013] Preferably, the concentration of the edible lactobacillus is (3-7)×10 9 CFU / mL.

[0014] The embodiment of the present invention provides an edible lactobacillus strain for alleviating pulmonary fibrosis, named Lactobacillus plantarum (Lactiplantibacillus sp.) ZYHL3, which can significantly reduce lung inflammation and pulmonary fibrosis in mice and improve disease prognosis by regulating intestinal flora diversity and metabolic spectrum, thereby providing new ideas for preventing and treating pulmonary fibrosis diseases such as idiopathic pulmonary fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of the experimental effects of three lactobacilli on BLM-induced pulmonary fibrosis in mice.

[0016] Figure 2 This is the Kaplan-Meier survival analysis result of each group of mice during the experiment.

[0017] Figure 3 The figure is a comparison of the weight changes of mice in each group.

[0018] Figure 4 This is a comparison chart of the lung coefficients of mice in each group at the end of the experiment.

[0019] Figure 5 Representative histopathological HE staining images of lung tissues of mice in each group at the end point of the experiment (scale bar: 50 μm).

[0020] Figure 6 Representative histopathological Masson staining images of lung tissues of mice in each group at the end point of the experiment (scale bar: 50 μm).

[0021] Figure 7This is a comparison chart of spzapiel scores of HE staining of mouse lung tissue.

[0022] Figure 8 This is a comparison chart of Ashcroft scores of Masson staining of mouse lung tissue.

[0023] Fig. 9 This is a representative graph of the relative expression levels of fibronectin, α-SMA and collagen I in the lung tissues of each group of mice detected by western blot.

[0024] Fig.10 This is the result of statistical analysis of the band diagram using Image J software.

[0025] Fig.11 This is the Shannon index analysis chart of the α-diversity of intestinal flora in three groups of mice.

[0026] Fig.12 This is the Simpson index analysis chart of the α-diversity of intestinal flora in the three groups of mice.

[0027] Fig.13 PCoA plot of β diversity of different populations based on weighted UniFrac distance.

[0028] Fig.14 This is a comparison of the relative abundance of intestinal flora at the phylum level among the three groups of mice.

[0029] Fig.15 Cluster heat map analysis of the relative abundance of intestinal flora among groups based on the genus level.

[0030] Fig.16 This is an evolutionary diagram of the relative abundance of intestinal flora in different groups.

[0031] Fig.17 The LDA score bar graph shows species with significant differences in abundance among groups (LDA score (log 10) > 2 and P < 0.05).

[0032] Fig.18 This is the PLS-DA analysis result diagram of the Con and BLM groups.

[0033] Fig.19 Figure 2 shows the PLS-DA analysis results of the BLM and LA groups.

[0034] Fig. 20 Figure 2 shows the PLS-DA analysis results of the Con and LA groups.

[0035] Fig.21 This is a volcano plot comparing the BLM group and the Con group.

[0036] Fig. 22 This is a volcano plot comparing the LA group and the BLM group.

[0037] Fig.23 Figure 2 is a heat map of differentially expressed metabolites.

[0038] Fig.24 This is the result of KEGG pathway enrichment analysis of differential metabolites between the Con group and the BLM group.

[0039] Fig.25 Figure 2 shows the results of KEGG pathway enrichment analysis of differential metabolites between the BLM group and the LA group. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0041] The present invention isolates a strain of Lactobacillus plantarum (Lactiplantibacillus sp.) from Northeastern sauerkraut, hereinafter referred to as Lactobacillus LA, and further studies have found that Lactobacillus LA improves the survival rate and body weight of mice with bleomycin (BLM)-induced pulmonary fibrosis model, reduces the lung coefficient, and alleviates lung inflammation and pulmonary fibrosis-related indicators in mice. Further studies have found that LA partially restored the species diversity of intestinal flora disrupted by BLM and changed the metabolic spectrum. Because it is derived from edible sauerkraut, LA is natural, safe, and has no side effects in the treatment of pulmonary fibrosis. In addition, its "medicine and food are of the same origin" feature will improve the compliance of IPF patients with treatment, and has potential value as a long-term treatment for IPF patients.

[0042] Specifically, in one embodiment of the present invention, an edible lactobacillus for alleviating pulmonary fibrosis is provided, which is named Lactobacillus plantarum (Lactiplantibacillus sp.) ZYHL3, deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC No: M 2025127, a deposit address of Wuhan University, Wuhan, China, and a deposit time of January 14, 2025.

[0043] In another embodiment of the present invention, there is also provided a use of the above-mentioned edible lactobacillus in the preparation of a medicine for preventing and treating pulmonary fibrosis.

[0044] In a preferred embodiment of the present invention, the edible lactobacillus is used to significantly reduce lung inflammation and pulmonary fibrosis in mice by regulating the diversity and metabolic profile of intestinal flora.

[0045] In a preferred embodiment of the present invention, the pulmonary fibrosis disease includes idiopathic pulmonary fibrosis.

[0046] In another embodiment of the present invention, a drug for preventing and treating pulmonary fibrosis is provided, comprising a pharmaceutically acceptable carrier and the above-mentioned edible lactobacillus.

[0047] In a preferred embodiment of the present invention, the pulmonary fibrosis disease includes idiopathic pulmonary fibrosis.

[0048] In a preferred embodiment of the present invention, the carrier is physiological saline.

[0049] In a preferred embodiment of the present invention, the concentration of the edible lactobacillus is (3-7)×10 9 CFU / mL.

[0050] The Lactobacillus plantarum LA selected in the embodiment of the present invention can significantly reduce lung inflammation and pulmonary fibrosis in mice and improve disease prognosis by regulating the diversity and metabolic spectrum of intestinal flora, thereby providing a new idea for preventing and treating pulmonary fibrosis diseases such as idiopathic pulmonary fibrosis.

[0051] In order to prove the efficacy of edible lactobacillus, some examples are listed below to conduct verification experiments on the efficacy of edible lactobacillus.

[0052] Example 1: This example provides a method for isolating and identifying strain LA, as follows: Take the sauerkraut juice from a household in Northeast China and place it in a 50 mL centrifuge tube and store it temporarily at 4°C. Let it stand for 10 minutes to allow the solid matter in the sauerkraut to settle. Dilute the sauerkraut juice in a 15 mL centrifuge tube with sterile saline in a clean bench (multiple: 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6), they were streaked on MRS plates and cultured in a 37°C incubator for about 48 hours. Colonies grew out and single clones were picked up and further streaked on the plates for purification twice. They were sent to Jilin Kumei Sequencing Company for 16s rDNA sequencing. The sequencing results were confirmed by BLAST comparison on the NCBI website. The strain LA was similar to the Strasbourg Lactobacillus plantarum with the deposit number DSM 16365. The strain LA was identified as Lactobacillus plantarum (Lactiplantibacillus sp.), named ZYHL3, and deposited in the China Center for Type Culture Collection with the deposit number CCTCC No: M 2025127. The deposit address is Wuhan University, Wuhan, China, and the deposit time is January 14, 2025.

[0053] The primer sequences used for sequencing include primers 27F and 1492R; the nucleotide sequence of primer 27F is shown in the sequence table SED ID NO: 1, specifically: AGAGTTTGATCCTGGCTCAG; the nucleotide sequence of primer 1492R is shown in the sequence table SED ID NO: 2, specifically: TACGGTTACCTTGTTACGACTT.

[0054]

[0055] Example 2: This example provides a method for modeling mice with pulmonary fibrosis and a lactobacillus gavage scheme, which are as follows: Seventy 6-8-week-old C57BL / 6 mice were selected and fed in an SPF animal room for one week and randomly divided into sham control (Con), BLM, BLM+LA, BLM+LB, and BLM+LC groups, with 14 mice in each group. Mice in the BLM+LA, BLM+LB, and BLM+LC groups were gavaged with 200 mL of the corresponding lactobacilli (concentration 5×10 9 CFU / mL, diluted with sterile saline), the BLM+LA group was gavaged with the strain LA isolated in Example 1; the BLM+LB group was gavaged with Lactobacillus coryniformis subsp. coryniformis, which was purchased from the Korean Type Culture Collection and has a collection number of KCTC 3167 (Lactobacillus coryniformis subsp. coryniformis); the BLM+LC group was gavaged with Lactobacillus brevis LC, which was purchased from the American Type Culture Collection and has a collection number of ATCC 14869 (Lactobacillus brevisBb14), and the gavage was paused for two days for every 5 days. The sham control group and the BLM group were gavaged with an equal volume of sterile saline at the same time. On the 8th day after the start of gavage with lactobacillus, BLM (5 mg / kg) was injected into the trachea of ​​mice in the BLM group, BLM+LA group, BLM+LB group, and BLM+LC group, and an equal volume of sterile saline was injected into the mice in the Con group. On the 21st day after BLM intratracheal administration, the mouse feces were collected, various data were recorded, the mice were killed and tissue specimens were collected: the survival status, body weight, and lung tissue weight of the mice were recorded, the lung coefficient was calculated, the left lung was fixed with paraformaldehyde, and after paraffin embedding, HE staining and Masson staining were performed to observe pathological changes, and the remaining lung tissue was retained for subsequent western blot detection. At the same time, the collected mouse feces were sent for 16S amplicon and non-targeted metabolomics detection. The results of the above experiments are shown in Figure 1-Figure 25 As shown, the details are as follows: 1. LA alleviated BLM-induced pulmonary fibrosis in mice, while LB and LC had no significant effect. Figure 1-Figure 8 ; Figure 1 Schematic diagram of the experimental effects of three lactobacilli on BLM-induced pulmonary fibrosis in mice. Figure 2 The figure shows the Kaplan-Meier survival analysis results of each group of mice during the experiment. It can be seen that LA intervention effectively reduced the mortality of mice treated with BLM, while LB and LC intervention had no significant effect on the survival rate of mice (using Log-rank test, *: P < 0.05; ***: P < 0.001).

[0056] Figure 3 The figure shows the weight changes of mice in each group. It can be seen that the three strains of Lactobacillus alleviated the weight loss of mice caused by BLM toxicity, and LA had the most obvious alleviating effect (analyzed by one-way ANOVA statistical method, *: P < 0.05; **: P < 0.01; ***: P < 0.001; ****: P < 0.0001).

[0057] Figure 4 The figure is a comparison of the lung coefficients of mice in each group at the end point of the experiment, where lung coefficient = lung wet weight (g) / body weight (kg). It can be seen from the figure that LA reduced the pulmonary edema of mice caused by BLM, while LB and LC had no significant effect (analyzed by one-way ANOVA statistical method, *: P < 0.05; ****: P < 0.0001).

[0058] Figure 5 and Figure 6 The representative histopathological images of the lung tissues of mice in each group at the end point of the experiment show that LA alleviated the inflammatory cell infiltration of lung tissues caused by BLM, reduced the thickness of alveolar walls, and reduced collagen deposition in lung tissues.

[0059] Figure 7 and Figure 8 The comparison charts are respectively the Spzapiel score of HE staining of mouse lung tissue and the Ashcroft score of Masson staining. The quantitative analysis indicates that LA alleviates BLM-induced lung injury and lung fibrosis in mice, while LB and LC have no significant effect. (Analyzed by one-way ANOVA statistical method, **: P < 0.01; ***: P < 0.001; ****: P < 0.0001) LA reduced the expression of fibrosis genes in lung tissue of BLM-induced pulmonary fibrosis model mice, while LB and LC had no significant effect. Figure 9-10 shown.

[0060] Fig. 9 This is a representative graph of the relative expression levels of fibronectin, α-SMA and collagen I in the lung tissues of each group of mice detected by western blot. Fig.10 Image J software was used for statistical analysis of the band graphs. Data are mean ± standard deviation (n = 6), *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001.

[0061] LA alleviates intestinal flora dysbiosis in BLM-induced pulmonary fibrosis in mice. Figure 11-Figure 17 shown. Fig.11 and Fig.12 These are the Shannon index analysis and Simpson index analysis results of the α-diversity of the intestinal flora of the three groups of mice. It can be seen that although there are no significant differences in the Shannon index and Simpson index of the intestinal flora of the three groups of mice, LA partially restored the diversity of the intestinal flora community reduced by BLM.

[0062] Fig.13 The PCoA diagram of β diversity of different groups based on weighted UniFrac distance. The results showed that the species composition of intestinal flora in the Con group and the BLM group was significantly different, while the LA group showed a species composition between the Con group and the BLM group, which further proved that LA partially alleviated the ecological imbalance of the flora caused by BLM. Fig.14 This is a comparison of the relative abundance of intestinal flora at the phylum level among the three groups of mice. Fig.15 Cluster heat map analysis of the relative abundance of intestinal flora among groups based on the genus level. Fig.16 This is an evolutionary diagram of the relative abundance of intestinal flora in different groups. Fig.17 The LDA score bar graph shows species with significant differences in abundance between groups (LDA score (log 10) > 2 and P < 0.05). Through LEfSe analysis, it was found that there were species with significant differences and high abundance in the intestinal flora of mice in different groups, such as Proteobacteria at the phylum level and Neisseria at the genus level in the BLM group, Lactobacillaceae at the family level and Ligilactobacillus at the genus level in the LA group. Proteobacteria and Neisseria have been reported to promote the occurrence and development of some diseases, while Lactobacillaceae and Ligilactobacillus have been reported to be negatively correlated with the severity of some diseases.

[0063] 4. Non-targeted metabolomics analysis of mouse intestinal contents. To investigate the effect of LA on the metabolome of the mouse intestinal microbiome, liquid chromatography-mass spectrometry (LC-MS) was used to analyze the composition of mouse cecal contents. Figure 18-Figure 25 shown.

[0064] Figure 18-Figure 20 This is a graph of the PLS-DA analysis results; the figure shows that there are significant differences in the metabolite levels in the intestinal contents of mice in the Con and BLM groups, the BLM and LA groups, and the Con and LA groups.

[0065] like Fig.21As shown in the volcano plot, compared with the Con group, the levels of 48 metabolites were increased and the levels of 57 metabolites were decreased in the BLM group (the set parameter thresholds were: importance projection (VIP) > 1.0, fold change (FC) > 2, and p value < 0.05).

[0066] like Fig. 22 The volcano plot showed that compared with the BLM group, the LA group had 76 metabolites with increased levels and 159 metabolites with decreased levels (the set parameter thresholds were: importance projection (VIP) > 1.0, fold change (FC) > 2, and p value < 0.05).

[0067] Fig.23 The heat map of differentially expressed metabolites shows the overall changes in the levels of differential metabolites among the three groups.

[0068] Fig.24 The figure shows the results of KEGG pathway enrichment analysis of differential metabolites between the Con group and the BLM group, which shows that after airway administration of BLM, significant changes occurred in carbohydrate metabolism, cofactor and vitamin metabolism, lipid metabolism, and amino acid metabolism in mouse feces.

[0069] Fig.25 Figure 2 is the result of KEGG pathway enrichment analysis of differential metabolites between the BLM group and the LA group, which shows that the differentially expressed metabolites between the BLM group and the LA group are also enriched in carbohydrate metabolism, lipid metabolism and amino acid metabolism, especially lipid metabolism.

[0070] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An edible lactobacillus for alleviating pulmonary fibrosis, characterized in that: It was named Lactiplantibacillus sp. ZYHL3 and deposited in China Center for Type Culture Collection with the deposit number CCTCCNo: M 2025127.

2. Use of the edible lactobacillus according to claim 1 in preparing a medicine for preventing and treating pulmonary fibrosis.

3. The use according to claim 2, characterized in that: The edible lactobacillus is used to significantly reduce lung inflammation and pulmonary fibrosis in mice by regulating the diversity and metabolic spectrum of intestinal flora.

4. The use according to claim 2, characterized in that: The pulmonary fibrosis disease includes idiopathic pulmonary fibrosis.

5. A drug for preventing and treating pulmonary fibrosis, comprising a pharmaceutically acceptable carrier, characterized in that: Also included is the edible lactobacillus as claimed in claim 1.

6. The drug for preventing and treating pulmonary fibrosis according to claim 5, characterized in that: The pulmonary fibrosis disease includes idiopathic pulmonary fibrosis.

7. The drug for preventing and treating pulmonary fibrosis according to claim 5 or 6, characterized in that: The carrier is physiological saline.

8. The drug for preventing and treating pulmonary fibrosis according to claim 7, characterized in that: The concentration of the edible lactobacillus is (3-7)×10 9 CFU / mL.

Images