Hybridoma cell strain XXML-2G11A7 as well as preparation method and application thereof

Abstract

The invention relates to the field of detection, in particular to a hybridoma cell strain XXML-2G11A7 as well as a preparation method and application thereof. The preservation number of the hybridoma cell strain XXML-2G11A7 is CGMCC NO: 46139, the preservation date is November 21, 2024, the preservation unit is China General Microbiological Culture Collection Center, and the address of the preservation unit is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing; the antibody secreted by the hybridoma cell strain XXML-2G11A7 disclosed by the invention can be used for specifically detecting dimethomorph, and is high in sensitivity and good in accuracy.

Description

Technical Field

[0001] The present invention relates to the field of detection, and in particular to a hybridoma cell line XXML-2G11A7 and a preparation method and application thereof. Background Art

[0002] Dimethomorph is a widely used fungicide that can inhibit the formation of fungal cell walls and cause the decomposition of spore sac walls, thereby leading to the death of fungi. It is particularly effective against Peronospora and Phytophthora fungi and is mainly used in crops such as cauliflower, grapes, and potatoes. Although dimethomorph has low toxicity, its residues in food are still valued due to its high frequency of use. The residue limit requirements for dimethomorph in some edible agricultural products vary greatly, with the maximum difference being 4,000 times, and the residue limits for some edible agricultural products are relatively low, which places high demands on detection technology.

[0003] At present, the main methods for detecting and analyzing oxadiazine residues include instrumental methods such as liquid chromatography, gas chromatography, liquid chromatography-mass spectrometry and gas chromatography-mass spectrometry, but these instrumental methods require the use of expensive instruments and equipment, with high detection costs and long detection time, and are not suitable for rapid on-site detection of pesticide residues. Compared with instrumental analysis methods, immunoassay has the advantages of being fast, simple, real-time, easy to conduct on-site detection, simple sample pretreatment, high sensitivity, strong selectivity, and suitable for high-throughput analysis, and can significantly reduce the detection cost. Summary of the invention

[0004] The purpose of the present invention is to provide a hybridoma cell line XXML-2G11A7 and a preparation method and application thereof in view of the deficiencies in the prior art.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] The first aspect of the present invention is to provide a hybridoma cell line XXML-2G11A7, with a deposit number of CGMCC NO: 46139, a deposit date of November 21, 2024, and a deposit unit of the China General Microbiological Culture Collection Center. The deposit unit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] Preferably, the nucleotide sequence of XXML-2G11A7-VH is as shown in SEQ ID NO: 1 (GAGGTGCAGCTTCAGGAGTCAGGACCTAGCCTCGTGAAACCTTCTCAGA CTCTGTCCCTCACCTGTTCTGTCACTGGCGACTCCATCACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGAAATAAATTTGAGTACATGGGGTATATCAGCTACAGTGGTAGAACTTACTACAATCCATCTCTCAAAAGTCGAATCTCCATCACTCGAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTAATGAAGACACAGCCACATATTACTGTTCAAGATCCAATATTATCTACGGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA), and the nucleotide sequence of XXML-2G11A7-VL is as shown in SEQ ID NO: 1 NO: 2(GATGTTGTGGTGACTCAAACTCCGCTCTCCCTGCCTGTCAGTTTTGGAGA TCAAGTTTCTATCTCTTGCAGGTCTAGTCAGAGTCTTGCAAATAATTTTGGGAACACCTATTTGTCTTGGTACCTGCACAAGCCTGGCCAGTCTCCACAGCTCCTCATCTATGGGATTTCCAACAGATTTTCTGGGGTGCCAGAC AGGTTCAGTGGTAGTGGTTCAGGGACAGATTTCACACTCAAGATCAGCACAATAAAGCCTGAGGACTTGGGAATGTATTACTGCGTACAAGGTACACATCAGCCTCCCACGTTCGGAGGGGGGACCAAGCTGGAAAATAAAA).

[0008] The second aspect of the present invention is to provide a method for preparing the hybridoma cell line XXML-2G11A7, comprising the steps of:

[0009] S1, preparing dimetholine hapten A, dimetholine hapten B, dimetholine complete antigen C1 and dimetholine complete antigen C2;

[0010] S2, emulsifying the enoylmorph complete antigen C2 and then immunizing the animal;

[0011] S3. After fusing the spleen cells of the immunized animal with myeloma cells, the cells are screened and cloned to obtain the hybridoma cell line XXML-2G11A7.

[0012] Preferably, the structural formula of the enoylmorpholine hapten A is as shown in Formula I:

[0013]

[0014]

[0015] Preferably, the structural formula of the enoylmorpholine hapten B is as shown in Formula II:

[0016]

[0017] More preferably, the preparation step of the dimetholine hapten B comprises: weighing the dimetholine hapten A, N-hydroxysuccinimide and dicyclohexylcarbodiimide, dissolving them respectively with anhydrous N,N-dimethylformamide, mixing and stirring for 4 hours, and centrifuging the reaction solution after the reaction is completed to obtain the dimetholine hapten B.

[0018] Preferably, the structural formula of the enoylmorpholine complete antigen C2 is as shown in Formula III:

[0019]

[0020] More preferably, the preparation step of the dimethomorph complete antigen C2 includes: weighing bovine serum albumin and dissolving it in PBS to obtain a bovine serum albumin solution, slowly adding the dimethomorph hapten B to the bovine serum albumin solution, reacting at room temperature for 4 hours, and dialyzing with PBS solution to obtain the dimethomorph complete antigen C2.

[0021] The third aspect of the present invention is to provide an enoylmorpholine monoclonal antibody obtained by secretion of the hybridoma cell line XXML-2G11A7 or the hybridoma cell line XXML-2G11A7 prepared by the above preparation method.

[0022] The fourth aspect of the present invention is to provide the use of the hybridoma cell line XXML-2G11A7 or the hybridoma cell line XXML-2G11A7 prepared by the above preparation method or the above dimethomorph monoclonal antibody in the detection of dimethomorph.

[0023] The present invention adopts the above technical solution, and has the following technical effects compared with the prior art:

[0024] The antibody secreted by the hybridoma cell line XXML-2G11A7 of the present invention can specifically detect dimethomorph with high sensitivity and good accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a standard curve diagram of oxadiazine in one embodiment of the present invention;

[0026] Figure 2 The figure is the experimental result of the colloidal gold test strip in one embodiment of the present invention.

[0027] Collection Information

[0028] The hybridoma cell line XXML-2G11A7, the deposit number is CGMCC NO: 46139, the deposit date is November 21, 2024, the depository is China General Microbiological Culture Collection Center, and the depository address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0031] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but they are not intended to limit the present invention.

[0032] Example 1

[0033] This embodiment provides dimethomorph hapten, dimethomorph complete antigen and preparation method thereof.

[0034] 1. Enoylmorpholine hapten A

[0035] The structural formula is as follows:

[0036]

[0037] 2. Enoylmorpholine hapten B

[0038] The structural formula is as follows:

[0039]

[0040] The preparation method comprises: weighing ethylenediamine hapten A (0.0225 mmol), N-hydroxysuccinimide (NHS, 0.045 mmol) and dicyclohexylcarbodiimide (DCC, 0.045 mmol), dissolving them respectively with 0.5 mL of anhydrous N,N-dimethylformamide (DMF) and then mixing them, stirring at room temperature for 4 hours, and then centrifuging the reaction solution at 10000 rpm for 10 minutes, and the obtained supernatant is the reactant containing ethylenediamine hapten B, and the reaction product can be directly used for subsequent carrier protein coupling.

[0041] 3. Enoylmorpholine complete antigen C1

[0042] The structural formula is as follows:

[0043]

[0044] The preparation method comprises:

[0045] Weigh 20 mg of ovalbumin (OVA) and dissolve it in 5 mL of 0.01 M PBS with a pH value of 7.4. Slowly add 300 μL of dimethomorph hapten B to the OVA solution (the feed ratio of dimethomorph hapten B to OVA is 30:1). After reacting at room temperature for 4 hours, dialyze the resulting reaction solution with 0.01 M PBS solution with a pH value of 7.4 to remove unreacted raw materials or by-products to obtain dimethomorph complete antigen C1.

[0046] 4. Enoylmorpholine complete antigen C2

[0047] The structural formula is as follows:

[0048]

[0049] The preparation method comprises:

[0050] Weigh 20 mg of bovine serum albumin (BSA) and dissolve it in 5 mL of 0.01 M PBS with a pH value of 7.4. Slowly add 200 μL of dimethomorph hapten B to the BSA solution (the feed ratio of dimethomorph hapten B to BSA is 30:1). After reacting at room temperature for 4 hours, dialyze the resulting reaction solution with 0.01 M PBS solution with a pH value of 7.4 to remove unreacted raw materials or by-products to obtain dimethomorph complete antigen C2.

[0051] Example 2

[0052] This embodiment provides a hybridoma cell line XXML-2G11A7 and a preparation method thereof.

[0053] The steps include:

[0054] (1) Six BALB / C female mice aged 6-8 weeks were selected as experimental animals.

[0055] (2) Basic immunization: 1 mL of enoylmorpholine complete antigen C2 solution (concentration of 1 mg / mL) was mixed with 1 mL of Freund's complete adjuvant, fully emulsified with a magnetic stirrer, and then injected into the abdomen and back at multiple points to immunize mice. The immunization dose was 0.1 mg antigen per mouse.

[0056] (3) Booster immunization: 2 weeks after the basic immunization, the diluted oxadimethoxine complete antigen C2 solution (concentration of 1 mg / mL) was mixed with an equal volume of Freund's incomplete adjuvant, fully emulsified with a magnetic stirrer, and then injected into the abdominal cavity and back subcutaneously at multiple points to immunize mice. The immunization dose was 0.1 mg antigen / mouse. Booster immunization was performed every 2 weeks. Starting from the third booster immunization, blood was collected from the eye sockets on the 7th day after each immunization, and the antibody titer and inhibitory effect in the serum were detected by the indirect competitive ELISA method. The coating antigen used in the method was oxadimethoxine complete antigen C1.

[0057] (4) Sprint immunization: Select mice with high titer and good suppression, and perform sprint immunization on the 10th day after the 5th booster immunization, with 100 μL of 0.1 mg / mL injected intraperitoneally without adjuvant.

[0058] (5) Cell fusion

[0059] Hybridoma fusion was performed on the third day after sprint immunization. The spleen cells of the mice were taken and fused with sp2 / 0 myeloma cells by the polyethylene glycol method. After one week of selection culture in 2% HAT medium, the indirect competitive ELISA method was used to screen the cell wells with high titer and good inhibition, and subcloning was performed by limiting dilution to finally obtain the hybridoma cell line XXML-2G11A7.

[0060] Example 3

[0061] This example provides the preparation and purification of dimethomorph monoclonal antibodies.

[0062] The steps include: taking 6 10-12 week old BALB / C female mice, injecting sterile paraffin oil intraperitoneally, 0.3 mL / mouse; one week later, injecting hybridoma cell line XXML-2G11A7 intraperitoneally into each mouse, with the number of cells injected per mouse being approximately 10 6 When the abdomen of the mouse was swollen, the ascites of the mouse was collected, purified by saturated ammonium sulfate method and stored at -20°C.

[0063] Example 4

[0064] Antibody titer, sensitivity and specificity testing.

[0065] The required buffer preparation method is as follows:

[0066] (1) Coating buffer (pH 9.6 0.05 M carbonate buffer): Na2CO3 1.5 g; NaHCO3 2.94 g, add pure water to make up to 1000 mL;

[0067] (2) Phosphate buffer PBS (pH 7.4 0.01 M): KH2PO4 0.2 g; NaCl 8 g; NaH2PO4·12H2O 2.92 g, add pure water to 1000 mL;

[0068] (3) Washing buffer (PBST): Add 1 mL of Tween-20 to 1000 mL of PBS solution;

[0069] (4) Sample diluent (PBSTG): Add 1 mL of Tween-20 and 1 g of gelatin (melted in a microwave oven) to the prepared PBS and make up to 1000 mL;

[0070] (5) Substrate buffer (pH 5.5): Na2HPO4·12H2O 9.22 g; citric acid monohydrate 2.55 g; Tween-20 0.5 mL, add pure water to 1000 mL;

[0071] (6) Stop solution (2M H2SO4): 445.6 mL of distilled water, add 54.4 mL of concentrated sulfuric acid (98%) dropwise and stir.

[0072] 1. Antigen and antibody checkerboard experiment

[0073] 1) Coating:

[0074] 1 mg / mL dimethomorph complete antigen C1 was diluted with coating buffer at 1:500, 1:1000, 1:2000, and 1:4000 to obtain coating antigen solutions of different concentrations of dimethomorph complete antigen C1. 100 μL of dimethomorph complete antigen C1 coating antigen solution was added to each well of a 96-well ELISA plate, incubated at 4°C overnight, and washed 3 times with PBST.

[0075] 2) Competition:

[0076] The 1 mg / mL oxadimethoxine standard purchased from the quality inspection of altar ink was diluted to 200 ng / mL with PBST, 50 μL of sample diluent was added to each zero well, and 50 μL of diluted 200 ng / mL oxadimethoxine standard solution was added to each inhibition well.

[0077] The dimethomorph antibody was serially diluted with PBST at 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, and 1:32000 to obtain dimethomorph antiserum dilution (50 μL / well), which was placed in a humidified box at 37°C for 30 min and the plate was washed 3 times.

[0078] 3) Add enzyme-labeled secondary antibody: dilute goat anti-mouse enzyme-labeled secondary antibody (IgG-HRP, Jackson) 10,000 times with PBST, add 100 μL to each well, incubate in a humidified box at 37°C for 30 min, and wash the plate three times.

[0079] 4) Color development: Prepare the color development solution before use. Mix the prepared TMB solution and hydrogen peroxide in proportion, add 100 μL to each well, and develop the color for 10 minutes at room temperature away from light.

[0080] 5) Termination: Add 50 μL of 2M H2SO4 to each well and measure the OD value of each well at 450 nm using an ELISA reader.

[0081] The calculation formula of inhibition rate: inhibition rate = (B0-B) / B0×100%), B0 is the OD value of the control well; B is the OD value of the inhibition well.

[0082] The results are shown in Table 1;

[0083] Table 1

[0084]

[0085]

[0086] Note: I represents the inhibition well in the ELISA plate, and C represents the control well in the ELISA plate.

[0087] The results in Table 1 show that when the coating antigen dilution is 1:4000 and the antibody dilution is 1:8000, the inhibition effect on dimethomorph is better, and the inhibition rate is 94.8%, indicating that the antibody produced by the hybridoma cell line XXML-2G11A7 of the present invention can detect dimethomorph.

[0088] 2. Establishment of the standard curve of dimethomorph

[0089] The oxadiazine standard solution was diluted with sample diluent to the following different concentrations: 200 ng / mL, 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.12 ng / mL, 1.56 ng / mL, 0.78 ng / mL and 0.39 ng / mL.

[0090] (1) Antigen coating: dilute the complete enoylmorpholine antigen C1 at 1:4000 and add it to the ELISA plate, 100 μL per well, and place it in a wet box at 4°C overnight; pour out the solution in the ELISA plate, wash the plate three times with washing solution, and spin dry;

[0091] (2) Add 50 μL of the above-mentioned oxadiazine standard solution of different concentrations (experimental wells) to each well, and add 50 μL of sample diluent to the control well without adding the oxadiazine standard solution;

[0092] (3) Add 1:8000 dilution of enoylmorpholine antibody diluent to the experimental wells and control wells, 50 μL per well, and incubate at 37°C for 30 min; pour out the solution in the ELISA plate, wash the plate three times with washing solution, and spin dry;

[0093] (4) Add 100 μL of IgG-HRP secondary antibody diluted at 1:10,000 to the experimental well and control well, respectively, and incubate at 37°C for 30 min; pour off the solution in the ELISA plate, wash the plate three times with washing solution, and spin dry;

[0094] (5) Add 100 μL of the prepared substrate buffer to the experimental well and the control well, incubate at 37°C for 10 min, and then add 50 μL of 2.0 M sulfuric acid solution to each well to terminate the reaction;

[0095] (6) Determine the absorbance at 450 nm;

[0096] (7) Drawing a standard curve: Using dimethomorph standard solutions of different concentrations (ng / mL) as the X-axis and the absorbance ratio (B / B0, where B is the average absorbance of the dimethomorph standard solution and B0 is the average absorbance of the control well) as the Y-axis, a standard curve was drawn; the experiment was repeated three times, and the average of the three experimental results was taken. The results are shown in Table 2. The obtained standard curve is shown in Figure 1 shown.

[0097] Table 2

[0098]

[0099] The results showed that its sensitivity (IC50) was 2.47ng / mL and the detection range was 0.72ng / mL-8.53ng / mL, indicating that the antibody obtained by immunizing mice with the complete oxadiazine antigen C2 as an antigen had a good detection effect and high sensitivity.

[0100] 3. Antibody specificity detection

[0101] Standard samples of flumorph, pyrimethanil, thiabendazim, prochloraz, difenoconazole, fenpropimorph and metalaxyl were purchased from the quality inspection department of Aloe vera. The above seven analogues were diluted to the following concentrations with sample diluent: 3200ng / mL, 1600ng / mL, 800ng / mL, 400ng / mL, 200ng / mL, 100ng / mL, 50ng / mL.

[0102] A standard curve was established to determine the inhibition concentration IC50 (the standard sample concentration value at which the inhibition rate reaches 50%). The method for establishing the standard curve was the same as the method for establishing the above-mentioned dimethomorph standard curve.

[0103] Cross-reaction rate (%) = (IC50 of enoylmorpholine) / (IC50 of analogue) × 100%.

[0104] The results are shown in Table 3;

[0105] Table 3

[0106]

[0107]

[0108] 4. Application of colloidal gold test strips

[0109] 1) Preparation of gold-labeled antibody pad: Take 1 mL of colloidal gold solution (30 nm) in a 2 mL centrifuge tube (rinsed with pure water), add 3 μL of 0.2 M K2CO3 solution, then add 5 μL of 1 mg / mL antibody, put it in a four-dimensional rotating instrument and rotate for 20 min, then add 50 μL of 3% BSA blocking solution, and rotate it on a four-dimensional rotating instrument for 10 min. Then use a high-speed refrigerated centrifuge to centrifuge the mixture at 10000 r / min for 10 min (4°C). Pour out the supernatant, add 0.4 mL of reconstitution solution (0.01 M PBS containing 3% sucrose) to the precipitate, spread the solution on a 1 cm × 15 cm sample pad, and dry it in a 37°C oven (1.5 h).

[0110] 2) NC membrane streaking concentration: T line concentration is 1.0 mg / mL, C line concentration is 1.0 mg / mL.

[0111] 3) Results:

[0112] Extraction solvent ck: T / C = 779 / 159 = 4.899

[0113] 20ppb standard (sensitivity): T / C = 205 / 202 = 1.015

[0114] 4) Test the matrix ck, 1 / 2MRL, MRL of cowpea, loofah, tomato and eggplant

[0115] Cowpea, loofah, tomato and eggplant samples were collected from supermarkets and spiked for testing according to the maximum residue limits in GB2763-2021. The test results are shown in Table 4 and Figure 2 As shown;

[0116] Table 4

[0117] Matrix Method detection limit (mg / kg) ck 1 / 2MRL MRL cowpea 0.15 550 / 172＝3.198 290 / 250＝1.160 162 / 257＝0.630 Loofah 0.5 566 / 163＝3.472 280 / 263＝1.065 135 / 196＝0.689 tomato 1 697 / 236＝2.953 262 / 204＝1.284 161 / 302＝0.533 eggplant 2 407 / 129＝3.155 183 / 200＝1.307 105 / 176＝0.597

[0118] 1 / 2MRL was suspicious or negative, and MRL was positive, both meeting the test requirements. This showed that the method had good accuracy and could be used for the detection of oxadiazine in actual samples, loofah, tomato and eggplant samples.

[0119] In summary, the antibody secreted by the hybridoma cell line XXML-2G11A7 of the present invention can specifically detect enoylmorpholine with high sensitivity and good accuracy.

[0120] The above description is only a preferred embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the description and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. A hybridoma cell line XXML-2G11A7, characterized in that The deposit number is CGMCC NO: 46139, the deposit date is November 21, 2024, the depository is China General Microbiological Culture Collection Center, and the depository address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The hybridoma cell line XXML-2G11A7 according to claim 1, characterized in that The nucleotide sequence of XXML-2G11A7-VH is shown in SEQ ID NO:1, and the nucleotide sequence of XXML-2G11A7-VL is shown in SEQ ID NO:

2.

3. A method for preparing the hybridoma cell line XXML-2G11A7 according to any one of claims 1 to 2, characterized in that the steps include: S1, preparing dimetholine hapten A, dimetholine hapten B, dimetholine complete antigen C1 and dimetholine complete antigen C2; S2, emulsifying the enoylmorph complete antigen C2 and then immunizing the animal; S3. After fusing the spleen cells of the immunized animal with myeloma cells, the cells are screened and cloned to obtain the hybridoma cell line XXML-2G11A7.

4. The preparation method according to claim 3, characterized in that: The structural formula of the enoylmorpholine hapten A is shown in Formula I:

5. The preparation method according to claim 3, characterized in that: The structural formula of the enoylmorpholine hapten B is shown in Formula II:

6. The preparation method according to claim 5, characterized in that: The preparation step of the dimetholine hapten B comprises: weighing the dimetholine hapten A, N-hydroxysuccinimide and dicyclohexylcarbodiimide, dissolving them respectively with anhydrous N,N-dimethylformamide, mixing and stirring for reaction for 4 hours, and centrifuging the reaction solution after the reaction is completed to obtain the dimetholine hapten B.

7. The preparation method according to claim 3, characterized in that: The structural formula of the enoylmorpholine complete antigen C2 is shown in Formula III:

8. The preparation method according to claim 7, characterized in that: The preparation steps of the dimethomorph complete antigen C2 include: weighing bovine serum albumin and dissolving it in PBS to prepare a bovine serum albumin solution, slowly adding the dimethomorph hapten B to the bovine serum albumin solution, reacting at room temperature for 4 hours, and dialyzing with a PBS solution to obtain the dimethomorph complete antigen C2.

9. An enoylmorpholine monoclonal antibody, characterized in that It is obtained by secretion of the hybridoma cell line XXML-2G11A7 according to any one of claims 1-2 or the hybridoma cell line XXML-2G11A7 prepared by the preparation method according to any one of claims 3-8.

10. Use of the hybridoma cell line XXML-2G11A7 according to any one of claims 1 to 2, or the hybridoma cell line XXML-2G11A7 prepared by the preparation method according to any one of claims 3 to 8, or the dimetholine monoclonal antibody according to claim 9 in detecting dimetholine.

Images