Acidic pectinase mutant and its application
By introducing Y219W mutation site into acid pectinase, its enzyme activity residue rate at high temperatures is significantly improved, the problem of insufficient heat resistance of acid pectinase is solved, and its application in feed and food processing has been expanded.
Patent Information
- Application Number
- CN202510251922.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-03-05
AI Technical Summary
The existing acid pectinase has insufficient heat resistance, which limits its application effect under high temperature conditions.
The amino acid at position 219 of the amino acid sequence of the acid pectinase is mutated from Tyr to Trp, forming a single mutation site of Y219W, improving its heat resistance.
After treatment at 80°C for 3 minutes, the enzyme activity residue rate increased by 46.77%, significantly enhancing the heat resistance of acid pectinase and is suitable for feed and food processing fields.
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering and protein engineering modification, and specifically relates to an acidic pectinase mutant and its application. Background Art
[0002] Pectin is a heteropolysaccharide widely present in the primary cell wall and middle lamella of plant cell walls. It is mainly an acidic heteropolysaccharide composed of D-galacturonic acids (D-Gal-A) linked by α-1,4-glycosidic bonds. In addition to D-Gal-A, it also contains neutral sugars such as L-rhamnose, D-galactose, and D-arabinose. In plant cell walls, pectin is mainly covalently bound to cellulose, hemicellulose, lignin, etc. to form protopectin, which is a structural substance of plants and plays a crucial role in maintaining the structure and hardness of plants.
[0003] Most of the feed eaten by livestock and poultry animals is plant-based feed raw materials. To fully digest and degrade plant-based feed raw materials, it is necessary to first destroy the structure of their cell walls, so that nutrients such as starch polysaccharides inside the cells are fully exposed, improve the contact between nutrients and endogenous enzymes such as proteases and amylases, and then improve feed utilization rate. Pectinase refers to enzymes that decompose pectin, the main component of plants. Pectinase is widely distributed in higher plants and microorganisms. According to the different substrates it acts on, it can be divided into three categories. Two of them (pectin esterase and polygalacturonase) exist in higher plants and microorganisms, and another one (pectin lyase) exists in microorganisms. Exogenous addition of pectinase can degrade pectin in plant cell walls, thereby destroying cell structure and further improving feed utilization rate. The addition of pectinase can also promote the digestion and absorption of animals. In the stomach of animals, pectinase can help decompose pectin, reduce the viscosity of feed, make other digestive enzymes easier to contact with feed, thereby improving the digestibility of feed, and can also promote the reproduction of beneficial bacteria in the intestine, maintain intestinal health, and further improve the digestive system function of animals.
[0004] With the continuous improvement of people's requirements for feed quality, the application effect of pectinase in the feed industry has become increasingly prominent. By adding pectinase, the processing performance of feed can be improved, and the granulation effect and feed stability can be enhanced. In addition, pectinase can also act synergistically with other enzymes to jointly promote the digestion and absorption of feed and improve the production performance of animals. Therefore, pectinase has become an important additive indispensable in the modern feed industry. Summary of the Invention
[0005] In order to solve the problems of the prior art, the present invention provides an acidic pectinase mutant and its application. The heat resistance of the mutant is significantly higher than that of the wild type, which is beneficial to its wide application in the fields of feed, food processing, etc.
[0006] On the one hand, the present invention relates to an acidic pectinase mutant, wherein the 219th amino acid of the acidic pectinase with the amino acid sequence of SEQ ID NO: 2 is mutated from Tyr to Trp.
[0007] The present invention also relates to a DNA molecule encoding the above-mentioned acidic pectinase mutant.
[0008] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.
[0009] The present invention also relates to a host cell containing the above recombinant expression plasmid.
[0010] After transferring the above plasmid into the host cell, the heat resistance of the recombinantly expressed acidic pectinase mutant is significantly improved.
[0011] The host cell is Aspergillus niger ( Aspergillus niger ).
[0012] Compared with the wild-type acidic pectinase PG, the acidic pectinase mutant containing a single mutation site of Y219W provided by the present invention has an enzyme activity residual rate increased by 46.77% after being treated at 80 °C for 3 min, and its heat resistance is significantly enhanced, and it can be widely applied in fields such as feed and food processing. The acidic pectinase mutant can significantly reduce the water-holding capacity of potato residues, which is beneficial to promoting the high-value utilization of potato residues, and has a broad market prospect. Specific Embodiments
[0013] The present invention discloses an acidic pectinase mutant, its preparation method and application, a DNA molecule encoding the acidic pectinase mutant, a plasmid, and a host cell. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve it. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate modifications and combinations to the methods and applications described in this article without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0014] The present invention employs conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as the methods described in MOLECΜLAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLSIN MOLECΜLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in the present invention, adopt other conventional methods, experimental protocols, and reagents in the art, without being limited to the specific embodiments of the present invention. For example, the following experimental materials and reagents can be selected for the present invention:
[0015] Strains and plasmids: Escherichia coli DH5α, Amp, etc. were purchased from Invitrogen Corporation.
[0016] Enzymes and kits: PCR enzymes and ligases were purchased from Takara Corporation, restriction endonucleases were purchased from Fermentas Corporation, plasmid extraction kits and gel purification and recovery kits were purchased from Omega Corporation, and the GeneMorph II Random Mutagenesis Kit was purchased from Beijing Bomes Biotechnology Co., Ltd.
[0017] The formulations of the culture media in the examples are as follows:
[0018] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0019] LB + Amp medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0020] LB + Amp plate: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;
[0021] The present invention will be further illustrated below in conjunction with examples:
[0022] Example 1 Cloning of Acidic Pectinase Gene
[0023] Using the Aspergillus niger Su genome as a template, the acidic pectinase gene fragment was amplified using primer 1 and primer 2. This acidic pectinase was named PG, its nucleotide sequence is SEQ ID NO: 1, and the amino acid sequence it encodes is SEQ ID NO: 2.
[0024] The PCR primers and reaction conditions are as follows:
[0025] Primer 1 (F): ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 3);
[0026] Primer 2 (R): TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 4).
[0027] The reaction conditions were as follows: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s. After 30 cycles, incubation at 72°C for 10 min. The results of agarose gel electrophoresis showed that the size of the amplified acidic pectinase gene was 1160 bp.
[0028] Example 2 Construction of Recombinant Plasmid
[0029] The above-mentioned acidic pectinase gene was amplified by PCR, and Xba I sites were introduced at both ends of the primers. The primer sequences were as follows:
[0030] Primer 3 (F): GC TCTAGA ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 5);
[0031] Primer 4 (R): GC TCTAGA TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 6).
[0032] The PCR reaction conditions were as follows: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s. After 30 cycles, incubation at 72°C for 10 min. The results of agarose gel electrophoresis showed that the acidic pectinase gene was a fragment with a size of 1160 bp.
[0033] The obtained acidic pectinase gene fragment and the expression plasmid pSU were respectively digested with the restriction endonuclease XbaI alone, and the digestion conditions are shown in Table 1.
[0034] Table 1 Digestion System
[0035] PCR Fragment Digestion System (50 μL) Plasmid pSU Digestion System (50 μL) PCR Fragment 20 μL pSU Plasmid 20 μL 10*M 5 μL 10*M 5 μL BSA 5 μL BSA 5 μL XbaI 2 μL XbaI 2 μL <![CDATA[18 μL of ddH2O]]> <![CDATA[18 μL of ddH2O]]>
[0036] Digest at 37°C in a water bath for 2 h. After electrophoresis, the two target fragments were respectively recovered and dissolved in 20 μL of ddH2O. Ligation was carried out using T4 DNA ligase, and the ligation system is shown in Table 2.
[0037] Table 2 Ligation System
[0038] PCR Fragment 2 μL pSU 2 μL 10*Buffer 1 μL T4 DNA ligase 1 μL <![CDATA[ddH2O]]> 4 μL Total Volume 10 μL
[0039] Connect at 22°C for 1 h, transform Escherichia coli DH5α competent cells, spread on LB + AMP plates, culture overnight at 37°C until single colonies grow out. For the transformants with correct ligation verified by colony PCR, extract the plasmids and send them for sequencing. After correct sequencing, the recombinant plasmid pSU - PG containing the acidic pectinase gene is obtained.
[0040] Example 3 Screening of Thermostable Mutants
[0041] In order to further improve the thermostability of acidic pectinase PG, the applicant screened a large number of mutants of this enzyme through directed evolution technology.
[0042] Design PCR primers F3 and R3:
[0043] F3: GC GAATTC ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 7, the underlined part is the recognition site of restriction endonuclease EcoRI);
[0044] R3: TA GCGGCCGC TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 8, the underlined part is the recognition site of restriction endonuclease NotI).
[0045] Using the PG gene (SEQ ID NO: 1) as a template, perform PCR amplification with the above primers using the GeneMorph II Random Mutagenesis PCR Kit (Bimaisi). Gel - purify the PCR products, perform digestion with EcoRI and NotI, and then ligate them with the pET21a plasmid digested with the same enzymes. Transform into Escherichia coli BL21(DE3), spread on LB + Amp plates, and culture inverted at 37°C. After the appearance of transformants, pick them one by one with toothpicks into 96 - well plates. Add 150 μL of LB + Amp medium containing 0.1 mM IPTG to each well, culture at 37°C and 220 rpm for about 6 h, centrifuge to discard the supernatant, resuspend the cells with buffer, and break the cell walls by repeated freezing and thawing to obtain the Escherichia coli cell lysate containing acidic pectinase.
[0046] Take out 30 μL of the lysate into two new 96 - well plates respectively. Treat one of them at 90°C for 5 min. Add 30 μL of substrate to both 96 - well plates, react at 40°C for 10 min, and then determine the generated galacturonic acid by the DNS method. Different mutants have different activities maintained after high - temperature treatment.
[0047] The experimental results show that some mutations have no effect on the heat resistance of acidic pectinase PG, and some mutations even make its heat resistance or enzyme activity worse; in addition, there are also some mutations that can improve the temperature tolerance of acidic pectinase, but its enzymatic properties have changed significantly after mutation, and these do not meet the requirements. Finally, the mutation site Y219W that can significantly improve the heat resistance of acidic pectinase without affecting its enzyme activity and original enzymatic properties was obtained.
[0048] Based on the above wild-type acidic pectinase PG, the present invention provides a mutant containing a single mutation site Y219W.
[0049] Example 4 Recombinant expression of acidic pectinase
[0050] According to the method described in Example 2, the screened mutant was amplified by PCR using primers F2 and R2, digested with Xba I enzyme, then ligated with the pSu plasmid digested with the same enzyme, and transformed into Escherichia coli DH5a. It was spread on an LB + Amp plate and cultured inverted at 37°C. After the transformants appeared, colony PCR was performed (reaction system: template, the picked monoclonal, 0.5 μL of rTaq DNA polymerase, 2.0 μL of 10× Buffer, 2.0 μL of dNTPs (2.5 mM), 0.5 μL of 5’AOX primer (10 mM), 0.5 μL of 3’AOX primer, 14.5 μL of ddH2O; reaction program: pre-denaturation at 95°C for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clones were verified, and the correct mutant recombinant expression plasmid was obtained after sequencing verification.
[0051] 4.1 Protoplast preparation:
[0052] Inoculate the Aspergillus niger host bacterium on a PDA + U (200 g / L of potato, boiled for 20 - 30 min and then filtered to remove residues; 2% glucose; 1% Uridine; 1.5% agar powder) plate and culture at 30°C for 5 - 7 d; cut a 2 cm × 2 cm sized bacterial block and inoculate it into 100 mL of liquid PDA + U (200 g / L of potato, boiled for 20 - 30 min and then filtered to remove residues; 2% glucose; 1% Uridine) medium, and culture at 30°C for 16 h to grow mycelia for transformation; after filtering the grown mycelia, resuspend them with 20 mL of 1.2 M magnesium sulfate solution; add 0.2 g of lysozyme and culture at 30°C and 100 rpm for 2 - 3 h; filter the lysed mycelia through two layers of lens paper and centrifuge at 3000 rpm for 10 min to obtain protoplasts; filter the lysed mycelia through lens paper and centrifuge to obtain protoplasts; then resuspend them with an appropriate amount of sorbitol solution.
[0053] 4.2 Transformation:
[0054] Wash the obtained Aspergillus niger host cell protoplasts twice with 1.2 M sorbitol solution, and then resuspend them with an appropriate amount of sorbitol solution to make the protoplast concentration reach 10 8 cells / mL; Add 10 μL of the prepared recombinant plasmid to each 200 μL of protoplasts, add 50 μL of 25% PEG6000, incubate on ice for 20 min, then add 2 mL of 25% PEG6000, and let stand at room temperature for 5 min; Add 4 mL of sorbitol solution, invert and mix well, pour it into 50 mL of transformation upper medium, and then pour it into 4 transformation lower plates. After the upper medium solidifies, incubate it upside down in a 30 °C incubator for 5 d.
[0055] 4.3 Screening of transformants:
[0056] After culturing for 5 d, pick the grown colonies and spot-inoculate them onto the transformation lower plates for re-screening, and culture at 30 °C for 3 d. Inoculate the normally growing transformants onto fresh PDA plates respectively and culture at 30 °C for 5 - 7 d. Cut 2 cm × 2 cm sized fungal blocks from each transformant and inoculate them into 50 mL of liquid shake flask medium (maltose 12%; corn steep liquor 1.5%; ammonium sulfate 0.5%; magnesium sulfate 0.3%; potassium sulfate 0.37%; calcium chloride 0.1125%; trace elements 0.1%) for fermentation, and culture at 30 °C for 5 d. After culturing for 5 d, centrifuge the thalli to obtain the supernatant, which is the crude enzyme solution, and perform SDS-PAGE protein electrophoresis detection and acidic pectinase enzyme activity detection.
[0057] 4.4 Detection of acidic pectinase enzyme activity
[0058] (1) Definition of acidic pectinase enzyme activity unit
[0059] Under the conditions of 40 °C and pH value of 4.5, the amount of enzyme that hydrolyzes polygalacturonic acid to produce 1 μmol of galacturonic acid per minute is defined as one enzyme activity unit U.
[0060] (2) Method for enzyme activity determination
[0061] Polygalacturonic acid solution (0.5%): Weigh 0.5 g of sodium polygalacturonate, place a suitable beaker containing 80 mL of water on a magnetic stirrer with heating, keep stirring and slowly add sodium polygalacturonate. After it is basically dissolved, turn on the heater of the magnetic stirrer to 80 °C, keep it for 2 min. After sodium polygalacturonate is completely dissolved (becomes transparent), immediately transfer the beaker to a cold water bath and cool it to room temperature. Add 5 mL of 1 mol / L sodium acetate buffer solution to the beaker, and then make the volume up to 100 mL with water.
[0062] Galacturonic acid solution (1%): Take D-galacturonic acid and dry it in an oven at 60 °C until it reaches a constant weight. Then accurately weigh 0.5 g, dissolve it with 0.05 mol / L sodium acetate buffer solution and make up the volume to 50 mL.
[0063] Enzyme solution: Dilute it to an appropriate multiple with 0.05 mol / L sodium acetate buffer solution at pH 4.5, and control the absorbance value in the range of 0.28 - 0.33.
[0064] Drawing of the galacturonic acid standard curve: Respectively prepare 0, 0.2, 0.4, 0.6, 0.8, 1.0 mL of 1% galacturonic acid standard solution, make up the volume to 10 mL with 0.05 mol / L sodium acetate buffer solution as the standard point solution. Take 0.5 mL of each of the above standard point solutions, add 0.5 mL of polygalacturonic acid substrate solution, then add 2 mL of DNS termination solution. After mixing evenly, place all the test tubes in a boiling water bath and boil for 5 min, then take them out of the water bath and cool to room temperature; add 5 mL of water to all the test tubes, mix evenly, transfer the solution to a 10 mL centrifuge tube, centrifuge at 4000 rpm for 10 min, and take the supernatant to read the absorbance value with a spectrophotometer at 540 nm.
[0065] Taking the absorbance value as the vertical coordinate (Y) and the galacturonic acid concentration (μmol / mL) as the horizontal coordinate (X), draw the standard curve Y = kX + b.
[0066] Determination: Take 0.5 mL of the diluted enzyme solution and add it to the reaction tube and the blank tube, and place the reaction tube and the blank tube in a 40 °C water bath and preheat for 3 min. Then, at a certain time interval, add 0.5 mL of the preheated polygalacturonic acid solution at 5 min to the reaction test tube, mix evenly, and time the reaction for 10 min. Finally, at the same time interval, add 2 mL of DNS solution to all the reaction tubes to terminate the reaction, and add 0.5 mL of polygalacturonic acid solution to the blank tube.
[0067] Place all the test tubes in a boiling water bath and boil for 5 min, then take them out of the water bath and cool to room temperature. Add 5 mL of water to all the test tubes, mix evenly, transfer the test tubes to a 10 mL centrifuge tube, centrifuge at 4000 rpm for 10 min, and take the supernatant to read the absorbance value with a spectrophotometer at 540 nm. The difference in absorbance values between the reaction tube and the blank tube is denoted as A.
[0068] Enzyme activity calculation formula: U = [(A - b) × n] / (10 × k).
[0069] In the formula:
[0070] U —— Enzyme activity of the sample, unit is U / mL;
[0071] A —— Difference in absorbance values between the sample and the blank;
[0072] k——Slope of the standard curve;
[0073] b——Intercept of the standard curve;
[0074] n——Dilution factor;
[0075] 10——Reaction time, 10 min.
[0076] Example 5 Analysis of the heat resistance of the acidic pectinase mutant
[0077] The fermentation supernatants of the Aspergillus niger recombinant strains expressing the recombinant acidic pectinase PG and its mutants constructed above were respectively diluted to about 200 U / mL with acetic acid-sodium acetate buffer at pH 4.5. After treatment at 80 °C for 3 min, the residual enzyme activity was measured. Taking the enzyme activity of the untreated sample as 100%, the enzyme activity retention rate was calculated. The specific results are shown in Table 3.
[0078] Table 3 Analysis of the heat resistance of the acidic pectinase mutant
[0079] Acid Pectinase Residual Enzyme Activity Rate after Treatment at 80°C for 3 min Wild-Type PG 32.00% Y219W Single-Point Mutant 78.77%
[0080] It can be seen from the results in Table 3 that compared with the wild-type acidic pectinase PG, the enzyme activity retention rate of the acidic pectinase mutant containing a single mutation site Y219W increased by 46.77% after treatment at 80 °C for 3 min, and the heat resistance was significantly enhanced, achieving an unexpected technical effect.
[0081] In summary, the acidic pectinase mutant provided by the present invention has stronger heat resistance and is more suitable for application in fields such as feed and food processing.
[0082] The applicant named the acidic pectinase mutant containing a single mutation site Y219W as acidic pectinase M. The Aspergillus niger engineering strain expressing this mutant was scaled up for production, and a solid product of acidic pectinase M was prepared, with an enzyme activity level of 1000 u / g.
[0083] Example 6 Application of acidic pectinase in potato residue treatment
[0084] Potato starch enterprises will produce a large amount of potato residues during the starch production process. The daily output is huge. Due to their high water content, self-borne bacteria and rich nutrients, they are prone to putrefaction and odor, which will cause serious environmental pollution and waste of resources. In fact, potato residues are rich in fiber, but using potato residues to produce high-value products such as fiber requires dry potato residues as raw materials. Therefore, rapid drying has become the key to solving the resource utilization of potato residues. Rapid drying requires reducing the water-holding capacity of potato residues through biocatalytic enzyme technology and effectively improving the biological value of potato residues.
[0085] The present invention provides a method for reducing the water-holding capacity of potato residue by using pectinase, specifically: adding the solid product of acidic pectinase M described in Example 5 to potato residue with a water content of 95% at a ratio of 50 grams per ton, enzymatically hydrolyzing at room temperature for 4 hours, and then performing pressure filtration, so that the water content of the potato residue is reduced to 55%.
[0086] As a control, potato residue with a water content of 95% was allowed to stand at room temperature for 4 hours and then pressure-filtered, and the water content of the potato residue was only reduced to 85%.
[0087] The above results show that the acidic pectinase mutant provided by the present invention can significantly reduce the water-holding capacity of potato residue, which is beneficial to promoting the high-value utilization of potato residue and has broad market prospects.
Claims
1. An acid pectinase mutant, characterized in that: The mutant is obtained by mutating the 219th amino acid from Tyr to Trp based on the acid pectinase shown in the amino acid sequence SEQ ID NO:
2.
2. A DNA molecule encoding the acid pectinase mutant according to claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3; the host cell is Aspergillus niger ( Aspergillus niger ).
5. Use of the acid pectinase mutant according to claim 1 in potato residue treatment.
Citation Information
Patent Citations
Recombinant incision polygalacturonase as well as gene pgaA and application thereof
CN108239649A
Polygalacturonase mutant T316C / G344C with high thermal stability as well as gene and application thereof
CN111926001A