Application of GhGDSL102 gene in regulation and control of oil content of plant

Abstract

The invention discloses application of a GhGDSL102 gene in regulating and controlling the oil content of a plant, and belongs to the technical field of gene engineering. The GhGDSL102 gene is over-expressed in arabidopsis thaliana, the oil content of arabidopsis thaliana seeds is obviously reduced by 13.67%, and oleic acid C18: 1 is obviously reduced by 7.7%. After the GhGDSL102 gene is silenced, the oil content and oleic acid content of the cotton seeds are obviously increased by 9.99% and 7.57%. Meanwhile, three transgenic positive strains are obtained through overexpression of cotton, it is found through measurement of the oil content of cotton seeds that the oil content of the three overexpression strains is remarkably reduced by 11.70%, 9.14% and 19.25% respectively compared with that of a control group, and the oleic acid content is reduced by 5.54%, 7.09% and 6.29% respectively; the cottonseed oil content of the obtained homozygous edited strain is remarkably improved by 19.4%, and the GhGDSL102 is proved to be a gene for negatively regulating the cottonseed oil content.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of GhGDSL102 gene in regulating the oil content of plants. Background Art

[0002] Cotton (Gossypium spp.) is not only an important economic crop in my country, but also the most important natural fiber raw material and an important source of vegetable oil. The basic research on cotton genetics has always focused on cotton fiber quality and yield, while there is relatively little basic research on cottonseed oil synthesis metabolism. Although there have been more and more studies on cottonseed oil synthesis-related genes in recent years, the biochemical process and metabolic regulation mechanism of oil synthesis still need further research. Therefore, genetic improvement of cottonseed oil content has become an urgent problem to be solved in my country's cotton production.

[0003] GDSL-type lipase genes play an important role in plant growth, development, anther and pollen development, and responses to biotic and abiotic stresses. However, the mechanism of cotton GDSL family genes in regulating oil accumulation has not been studied in depth. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the GhGDSL102 gene in regulating the oil content of plants, so as to solve the problems existing in the above-mentioned prior art.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is the application of the GhGDSL102 gene in regulating the oil content of plants.

[0007] The second technical solution of the present invention is a method for regulating the oil content of plants, which includes overexpressing the GhGDSL102 gene to reduce the oil content of plants, silencing or knocking out the GhGDSL102 gene to increase the oil content of plants.

[0008] The third technical solution of the present invention is the application of the GhGDSL102 gene in changing the fatty acid composition of plants, overexpressing the GhGDSL102 gene to reduce the oleic acid C18:1 content, silencing or knocking out the GhGDSL102 gene to increase the oleic acid C18:1 content.

[0009] The fourth technical solution of the present invention is a method for regulating plant fatty acid composition, overexpressing the GhGDSL102 gene to reduce the oleic acid C18:1 content, silencing or knocking out the GhGDSL102 gene to increase the oleic acid C18:1 content.

[0010] A fifth technical solution of the present invention is the application of inhibiting the expression of GhGDSL102 gene in increasing the oil content of plants.

[0011] The sixth technical solution of the present invention is the application of inhibiting the expression of GhGDSL102 gene in increasing the content of plant oleic acid C18:1.

[0012] Based on the above technical solution, the present invention has the following technical effects:

[0013] The present invention overexpresses the GhGDSL102 gene in Arabidopsis, and the results show that the oil content of Arabidopsis seeds is significantly reduced by 13.67%, and the oleic acid C18:1 is significantly reduced by 7.7%. After silencing the GhGDSL102 gene in cotton, the oil content and oleic acid of cotton seeds are significantly increased by 9.99% and 7.57%. At the same time, three transgenic positive strains are obtained by overexpressing cotton, and by measuring the oil content of cotton seeds, it is found that the oil content of cotton seeds in the three overexpression strains is significantly reduced by 11.70%, 9.14% and 19.25% respectively compared with the control, and the oleic acid content is reduced by 5.54%, 7.09% and 6.29% respectively; the cotton seed oil content of the obtained homozygous edited strain is significantly increased by 19.4%, and the above results prove that GhGDSL102 is a gene that negatively regulates the oil content of cotton seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0015] Figure 1 This is the amplification result of GhGDSL102.

[0016] Figure 2 Map of the vector used for GhGDSL102 overexpression in Arabidopsis.

[0017] Figure 3 a. Screening of Arabidopsis seedlings sprayed with glufosinate herbicide; b. PCR detection of Arabidopsis positive seedlings overexpressing GhGDSL102; c. qPCR detection of Arabidopsis positive seedlings overexpressing GhGDSL102 (P***<0.01).

[0018] Figure 4 The oil content and fatty acid composition of WT and overexpression genetically transformed Arabidopsis seeds. a. Changes in oil content in T3 generation seeds of GhGDSL102 overexpressing plants and wild-type plants; b. Fatty acid composition analysis.

[0019] Figure 5 Phenotypic analysis of virus-induced GhGDSL102 silenced plants. Among them, a. Growth phenotype of cotton plants in the PDS positive control group and the experimental group; b. Expression level of GhGDSL102 gene in leaves of VIGS-GhGDSL102 plants; c. Oil content in leaves of VIGS-GhGDSL102 plants; d. Fatty acid composition in leaves of VIGS-GhGDSL102 plants; e. Oil content in cotton seeds of VIGS-GhGDSL102 plants; f. Fatty acid composition in cotton seeds of VIGS-GhGDSL102 plants (P**<0.01).

[0020] Figure 6 This is the T0 knockout strain of the GhGDSL102 gene. Among them, a. Identification of the T0 Cas9 protein; b. Cloning of the T0 editing fragment; c. Sequencing results of the editing site of the T0 cotton knockout strain.

[0021] Figure 7 This is the editing type of the T1 generation knockout strain of the GhGDSL102 gene.

[0022] Figure 8 This is the editing type of the GhGDSL102 gene T2 knockout strain.

[0023] Fig. 9 This is a map of cotton overexpression vectors.

[0024] Fig.10 Identification of cotton with overexpression of GhGDSL102 gene. a. PCR detection of GhGDSL102 overexpression positive cotton lines; b. Expression level of GhGDSL102 gene in cotton overexpression positive lines (P***<0.01).

[0025] Fig.11 Phenotypic analysis of cotton plants overexpressing the GhGDSL102 gene. a. Changes in oil content in overexpressed lines; b. Changes in fatty acids in overexpressed cotton (P*<0.05, P**<0.01). DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0032] The embodiment of the present invention provides the use of the GhGDSL102 gene in regulating the oil content of plants.

[0033] In some specific embodiments, the plants include cotton and Arabidopsis thaliana.

[0034] The embodiments of the present invention also provide a method for regulating the oil content of plants, which includes overexpressing the GhGDSL102 gene to reduce the oil content of plants, silencing or knocking out the GhGDSL102 gene to increase the oil content of plants.

[0035] In some specific embodiments, the plants include cotton and Arabidopsis thaliana.

[0036] In some specific embodiments, overexpression of the GhGDSL102 gene reduces the oil content of plant seeds, and silencing or knocking out the GhGDSL102 gene increases the oil content of plant seeds.

[0037] The embodiments of the present invention also provide the use of the GhGDSL102 gene in changing the fatty acid composition of plants, overexpressing the GhGDSL102 gene to reduce the oleic acid C18:1 content, silencing or knocking out the GhGDSL102 gene to increase the oleic acid C18:1 content.

[0038] The embodiment of the present invention also provides a method for regulating plant fatty acid composition, overexpressing the GhGDSL102 gene to reduce the oleic acid C18:1 content, silencing or knocking out the GhGDSL102 gene to increase the oleic acid C18:1 content.

[0039] The embodiment of the present invention also provides the use of inhibiting the expression of GhGDSL102 gene in increasing the oil content of plants.

[0040] The embodiment of the present invention also provides the use of inhibiting the expression of GhGDSL102 gene in increasing the content of plant oleic acid C18:1.

[0041] The cotton materials used in the present invention are 'Upland cotton TM-1', 'China Cotton Institute 24' and 'Bai Mian No. 1', and Columbia type Arabidopsis thaliana (Col-0), and the above plant materials and germplasm resources are all from laboratory reserves.

[0042] Example 1

[0043] Cloning of 1GhGDSL102 gene

[0044] The RNA of ovules and fibers of upland cotton TM-1 material at different stages (0, 5, 10, 15, 20, 25 and 30 DPA) was reverse transcribed into cDNA and mixed separately. With the cDNA as the template, the sequence information of GhGDSL102 gene in TM-1 reference genome was used to design the sequence with suitable Tm by using SnapGene software and Primer3 website. The specificity was then tested by CottonMD. Finally, the specific primers GhGDSL102-F (SEQ ID NO.1: ATGGACACCCAAAGCTTTC) and GhGDSL102-R (SEQ ID NO.2: TCAGTCAATAAATTGCTTGAGAGT) were obtained. Using this pair of specific primers, a reaction system was set up under low temperature conditions to achieve effective amplification of the full-length CDS of GhGDSL102 gene.

[0045] The amplification system was: 2×Phanta Max Master Mix 25 μL, Primer F / R (10 μm) 2 μL, cDNA 1.5 μL, and ddH2O 19.5 μL.

[0046] The amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 40 s, 35 cycles; 72°C for 5 min; and storage at 4°C.

[0047] After the amplification was completed, the gel was recovered by 1.2% agarose gel electrophoresis (U=115V, I=125mA, 24min) to confirm that the band was correct, and the GhGDSL102 gene fragment was extracted from the gel.

[0048] The results showed that the amplification results were specific, and the target band of 1074 bp was obtained by gel recovery ( Figure 1 ), the sequencing results of the amplified fragments were compared with the reference genome, and the results showed that the similarity between GhGDSL102 and the reference sequence was 100%.

[0049] Construction of 2GhGDSL102 overexpression vector and transformation of Agrobacterium

[0050] The target gene GhGDSL102 was connected to the overexpression vector pEarleyGate 101 by BP and LR reaction, and then Arabidopsis thaliana overexpressing the GhGDSL102 gene was obtained by infecting Arabidopsis thaliana by floral dipping method. The above DNA fragment was first connected to the Gateway entry vector, and the recovered DNA fragment was connected to the pDONR Zeo vector by BP reaction. The product after connecting the vector was then transformed into the competent Escherichia coli Trans 5α.

[0051] Single clones were selected for bacterial liquid identification, and then sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The correct positive bacterial liquid was selected for plasmid extraction by shaking. 100 μL of the correct bacterial liquid was added to 5 mL of LB liquid culture medium containing the corresponding resistance, and placed in a shaking incubator at 37°C and 180 rpm for overnight culture. Plasmid was extracted using PlasmidMiniPrep Kit. The correctly sequenced GhGDSL102-ZEO entry vector was connected to the pEarleyGate 101 vector through LR reaction.

[0052] The product after ligation with the vector was transformed into the competent E. coli Trans 5α and a single clone was picked for bacterial liquid identification. Then, the correct positive bacterial liquid containing the target gene was shaken to extract the GhGDSL102-101 plasmid and transformed into GV3101 Agrobacterium.

[0053] 3GhGDSL102 Arabidopsis genetic transformation

[0054] (1) Select wild-type Arabidopsis thaliana (Col-0) in full bloom and cut off the fruit pods that have formed on the plants before transformation. This step helps to increase the probability of obtaining positive plants after transformation.

[0055] (2) Agrobacterium containing GhGDSL102-101 was inoculated into 50 mL of LB liquid medium containing Kan and Rif, and cultured in a conical flask at 28°C and 210 rpm with shaking overnight.

[0056] (3) Add the prepared transformation medium (Table 1) and adjust the OD 600 The resuspended bacterial solution was allowed to stand in the dark for about 3-4 hours.

[0057] Table 1 Transformation medium formula

[0058]

[0059] (4) Gently immerse the inflorescence of each Arabidopsis plant completely in the transformation medium for 60 seconds, and then place it in a dark environment for 24 hours to allow the GhGDSL102-101 strain to infect the Arabidopsis inflorescence. Then grow it under normal culture conditions and wait until the fruit pods of the plants mature, then harvest the T0 generation seeds.

[0060] Screening and identification of 4GhGDSL102 transgenic Arabidopsis

[0061] The collected T0 Arabidopsis seeds were first dried and placed in a suitable container with a desiccant to complete the after-ripening effect. Then, the treated seeds were sown on a planting tray containing nutrient soil: vermiculite volume = 1:1. To ensure that the soil is evenly infiltrated from bottom to top, it is necessary to irrigate from the bottom of the tray, and then cover it with a layer of transparent plastic film to maintain a suitable humidity. Subsequently, after the seeds have been cultured in the growth room for one week, they are treated with 10% glufosinate herbicide, sprayed twice a day, and treated for one week. The T1 generation GhGDSL102 overexpression positive plants with normal growth and green leaves were selected, and their leaf DNA was extracted. The positive identification was performed by molecular biological methods using universal primers to verify whether these plants have successfully integrated the GhGDSL102 gene.

[0062] In order to further clarify the function of GhGDSL102, the present invention overexpressed GhGDSL102 in Arabidopsis. The experiment used the pEarleyGate 101 overexpression vector ( Figure 2 ), Agrobacterium containing the overexpression vector was genetically transformed into wild-type Arabidopsis using the floral dipping method. After culturing under normal photoperiod and waiting for maturity, mature transgenic T0 generation seeds were collected. In terms of plant resistance to the pEarleyGate 101 vector, resistance to glufosinate herbicide was demonstrated. The seedlings were sprayed with 10% glufosinate herbicide ( Figure 3a). By spraying herbicides, positive plants are screened and their DNA is extracted for positive identification ( Figure 3 b), and then 8 transgenic lines were selected for reproduction. After stable inheritance in the T3 generation, 3 lines with higher expression levels were identified by fluorescence quantitative PCR. Compared with the wild type, the expression level of the GhGDSL102 gene in the overexpression line was significantly increased ( Figure 3 (c).

[0063] 5 Determination of oil content and fatty acid composition in Arabidopsis seeds

[0064] Weigh 20 mg of mature Arabidopsis seeds and grind them into powder using an automatic sample grinder (JXFSTRBP-64, Shanghai Jingxin). Use a Nexis GC-2030 (Shimadzu Corporation, Kyoto, Japan) gas chromatograph to determine the oil content and fatty acid composition of the samples. The detection method of fatty acids can be found in Xin et al. (Xin et al. 2022).

[0065] In order to clarify the effect of GhGDSL102 on plant oil accumulation, the present invention screened three overexpression transgenic lines and measured the oil content and fatty acid composition of their T3 mature seeds. The results showed that the oil content of the three overexpression lines of Arabidopsis thaliana was significantly reduced by 9.95%, 17.19% and 13.87% respectively compared with the wild type. Figure 4 The oleic acid (C18:1) content of the seeds of the three overexpression lines was reduced by 4.9%, 10.9% and 7.3% compared with the wild type (see Figure 4 b), while the linolenic acid content increased by 8.86%, 9.96% and 8.73% respectively. These results indicate that overexpression of the GhGDSL102 gene in Arabidopsis can reduce the oil content of mature seeds and also affect the content of oleic acid and linolenic acid in the fatty acid composition of Arabidopsis seeds.

[0066] 6VIGS silencing of cotton GhGDSL102 expression

[0067] (1) Vector construction: SnapGene software was used to design primer pairs with appropriate Tm from the CDS sequence of GhGDSL102, and the specificity was verified by CottonMD. A 210 bp silencing fragment was cloned from the GhGDSL102 plasmid, and the PCR product was inserted between the Xba I and BamH I sites of the CLCRV silencing expression vector to obtain the CLCRV::GhGDSL102 recombinant plasmid.

[0068] (2) Infection of cotton: Select the strong growing 'Zhong 24' as the recipient (delinted), soak it in clean water for a day and night until it turns white, and then spread it flat in moist nutrient soil. Infect after about 10 days (when the two cotyledons are flattened). Activate the PCR-correct Agrobacterium CLCRV::GhGDSL102, CLCRV::00, CLCRV::PDS and auxiliary vector overnight (28℃ shaker 210rpm), centrifuge at 5000rpm for 8min in a 50ml centrifuge tube, and collect the colonies. Add an appropriate amount of the prepared transformation medium and adjust the OD 600 The value was adjusted to 0.8-1, and the resuspended bacterial solution was placed in the dark for about 3 hours. The auxiliary vector was mixed with CLCRV::GhGDSL102, CLCRV::00 and CLCRV::PDS in a ratio of 1:1, and injected into the whole cotyledon of 'middle 24' through a 1mL syringe. After 24 hours of darkness, the mixture was grown normally in the greenhouse.

[0069] (3) Fatty acid detection: 15 days after injection, when the CLCRV::PDS-infected 'Zhong 24' showed whitening, the silencing efficiency of CLCRV::GhGDSL102 was detected. When it was confirmed that the expression of GhGDSL102 was inhibited, the top three leaves of CLCRV::GhGDSL102 and CLCRV::00 were cut and their fatty acid compositions were measured. The collected leaves and seeds were dried using a vacuum freeze dryer ( Alpha I-5; Martin Christ) was freeze-dried. The detection method of fatty acids is shown in Xin et al. (Xin et al. 2022).

[0070] GhGDSL102 in cotton was reduced by VIGS. PDS was injected into the cotyledons of cotton seedlings when they were flat. A yellowing phenotype appeared about 20 days later. The yellowing phenotype of CLCrV::PDS plants was analyzed and found to be still obvious in the late growth stage of the plants, indicating that the gene silencing was successful and the silencing efficiency was stable ( Figure 5 The relative expression of GhGDSL102 in CLCrV::00 and CLCrV::GhGDSL102 plants was detected by qRT-PCR. It was found that the gene expression level of CLCrV::GhGDSL102 was significantly lower than that of CLCrV::00, indicating that GhGDSL102 was successfully silenced in cotton ( Figure 5 b). At the same time, the present invention measured the oil content of the leaves of the same position and size of the silent cotton plants, as well as the cotton seeds of mature cotton bolls. The results showed that the oil content of the leaves and cotton seeds of the CLCrV::GhGDSL102 plants was significantly increased compared with the control group CLCrV::00, and the oil content in the leaves of the three silent plants was significantly increased by 35.36%, 13.98% and 21.45% respectively ( Figure 5c), the oleic acid content in leaves increased significantly by 52.01%, 27.65% and 44.45% ( Figure 5 d); the oil content in cottonseed increased by 12.17%, 8.71% and 9.11% respectively ( Figure 5 e), the oleic acid content in cottonseed increased by 8.22%, 4.86% and 9.63% respectively ( Figure 5 (f)

[0071] The above results show that silencing GhGDSL102 in cotton will increase the oil content and oleic acid content in cotton leaves and cotton seeds. The results show that GhGDSL102 plays a role in the synthesis of cottonseed oil and fatty acids.

[0072] 7 Identification of transgenic cotton knockout lines and detection of editing sites in target sequences

[0073] The DNA of the knockout transgenic cotton strain was extracted and identified using 2×TaqPlus Master Mix II (Dye Plus) from Vazyme.

[0074] Detection primers were designed upstream and downstream of the sgRNAs target sequence, the upstream primer was 5'-TTCTGAGAACTTCAGTGGCAC-3', and the downstream primer was 5'-GTAACAAAATGACCTAAGGTC-3'. Then, 6 nucleotide barcodes were added to the 5' end of the upstream and downstream primers to detect different samples. A total of 20 barcode primers were designed in this experiment. The upstream and downstream primers were arranged and combined. A total of 80 transgenic cotton plants were sequenced at one time. The specific primer sequences are shown in Table 2. The raw data of double-end sequencing was obtained, and the CRISPR_Barcode_HiTom_Analysis analysis process (https: / / github.com / tiramisutes / CRISPR_Barcode_HiTom_Analysis) was used to obtain the specific mutations and editing efficiency of each plant.

[0075] Table 2 Barcode primer list

[0076]

[0077] In order to further study the biological function of GhGDSL102 in cotton, this study constructed the CRISPR / Cas9 vector of GhGDSL102 and transfected the hypocotyls of Baimian No. 1 seedlings with Agrobacterium tumefaciens. After target site identification, three GhGDSL102 cotton edited lines were obtained in the T0 generation ( Figure 6 The mutation sites of these three strains were amplified ( Figure 6b), after sequencing, two types of editing were obtained, namely -1bp and -2bp ( Figure 6 (c) The results showed that the mutation of the GhGDSL102 gene was achieved through precise editing by the CRISPR / Cas9 system, and the phenotypes of the three edited plants will be further identified.

[0078] Editing target and phenotype analysis of 8GhGDSL102 gene editing strain

[0079] The T1 generation of transgenic plants were planted in the field in Anyang. There were 25 plants (named as CR), including 9 CR1 plants, 8 CR2 plants, and 8 CR3 plants. The target sequences of all strains were amplified by PCR and sequenced using Sanger technology to obtain the editing types of T1 plants ( Figure 7 ). The analysis found that in the CR1 line, except for 3 strains that were not edited, the other 6 strains had editing types including 1bp deletion; in the CR2 line, 4 strains were not edited, and the other 4 strains had editing types including 1bp deletion and 5bp deletion; in the CR3 line, 4 strains were not edited, and the other 4 strains had editing types including 1bp deletion. The T1 generation had two editing types, including 1bp deletion and 5bp deletion.

[0080] To determine the editing efficiency of the transgenic edited lines, the target sequences of 80 T2 transgenic lines were amplified by PCR using barcode primers. After the PCR products were mixed and purified, the editing type of the target sequence was determined by high-throughput sequencing ( Figure 8 ), and the results showed that there were 39 pure lines with 1bp deletion in the editing type, 29 heterozygous lines with 1bp deletion, 7 lines with 5bp deletion as the main editing type, and 5 lines with 1bp insertion as the main editing type.

[0081] The oil content of seeds harvested from the T2 generation was tested using a nuclear magnetic resonance oil content meter. Since fewer T2 generation seeds were obtained, the oil content was first determined by nuclear magnetic resonance, and then GC was used to measure the changes in oil content and fatty acids when the phenotype of T3 generation seeds was stable. In the T2 generation, among the three edited cotton types, namely -1bp (CR-1), -5bp (CR-2), and +1bp (CR-3), the oil content of CR-1 (-1bp homozygous line) was significantly increased by 19.4%.

[0082] 9 Identification of transgenic cotton overexpression lines

[0083] The GhGDSL102-OE vector was constructed using the cotton OE vector WMV067-AADA+GFP. Fig. 9 ) and transfected the hypocotyls of Baimian No. 1 seedlings to obtain 9 GhGDSL102 transgenic cotton lines. Universal primers were used to identify the overexpression vector. A total of 3 overexpression transgenic lines were identified in the T0 generation ( Fig.10 The expression levels of the three strains were measured, and the expression levels of GhGDSL102 in the three overexpression strains were significantly increased compared with the wild type ( Fig.10 In (a), T2 transgenic plants were obtained after two generations of continuous self-pollination.

[0084] Phenotypic Analysis of 10GhGDSL102 Overexpressing Transgenic Cotton

[0085] The oil content of mature cotton seeds of the T2 generation overexpression strains and the control material Baimian No. 1 planted in the Sanya Nanfan field in 2024 was determined by GC. The oil content of the three overexpression cotton lines was significantly reduced by 11.70%, 9.14% and 19.25% respectively compared with the control material ( Fig.11 a), the oleic acid content in the fatty acid components was significantly reduced by 5.54%, 7.09% and 6.29% ( Fig.11 (b)

[0086] In summary, the present invention transforms Arabidopsis thaliana by overexpressing the GhGDSL102 gene, and then determines the seed oil content of the transgenic T3 line, and finds that heterologous expression of GhGDSL102 can significantly reduce the oil content of Arabidopsis seeds. The oil content of the three overexpression lines of Arabidopsis thaliana is reduced by 9.95%, 17.19% and 13.87% respectively compared with the wild type. The oleic acid (C18:1) content of the seeds of the three overexpression lines of Arabidopsis thaliana is reduced by 4.9%, 10.9% and 7.3% respectively compared with the wild type, while the linolenic acid content is increased by 8.86%, 9.96% and 8.73% respectively. Therefore, it is speculated that the heterologous expression of GhGDSL102 in Arabidopsis thaliana reduces the C18:1 content, thereby reducing the oil content of Arabidopsis thaliana, and at the same time affecting the positive regulation of the gene on the synthesis of linolenic acid.

[0087] At the same time, the present invention preliminarily verifies the function of GhGDSL102 in cotton by using the virus-induced gene silencing (VIGS) method. The results showed that after the expression of the gene was significantly reduced, the oil content of cotton leaves and cotton seeds of the CLCrV::GDSL strain increased, with the three strains increasing by 35.36%, 13.98% and 21.45% in leaves, and 12.17%, 8.71% and 9.11% in cotton seeds respectively; the oleic acid (C18:1) content in leaves and cotton seeds of the three silenced strains increased compared with the control group, with the content in leaves increasing by 52.01%, 27.65% and 44.45%, and the content in cotton seeds increasing by 8.22%, 4.86% and 9.63% respectively. Therefore, it is speculated that after GhGDSL102 was silenced in cotton, the content of C18:1 was increased, thereby increasing the accumulation of cottonseed oil. Since the content of linolenic acid in cottonseed oil is relatively low, no significant change was observed.

[0088] At the same time, the present invention obtains three positive transgenic strains by overexpressing cotton, and measures the oil content of cottonseed of the T2 generation of overexpressing transgenic cotton plants. The oil content of cottonseed of the three overexpressing materials is significantly reduced by 11.70%, 9.14% and 19.25% respectively compared with the control, and the C18:1 content in the fatty acid component is reduced by 5.54%, 7.09% and 6.29% respectively. Among the three edited cottonseed oil contents of the three edited strains, namely -1bp (CR-1), -5bp (CR-2) and +1bp (CR-3), CR-1 (-1bp homozygous line) is significantly increased by 19.4%. After the seeds of the T3 generation are harvested, the changes in oil content and fatty acids are further measured. The above research results show that the GhGDSL102 gene can affect the accumulation of cottonseed oil, and GhGDSL102 is a gene that negatively regulates seed oil content.

[0089] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of GhGDSL102 gene in regulating plant oil content.

2. The use according to claim 1, characterized in that: The plants include cotton and Arabidopsis thaliana.

3. A method for regulating plant oil content, characterized in that: Overexpression of the GhGDSL102 gene reduces the oil content of the plant, while silencing or knocking out the GhGDSL102 gene increases the oil content of the plant.

4. The method according to claim 3, characterized in that The plants include cotton and Arabidopsis thaliana.

5. The method according to claim 3, characterized in that: Overexpression of the GhGDSL102 gene reduces the oil content of plant seeds, while silencing or knocking out the GhGDSL102 gene increases the oil content of plant seeds.

6. The use of the GhGDSL102 gene in changing the fatty acid composition of plants, characterized in that: Overexpression of the GhGDSL102 gene reduced the oleic acid C18:1 content, while silencing or knocking out the GhGDSL102 gene increased the oleic acid C18:1 content.

7. A method for regulating plant fatty acid composition, characterized in that: Overexpression of the GhGDSL102 gene reduced the oleic acid C18:1 content, while silencing or knocking out the GhGDSL102 gene increased the oleic acid C18:1 content.

8. Application of inhibiting the expression of GhGDSL102 gene in increasing the oil content of plants.

9. Application of inhibiting the expression of GhGDSL102 gene in increasing the content of plant oleic acid C18:1.

Images