Molecular Markers for Identifying Zhongwei Goats with Long Hair in the Femoral Region and Their Applications

Abstract

The present invention belongs to the technical field of genetic breeding, and specifically relates to a molecular marker for identifying Zhongwei goats with long woolly thighs and its application. The molecular marker includes Locus 1 or Locus 2 or Locus 3. The nucleotide sequence of the molecular marker containing Locus 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at the 102nd bp in SEQ ID NO.1; the nucleotide sequence of the molecular marker containing Locus 2 is shown in SEQ ID NO.2, and a mutation from A to G occurs at the 102nd bp in SEQ ID NO.2; the nucleotide sequence of the molecular marker containing Locus 3 is shown in SEQ ID NO.3, and a mutation from T to G occurs at the 102nd bp in SEQ ID NO.3. The Zhongwei goats with the trait of long woolly thighs can be bred by using this molecular marker.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a molecular marker for identifying long-haired Zhongwei goats and an application thereof. Background Art

[0002] Zhongwei goat is the only goat breed in the world that produces white fur. In recent years, due to changes in livestock and poultry industry demand and feeding conditions, the current core population of Zhongwei goats is seriously insufficient. The problems of too few sheep in the core production area, low reproduction rate, and degradation of excellent germplasm traits have become the difficulties in the protection of the germplasm resources of this breed. Zhongwei goat is not only famous for its high-quality cashmere, but its fur also has certain economic value. Sand fur refers to the fur obtained from Zhongwei goats around 40 days old. This fur is white, shiny like jade, neatly curved, and beautiful inflorescence. It is valued for its unique texture and characteristics. Therefore, improving the fur quality of Zhongwei goats and cultivating Zhongwei goats with excellent sand fur quality is one of the urgent problems to be solved in the current Zhongwei goat conservation work. The natural length of the hair strand is an important indicator of the sand fur trait of goats, but the existing technology has yet to study the natural length of goat hair strands at the genetic level. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a molecular marker for identifying long-haired Zhongwei goats, which can be used to identify the natural length trait of goat hair strands and to breed goats with long-haired strands.

[0004] The technical solution provided by the present invention is as follows:

[0005] In a first aspect, the present invention provides a molecular marker for identifying a long-haired Zhongwei goat, wherein the molecular marker comprises site one, site two or site three;

[0006] The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1;

[0007] The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp;

[0008] The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

[0009] Wherein, the site 1 is located at position 6521711 on chromosome 16 of the Zhongwei goat genome;

[0010] The second locus is located at the 6,525,211th position on chromosome 16 of the Zhongwei goat genome;

[0011] The third locus is located at the 6,529,012th position on chromosome 16 of the Zhongwei goat genome.

[0012] In the second aspect of the present invention, there is provided an application of the said molecular marker in identifying the natural length trait of the wool strands of Zhongwei goats.

[0013] As a preferred embodiment of the present invention, the method for identifying the natural length trait of the wool strands of Zhongwei goats comprises the following steps:

[0014] Detect the base at the 102bp position in the said molecular marker of the goat to be tested. When the base at this position is G, the natural length of the wool strands of the goat is greater than that of the goat when the base at this position is T or A.

[0015] In the third aspect of the present invention, there is provided an application of the said molecular marker in the genetic breeding of Zhongwei goats.

[0016] As a preferred embodiment of the present invention, the said molecular marker is used for breeding Zhongwei goats with long wool strands.

[0017] In the fourth aspect of the present invention, there is provided a genetic breeding method for Zhongwei goats with long wool strands, comprising the following steps:

[0018] Detect the genotype at the 102bp position in the said molecular marker of Zhongwei goats, and select individuals with the GG genotype as parents to increase the natural length of the wool strands of the offspring.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] The present invention provides three SNP loci affecting the natural length of the wool strands of Zhongwei goats and molecular markers respectively containing three different SNP loci. By selecting individuals with the GG genotype at the SNP loci as male or female parents, the natural length of the wool strands of the offspring can be increased. Description of the Drawings

[0021] Figure 1 It is a principal component analysis diagram, with the first three explained variance percentages, namely PC1, PC2, and PC3 as the X, Y, and Z axes;

[0022] Figure 2 It is a visualization diagram of the G matrix;

[0023] Figure 3 It is a distribution diagram of the quality-controlled SNPs in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size;

[0024] Figure 4The GWAS results of the natural length of the hair strands of Zhongwei goats are shown for Manhattan Plots (A) and QQ-plots (B). DETAILED DESCRIPTION

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0026] Zhongwei goats are the only goat breed in the world that produces white fur. Zhongwei goats are not only famous for their high-quality cashmere, but their fur also has certain economic value. The natural length of the hair strands is an important indicator of the characteristics of goat fur, but the existing technology has yet to study the natural length of goat hair strands at the genetic level.

[0027] Based on this, the present invention provides a molecular marker for identifying long-haired goats, wherein the molecular marker comprises site one, site two or site three;

[0028] The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1;

[0029] The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp;

[0030] The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

[0031] By using this molecular marker and selecting individuals with the GG genotype as the father or mother, the natural length of the hair strands of the offspring can be increased.

[0032] Example 1

[0033] Source of experimental animals and phenotypes:

[0034] The test goats of the present invention are all from the Zhongwei goat breeding farm in Ningxia Hui Autonomous Region. The phenotypic records of natural hair length in 2022 were measured, and the results are shown in Table 1. Ear tissue samples of 367 Zhongwei goats were collected, and all samples were immediately stored in liquid nitrogen after collection, and stored at -80°C for a long time after being transported to the laboratory.

[0035] Table 1 Description of the natural length of Zhongwei goat wool strands

[0036]

[0037] I. Genomic DNA Extraction and Quality Inspection

[0038] The ear tissue samples were used for DNA extraction by the phenol-chloroform method. A spectrophotometer, model NanoDrop2000, was used to detect the DNA concentration, the absorption wavelength ratio of nucleic acid, protein and phenolic substances at the highest absorption peak (260 nm / 280 nm), and the absorption wavelength ratio of carbohydrates at the highest absorption peak (260 nm / 230 nm). The DNA quality was detected and evaluated using 1% agarose gel.

[0039] II. Library Construction and Sequencing on the Machine

[0040] After the qualified genomic DNA samples were processed, the genomic DNA was randomly fragmented into fragments with a length of 350 bp using a Covaris ultrasonic crusher. The DNA fragments completed the entire library preparation through steps such as end repair, adding polyA, adding sequencing adapters, purification, and PCR amplification. After the library construction was completed, Qubit2.0 was used for preliminary quantification, and the qPCR method was used to accurately quantify the effective concentration of the library to ensure the library quality. After the library quality was detected and qualified, the BGI MGI-T7 sequencing platform was used for sequencing, and the sequencing mode was PE150 mode.

[0041] III. Identification, Screening and Annotation of Variant Sites

[0042] The Raw reads data was filtered into Clean reads data using fastp software version V0.20.0. A genomic index was built for the reference genome. The quality-controlled Clean reads data was aligned with the goat reference genomes ARS1 and GCF_001704415.1 using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam file was converted into a bam file and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in GenomeAnalysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam file to obtain the final bam file. An index was built for the final bam file, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the vcf file, it was filtered using the VariantFiltration module. The detected gene variations were functionally annotated using the ANNOVAR software package. Based on the position of the variant sites on the reference genome and the gene position information on the reference genome, the regions in the genome where the variant sites occurred could be obtained, including intergenic regions, intronic regions, or CDS regions, etc., as well as the effects of the variations.

[0043] IV. Data quality control and population stratification correction

[0044] The obtained genotyping data was quality-controlled using PlinkV1.90 software, removing individuals with genotype call rate < 98%, SNPs with call rate < 98%, SNPs with minor allele frequency < 5%, and SNPs with Hardy-Weinberg equilibrium test P value < 10 -6 . The first three principal components were calculated using the "-pca 3" parameter of PlinkV1.90 software. The PCA plot was drawn using R language V3.6.0. The results were as Figure 1 shown. There was no population stratification in the experimental samples, and the population stratification phenomenon of Zhongwei goats did not need to be corrected. The genetic distance analysis based on IBS and the genomic relatedness analysis based on the G matrix were performed on this population using Plinkv1.90. The results were as Figure 2 shown. Figure 2 Each small square in it represents the relatedness value between every two samples from the first to the last sample. The larger this value, the closer it is to dark green, indicating that the genetic relationship between the two individuals is closer; Figure 2 indicating that the average genetic distance between Zhongwei goat individuals is relatively far.

[0045] A total of 32,219,876 SNPs participated in quality control. After filtering by SNP detection rate, Hardy-Weinberg equilibrium, minor allele frequency, and individual detection rate, the filtering conditions were -geno 0.02, -maf 0.05, -hwe 1e -6 , -mind 0.1. A total of 15,817,002 SNP loci were obtained for subsequent analysis. These loci were evenly distributed on the 29 pairs of autosomes of goats, as Figure 3 shown.

[0046] V. Genome-wide association study

[0047] The fastGWA-mlm model in GCTA V1.94.0beta software was used to conduct an association analysis between SNPs and the natural length trait of wool strands.

[0048] y = X snp β snp + X c β c + g + e

[0049] where y is an n×1 phenotypic vector; X snp is the genotype vector with an effect of β snp ; X c is the association matrix with gender as a fixed covariate, and its corresponding coefficient is β c ; g is the vector of the total genetic effect captured by the genetic relationship matrix derived from SNPs, g ~ N(0, ); π is the vector of the genetic relationship matrix derived from SNPs, where all non-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).

[0050] The Bonferroni correction method was used to determine the significance threshold of GWAS. The genomic inflation factor λ of the test statistic was calculated by the slope of the linear regression between the observed quantiles and the theoretical quantiles in R language V3.6.0. After calculation, the λ value of the natural length trait of wool strands was 1.111, indicating no genomic expansion. Based on the resequencing data of 367 Zhongwei goats, 76 significant SNP loci related to the natural length trait of wool strands were detected. These loci were located on chromosomes 2, 3, 4, 7, 9, 11, 13, 16, 19, 21, 24, and 29, as shown in Table 2, Supplementary Table 2 and Figure 4 shown. Figure 4 The genome-wide significant SNPs in

[0051] Table 2 Significant SNP loci related to the natural length trait of wool strands

[0052]

[0053] Supplementary Table 2 Significant SNP Loci Related to the Natural Length Trait of Wool Strands

[0054]

[0055] VI. SNPs Affecting the Natural Length Trait of Wool Strands in Zhongwei Goats

[0056] Further research on SNPs reaching the genome-wide significance level found that the T→G mutation at position 6521711 on chromosome 16 of the Zhongwei goat genome can significantly affect the natural length trait of wool strands in Zhongwei goats.

[0057] The association analysis between the SNP locus at position 6521711 on chromosome 16 of the Zhongwei goat genome and the natural length trait of wool strands is shown in Table 3 as follows:

[0058] Table 3 Polymorphism at Position 6521711 on Chromosome 16 of the Zhongwei Goat Genome

[0059]

[0060] Note: Different letters indicate significant differences ( P <0.05), and the same letter indicates no significant difference ( P >0.05).

[0061] As can be seen from Table 3, for individuals with the genotype GG, the natural length of their wool strands is the longest.

[0062] In the genome-wide association analysis, the SNP molecular marker at position 6521711 on chromosome 16 of the Zhongwei goat genome reached the genome-wide significant level, indicating that this marker is significantly correlated with the natural length trait of wool strands in Zhongwei goats, and when this marker mutates to G, it is beneficial for Zhongwei goats to have a longer natural length of wool strands, as shown in Table 4.

[0063] Table 4 SNP Gene Frequencies and Genotype Frequencies at Position 6521711 on Chromosome 16 of the Zhongwei Goat Genome

[0064]

[0065] The nucleotide sequence of the molecular marker containing the T→G mutation site at position 6521711 on chromosome 16 is shown in SEQ ID NO.1, specifically: CCCTGAGCCATACAGCAAATTCCCACCGGCTATCTGTTTTACATGTGGTAATGTATATGTTTCAGTGCATGCGACTCTCTCAAACATCCCACTTTCTCCTTSTCCACTGTATCCACAAGTCTGTTCTCTATGTCTGTGATGCAGATACTGTCACGGTATTTGAGGCTGTTTCATCCACAGGCTGGAAAGTCACAGTGAGAGAG, where S is T / G.

[0066] Further research on SNPs reaching the genome-wide significance level found that the A→G mutation at position 6525211 on chromosome 16 of the Zhongwei goat genome can significantly affect the natural length trait of the wool strands of Zhongwei goats.

[0067] The association analysis of the SNP locus at position 6525211 on chromosome 16 of the Zhongwei goat genome with the natural length trait of the wool strands is shown in Table 5:

[0068] Table 5 Polymorphism at position 6525211 on chromosome 16 of the Zhongwei goat genome

[0069]

[0070] Note: Different letters indicate significant differences ( P <0.05), and the same letter indicates no significant difference ( P >0.05).

[0071] As can be seen from Table 5, for individuals with the genotype GG, the natural length of their wool strands is the longest.

[0072] In the genome-wide association study, the SNP molecular marker at position 6525211 on chromosome 16 of the Zhongwei goat genome reached the genome-wide significant level, indicating that this marker is significantly correlated with the natural length trait of the wool strands of Zhongwei goats, and when this marker mutates to G, it is beneficial for Zhongwei goats to have longer wool strands. See Table 6.

[0073] Table 6 SNP gene frequency and genotype frequency at position 6525211 on chromosome 16 of the Zhongwei goat genome

[0074]

[0075] The nucleotide sequence of the molecular marker containing the A→G mutation site at position 6525211 on chromosome 16 is shown in SEQ ID NO.2, specifically: TAGACTGCAATGTAAATAAAGCAACTATATTTCTTTAAAAAAAATCCATGGGTATTAATTCTGTTTTTATTGTTTGGACTCTACAGTACTTGGTCTTTTTASAATTTCACATTCTGCTATAAAAGTGTGGTTTAAACAAAAACTATGTAGAAATATTCCTGTATATTTTTATAATCTACCTTACATGGATTTTAATTCAAGGA, where S is A / G.

[0076] Further research on SNPs reaching the genome-wide significance level found that the T→G mutation at position 6529012 on chromosome 16 of the Zhongwei goat genome can significantly affect the natural length trait of the wool strands of Zhongwei goats.

[0077] The association analysis of the SNP locus at position 6529012 on chromosome 16 of the Zhongwei goat genome with the natural length trait of the wool strands is shown in Table 7:

[0078] Table 7 Polymorphism at position 6529012 on chromosome 16 of the Zhongwei goat genome

[0079]

[0080] Note: Different letters indicate significant differences ( P <0.05), and the same letter indicates no significant difference ( P >0.05).

[0081] As can be seen from Table 7, for individuals with the genotype GG, the natural length of their wool strands is the longest.

[0082] In the genome-wide association study, the SNP molecular marker at position 6529012 on chromosome 16 of the Zhongwei goat genome reached the genome-wide significant level, indicating that this marker is significantly associated with the natural length trait of the wool strands of Zhongwei goats, and when this marker mutates to G, it is beneficial for Zhongwei goats to have a longer natural length of wool strands, as shown in Table 8.

[0083] Table 8 SNP gene frequencies and genotype frequencies at position 6529012 on chromosome 16 of the Zhongwei goat genome

[0084]

[0085] The nucleotide sequence of the molecular marker containing the T→G mutation site at position 6529012 on chromosome 16 is as shown in SEQ ID NO.3, specifically:

[0086] TAGCTTTCTTGTCAGAAATCTTCATGAATACTTATCATAAAATGTACTTACAGTTCCAATCTTGGAGCTGACAGAAGCTTATTAAAACACATGTACACTTGSGGCTGAGTCATGTCAATGTATGGGAAAACCACCACAATATTATAAAGTAATTAGTCTCCAATTAAAATAAATAAATTAAGTTTAAAAATGTATTTATTTTA, where S is T / G.

[0087] Thus, it can be seen that Zhongwei goats with long natural length of wool strands can be bred by the T→G mutation at position 6521711 on chromosome 16 of the Zhongwei goat genome, or by the A→G mutation at position 6525211 on chromosome 16 of the Zhongwei goat genome, or by the T→G mutation at position 6529012 on chromosome 16 of the Zhongwei goat genome. By selecting individuals with the GG genotype and using them as the male parent or female parent, the natural length of the wool strands of the offspring of Zhongwei goats can be increased.

[0088] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints themselves can be selected. To avoid repetition, preferred embodiments of the present invention are described.

[0089] Although the preferred embodiments of the present invention have been described, once those skilled in the art learn the basic creative concept, additional changes and modifications can be made to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0090] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these changes and modifications.

Claims

1. A typing detection reagent for molecular markers related to the long-hair strand trait of Zhongwei goats in identifying the natural length trait of hair strands of Zhongwei goats, characterized in that: The molecular marker comprises site one, site two or site three; The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1; The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp; The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

2. The use according to claim 1, characterized in that: The method for identifying the natural length of Zhongwei goat hair strands includes the following steps: The base at the 102 bp position in the molecular marker of the goat to be tested is detected. When the base at the position is G, the natural length of the goat's hair strand is greater than the natural length of the goat's hair strand when the base at the position is T or A.

3. The use according to claim 2, characterized in that: The detection of the base at the 102 bp position in the molecular marker of the goat to be tested is carried out by using a whole genome resequencing method.

4. Application of a typing detection reagent for molecular markers related to the long-haired strand trait of Zhongwei goats in breeding long-haired strand Zhongwei goats, characterized in that: The molecular marker comprises site one, site two or site three; The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1; The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp; The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

5. The use according to claim 4, characterized in that: The following steps are involved: The genotype of Zhongwei goats at the 102 bp position in the molecular marker was detected, and individuals with the GG genotype were selected as parents to increase the natural length of the hair strands of the offspring.

Images