Adeno-associated virus mutants and uses thereof

By constructing a mutant adeno-associated virus capsid protein with a specific amino acid sequence, the problems of insufficient muscle targeting and liver tropism of existing adeno-associated viruses have been solved, realizing a recombinant adeno-associated virus vector with high targeting and safety, thus improving the efficacy of gene therapy.

CN119751598BActive Publication Date: 2025-11-07GUANGZHOU PACKGENE BIOTECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411819547.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-16
Publication Date
2025-11-07
Estimated Expiration
2044-07-16

AI Technical Summary

Technical Problem

Existing adeno-associated virus gene therapy vectors have limitations in muscle targeting and liver tropism, leading to high dose requirements and side effects, which limits their application in gene therapy.

Method used

By constructing adeno-associated virus (AAV) capsid protein mutants with specific amino acid sequences, muscle targeting was improved and liver tropism was reduced. AAV variants with high targeting were screened using a specific motif method, and recombinant AAV vectors were constructed.

Benefits of technology

It achieved an approximately 496.41-fold increase in muscle targeting and a nearly 100-fold decrease in liver tropism, thereby improving the specificity and safety of the recombinant adeno-associated virus vector and expanding its application scope.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119751598B_ABST
    Figure CN119751598B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and discloses an adeno-associated virus mutant and application thereof. The amino acid sequence of the adeno-associated virus capsid protein mutant is shown in SEQ ID No. 8. The adeno-associated virus capsid protein mutant, the expression vector thereof, the host cell, and the recombinant adeno-associated virus are applied in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases. The adeno-associated virus capsid protein mutant has muscle or heart targeting property, the muscle targeting property is increased by about 496.41 times at most, the liver tropism is also nearly 100 times lower than that of the control group, the specificity is good, and the adeno-associated virus capsid protein mutant also shows good effect in NHP. The application can promote the AAV-based gene therapy method to be applied in a large scale and in a socialized manner.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This patent application is a divisional application of Chinese Patent Application No. 2024109520630, filed on July 16, 2024, entitled "Adeno-Associated Virus Mutants and Applications Thereof". TECHNICAL FIELD

[0002] The present application relates to the field of biological medicine, in particular to an adeno-associated virus mutant and applications thereof. BACKGROUND

[0003] Adeno-associated virus (AAV) is a kind of small non-enveloped virus wrapping linear single-stranded DNA genome, belonging to the family of Parvoviridae and the genus of Dependovirus, which requires the participation of helper virus (usually adenovirus) for replication. The genome of AAV is a single-stranded DNA fragment, which is contained in a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and inverted terminal repeat (ITR). Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus, which has been widely used as a gene transfer vector in gene therapy and vaccine research due to its wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good spreading performance and stable physical properties. In medical research, rAAV has been used for gene therapy research (including in vivo and in vitro experiments) of various diseases, such as gene function research, construction of disease models, preparation of gene knockout mice, etc.

[0004] In recent years, gene therapy has become a new method for treating muscle diseases, in which AAV has been widely used as an effective gene vector. For example, Duchenne muscular dystrophy (DMD) is a rare and fatal neuromuscular genetic disease that occurs in one in 3,500-5,000 males worldwide. DMD is caused by changes or mutations in the gene that encodes the dystrophin protein. Symptoms of DMD usually occur in infants and young children, and affected patients may experience developmental delays, such as difficulty walking, climbing stairs, or standing from a sitting position. Elevidys (trade name), whose generic name is delandistrogene moxeparvovec, was previously known as SRP-9001, is a gene therapy delivered by AAVrh74 vector to express a truncated DMD gene (mini-dystrophin gene micro-dystrophin) in DMD patients using the MHCK7 promoter. It was launched in June 2023 for DMD patients who can walk independently (people with deletion mutations in exons 8 and / or 9 are not allowed). On June 20, 2024, the FDA fully approved ELEVIDYS for DMD patients who can walk independently over the age of 4, while accelerating the approval (conditional launch) of the drug for DMD patients who cannot walk independently over the age of 4. In addition, there are some other AAV treatment cases or clinical studies in progress. However, like any drug treatment, AAV treatment also has some potential risks. For example, too high a dose can cause an immune system response, leading to side effects. In addition, high doses also mean higher production difficulty and higher cost. Therefore, developing drugs with higher targeting to reduce drug dosage, or drugs with better specificity to avoid adverse reactions, is the main purpose of AAV serotype modification.

[0005] In summary, although AAV is one of the most widely used and safest gene therapy vectors, further improvements are needed in terms of lower doses in vivo and muscle targeting. It is very important to develop a serotype type with better therapeutic effect, lower treatment dose, less side effect and lower cost. Therefore, it is urgent to develop a new type of AAV gene therapy product with lower dosage requirement and cost to meet the needs of more different patients and promote the scale and social application of AAV-based gene therapy methods. SUMMARY

[0006] The present application aims to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant with muscle or heart targeting and its application.

[0007] To achieve the above-mentioned purpose, the technical solutions adopted by the present application are as follows:

[0008] In a first aspect, the present application provides an adeno-associated virus capsid protein mutant, the amino acid sequence of which comprises a sequence as shown in any one of SEQ ID No. 7-12.

[0009] The adeno-associated virus capsid protein mutant of the present application has muscle or heart targeting property, and the mutant has good targeting property to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.), the muscle targeting property is increased by about 496.41 times compared with the control group AAV9, and the liver tropism is also lower than that of the control group by nearly 100 times, the specificity is good, and good effect is also shown in NHP (Nonhuman primate, non-human primates).

[0010] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present application, a targeting peptide is inserted in the amino acid sequence; the amino acid sequence of the targeting peptide is a sequence as shown in any one of SEQ ID No. 1-6.

[0011] In a second aspect, the present application provides a nucleic acid encoding the adeno-associated virus capsid protein mutant.

[0012] As a preferred embodiment of the nucleic acid of the present application, the nucleotide sequence thereof comprises a nucleotide sequence as shown in any one of SEQ ID No. 13-18.

[0013] In a third aspect, the present application provides an expression vector comprising the nucleic acid.

[0014] In a fourth aspect, the present application provides a host cell comprising the expression vector.

[0015] In a fifth aspect, the present application provides a host cell expressing the adeno-associated virus capsid protein mutant.

[0016] In a sixth aspect, the present application provides a recombinant adeno-associated virus comprising the adeno-associated virus capsid protein mutant.

[0017] The recombinant adeno-associated virus vector constructed by using the AAV capsid protein mutant of the present application has higher specificity, better safety and wider application range.

[0018] As a preferred embodiment of the recombinant adeno-associated virus of the present application, it further comprises a heterologous target gene.

[0019] As a preferred embodiment of the recombinant adeno-associated virus of the present application, the heterologous target gene encodes any one of gene products of interfering RNA, aptamer, endonuclease and guide RNA.

[0020] In a seventh aspect, the present application provides a method for preparing a recombinant adeno-associated virus, comprising introducing into a host cell at least: 1) the nucleic acid or the expression vector, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.

[0021] In an eighth aspect, the present application provides the rAAV prepared by the method.

[0022] In a ninth aspect, the present application provides a pharmaceutical composition comprising the recombinant adeno-associated virus or the rAAV, and a pharmaceutically acceptable carrier.

[0023] In a tenth aspect, the present application provides use of the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, or the rAAV in the preparation of a medicament or a preparation for delivering a gene product into cells or tissues of a subject.

[0024] In a preferred embodiment of the use of the present application, the cells are muscle cells or heart cells; and the tissues are muscle tissues or heart tissues.

[0025] In an eleventh aspect, the present application provides use of the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, or the rAAV in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases.

[0026] In a preferred embodiment of the use of the present application, the muscle diseases include, but are not limited to, any one of Duchenne muscular dystrophy, Becker muscular dystrophy, X-linked myotubular myopathy, limb girdle muscular dystrophy, myotonic muscular dystrophy, and facioscapulohumeral muscular dystrophy; and the heart diseases include, but are not limited to, any one of arrhythmogenic cardiomyopathy, ischemic cardiomyopathy, hypertrophic cardiomyopathy, dilated cardiomyopathy, angina pectoris, coronary heart disease, myocardial infarction, and heart failure.

[0027] Compared with the prior art, the present application has the following advantages:

[0028] The application adopts a method based on a specific motif to construct an AAV virus library for screening of muscle targeting, and can explore effective AAV variants through a fewer number of screening processes, and overcomes the defects of a generally used random library, such as a large number of types, poor screening accuracy, and the need for multiple rounds of repeated screening and verification. The adeno-associated virus capsid protein mutant screened by the application has muscle or heart targeting, the mutant has good targeting for different muscle tissues (quadriceps, biceps and abdominal muscles, etc.), the muscle targeting is increased by about 496.41 times compared with the control group AAV9, the liver tropism is also lower than that of the control group by nearly 100 times, the specificity is good, and the mutant also shows good effects in NHP. The recombinant adeno-associated virus vector constructed by using the AAV capsid protein mutant of the application has higher specificity and better safety, and has a wide application range. This will have important significance for improving the benefits of gene therapy and serving a large number of patients in the future. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Live imaging results of Balb / c mice infected with different serotypes, Figure 1 In the figure, A: 14 days, B: 21 days;

[0030] Figure 2 Muscle (biceps) targeting analysis of Balb / c mice by different serotypes (21 days), Figure 2 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;

[0031] Figure 3 Muscle (triceps) targeting analysis of Balb / c mice by different serotypes (21 days), Figure 3 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;

[0032] Figure 4 Muscle (quadriceps) targeting analysis of Balb / c mice by different serotypes (21 days), Figure 4 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;

[0033] Figure 5 Muscle (abdominal muscle) targeting analysis of Balb / c mice by different serotypes (21 days), Figure 5 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;

[0034] Figure 6 Muscle (gastrocnemius) targeting analysis of Balb / c mice by different serotypes (21 days), Figure 6 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;

[0035] Figure 7Analysis of the heart targeting of different serotypes in Balb / c mice (21 days), Figure 7 wherein A is the mRNA relative expression level and B is the protein expression level;

[0036] Figure 8 Analysis of the liver targeting of different serotypes in Balb / c mice (21 days), Figure 8 wherein A is the mRNA relative expression level and B is the protein expression level;

[0037] Figure 9 Analysis of the muscle targeting and liver tropism of different serotypes in cynomolgus monkeys by NGS detection, Figure 9 wherein A is the 14 days puncture and B is the 28 days puncture. DETAILED DESCRIPTION

[0038] Unless otherwise indicated herein, all technical and scientific terms used have the meanings that are commonly understood by one of ordinary skill in the art.

[0039] Unless otherwise indicated herein, the term "or" means a single element of an enumerated list of alternatives, and the term "and / or" means any one, any two, any three, any more, or all of the listed alternatives.

[0040] The terms "comprising" or "including" or "having" mean that the specified element is included, but not that any other element, integer or step is excluded. In this document, when the term "comprising" or "including" is used, unless otherwise indicated, it is also contemplated that the case where the element, integer or step is composed of the specified element, integer or step is also encompassed. For example, when referring to a polypeptide "comprising" a particular sequence, it is also intended to encompass a polypeptide consisting of the particular sequence.

[0041] An "adeno-associated virus (AAV)" is a nonenveloped icosahedral capsid virus of the Parvoviridae family, including a single-stranded DNA viral genome. The Parvoviridae family includes the Dependovirus genus, which includes AAV, which depends on the presence of a helper virus, such as an adenovirus, for its replication. Due to its relatively simple structure, ability to infect a variety of cells, including quiescent and dividing cells, without integrating into the host genome, and its relatively mild immunogenic profile, AAV has proven useful as a biological tool for expressing a gene of interest in vitro or in vivo. Also contemplated herein are AAV-based expression vectors, including recombinant AAV (rAAV) with a gene of interest for therapeutic purposes.

[0042] The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule, approximately 5,000 nucleotides (nt) in length. The AAV viral genome typically includes two inverted terminal repeat sequences (ITRs), one at the 5' and one at the 3' end of the viral genome, which cap the viral genome and provide an origin of replication for the viral genome. These ITRs have a characteristic T-shaped hairpin structure and have multiple functions, including but not limited to acting as an origin of DNA replication by acting as a primer for the host's endogenous DNA polymerase complex of the replicating cell.

[0043] The wild-type AAV viral genome also includes a Rep gene and a Cap gene, which encode four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40) and three capsid proteins or structural proteins (VP1, VP2, VP3), respectively. The Rep proteins are associated with viral replication and packaging, while the capsid proteins assemble to form the protein outer shell or AAV capsid of AAV. Alternative splicing and alternative start codons and promoters result in four different Rep proteins from a single open reading frame in the Rep gene and three capsid proteins from a single open reading frame in the Cap gene.

[0044] The term "viral capsid protein" or "capsid protein" as used in reference to AAV refers to a protein of AAV that is capable of self-assembly to produce an AAV particle, also referred to as a coat protein or VP protein. The VP protein includes three subunits, VP1, VP2, and VP3, and thus changes in VP protein mutants relative to wild-type VP protein can be reflected in changes in the amino acid sequence of the VP1, VP2, and VP3 subunits. Accordingly, "capsid protein mutants" herein include VP protein mutants and also include VP1, VP2, and / or VP3 subunit mutants. Due to the identity of the amino acid sequences between the VP1, VP2, and VP3 subunits expressed from the same Cap gene, alterations in the coding sequence in the Cap gene, for example, alterations in the coding sequence for the VP1 subunit, simultaneously alter the amino acid sequences of the VP2 and VP3 subunits expressed.

[0045] The term "serotype" as used in reference to AAV refers to a distinction in the capsid proteins of AAV that are serologically distinct from other AAV serotypes. Determination of serological uniqueness is based on reactivity between an antibody and one AAV and lack of cross-reactivity with other or another AAV. This difference in cross-reactivity is generally due to differences in capsid protein sequence (or subunit sequence) / antigenic determinants (e.g., due to VP1, VP2, and / or VP3 sequence differences of serotype AAV9). A number of AAV serotypes have been discovered, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12, as well as mutants thereof.

[0046] "Variable region" in reference to the capsid protein of AAV or a subunit thereof refers to a region whose amino acid sequence varies relatively more among different serotypes. Generally, by aligning the amino acid sequences of capsid proteins of a number of AAV serotypes, one can determine regions that are relatively conserved, and the sequences that lie between them are variable region sequences. Variable regions can be involved in binding of AAV to cell surface receptors.

[0047] "Recombinant AAV vector" refers to an AAV genome that has been derived by using molecular biology methods to remove portions of the wild-type gene (e.g., Rep gene and Cap gene) from the AAV genome and replace them with a heterologous nucleic acid sequence (e.g., a coding sequence for a protein or RNA for therapeutic purposes). Typically, one or both inverted terminal repeat (ITR) sequences of the AAV genome are retained in a recombinant AAV vector. Most often, a recombinant AAV vector is replication-defective, lacking sequences that encode functional Rep and Cap proteins in its viral genome. These replication-defective AAV particles can lack most of the parental coding sequences and essentially carry only one or both AAV ITR sequences and a nucleic acid of interest for delivery to a cell, tissue, organ, or organism. An AAV comprising a recombinant AAV vector is referred to herein as a recombinant AAV (rAAV).

[0048] "Amino acid alteration" includes herein amino acid substitutions, deletions, or insertions. The number of amino acid alterations that occur in a mutant sequence relative to a parent sequence can be counted as the sum of the number of amino acid substitutions, the number of amino acids deleted, and the number of amino acids inserted.

[0049] As used herein, the terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably and refer to a polymer of nucleotides. Such nucleotide polymers can contain natural and / or non-natural nucleotides and include, but are not limited to, DNA, RNA, and PNA. A "nucleic acid sequence" refers to the linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. An "isolated nucleic acid molecule" refers to a nucleic acid molecule that is separated from the natural environment of the cell in which it is found, is substantially free of the one or more materials with which it is naturally associated, such as proteins, nucleic acids, lipids, carbohydrates, cellular membranes, etc., or is artificially manufactured (e.g., synthesized).

[0050] The term "expression vector" refers to a nucleic acid molecule containing various expression elements for expressing a protein or RNA of interest in a host cell. For an expression vector for expressing a protein of interest in a eukaryotic cell, these expression elements typically include a promoter, an enhancer, a polyadenylation signal sequence, etc. For the convenience of amplification in E. coli, the expression vector typically further includes an E. coli replicon sequence. In addition, the expression vector can further include an antibiotic resistance gene or a selection marker gene (e.g., ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR), etc.) for screening and a multiple cloning site (MCS) for insertion of a gene of interest.

[0051] The term "host cell" refers to a cell in which an expression vector can be maintained and / or replicated, including prokaryotic and eukaryotic cells, such as bacteria (e.g., E. coli), fungi (yeast), insect cells (e.g., SF9), and mammalian cells (e.g., HEK-293T).

[0052] The term "pharmaceutically acceptable carrier" as used with reference to a pharmaceutical composition refers to a solid or liquid diluent, filler, antioxidant, stabilizer, etc. that can be safely administered, which is suitable for human and / or animal administration without undue adverse side effects coupled with the use of the drugs or active agents contained therein, while maintaining the activity of the drugs or active agents therein. Depending on the route of administration, various carriers known in the art can be used, including, but not limited to, sugars, starches, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffers, emulsifiers, isotonic saline, and / or pyrogen-free water, etc.

[0053] The "targeting" of an AAV or rAAV refers to the phenomenon that it is relatively accumulated in a specific tissue or organ when introduced into the body. For example, the targeting can be manifested as a higher concentration in tissue A than in tissue B. This targeting can be reflected by detecting the amount or concentration of its genome in different tissues or organs.

[0054] For better illustrating the purposes, technical solutions and advantages of the present application, the present application will be further described below in combination with specific examples. Those skilled in the art should understand that the specific examples described herein are only used to explain the present application, and are not used to limit the present application.

[0055] The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all commercially available unless otherwise specified. The low-liver serum preference type capsid nucleotide sequence is shown in SEQ ID No. 32 in Chinese patent document CN116041443B.

[0056] Example 1: Screening of new mutants

[0057] (1) Construction of low-liver serum preference type mutant library skeleton plasmid

[0058] The low-liver serum preference type mutant library skeleton vector comprises a CAG promoter, an intron, a mutated low-liver serum preference type capsid protein sequence [the VP1 sequence after T580 is removed, and the T580 nucleic acid sequence ACC is mutated to ACT, thereby forming a restriction site BsrG I (TGTACA) with the polyA front sequence, which is used for subsequent skeleton restriction linearization], and a polyA. The above sequences are synthesized by gene synthesis, and inserted between the ITRs of the AAV vector plasmid to form the low-liver serum preference type mutant library skeleton vector.

[0059] (2) Construction of mutant Rep-CAP vector

[0060] By introducing a stop codon at the N-terminus of the VP1, VP2 and VP3 proteins of the CAP sequence in the low-liver serum preference type, the Rep-CAP vector can normally express Rep protein and AAP protein, but cannot express the VP1, VP2 and VP3 proteins of the CAP, thereby avoiding contamination of the CAP sequence in the parent. The above sequences are synthesized by gene synthesis, and inserted to replace the CAP sequence of the low-liver serum preference type Rep-CAP vector.

[0061] (3) Construction of random polypeptide vector library containing RGD motif

[0062] Design method: the sequences between TNLQ583 and Q588AAT of low- liver- tropic CAP are used as insertion and modification sequences, and are combined as follows: AGRGDXXXXXR, AGXRGDXXXXR, AGXXRGDXXXR, AGXXXRGDXXR, AGXXXXRGDXR, AGXXXXXRGDR, AGRGDXXXXXA, AGXRGDXXXXA, AGXXRGDXXXA, AGXXXRGDXXA, AGXXXXRGDXA, AGXXXXXRGDA. The upstream primer sequence is composed of a homologous arm sequence, the above combined sequence, and a primer matching sequence, and a total of 12 sequence primers are constructed. The downstream primer uses the same sequence. These primers are used as upstream primers and downstream primers to form primer pairs. In the case of using the low- liver- tropic CAP vector as a template, the target fragment library is amplified, and the fragment library has homologous arms at both ends, which can homologously recombine with the enzyme-digested low- liver- tropic mutant library backbone plasmid to form the vector library.

[0063] The base sequence of the upstream primer (5'->3') is as follows:

[0064] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCAGAGGAGACNNKNNKNNKNNKNNKAGACAAGCAGCTACCGCAGAT;

[0065] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKAGAGGAGACNNKNNKNNKNNKAGACAAGCAGCTACCGCAGAT;

[0066] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKAGAGGAGACNNKNNKNNKAGACAAGCAGCTACCGCAGAT;

[0067] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKAGAGGAGACNNKNNKAGACAAGCAGCTACCGCAGAT;

[0068] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKAGAGGAGACNNKAGACAAGCAGCTACCGCAGAT;

[0069] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACAGACAAGCAGCTACCGCAGAT;

[0070] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0071] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0072] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0073] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0074] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACNNKGCTCAAGCAGCTACCGCAGAT;

[0075] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACGCTCAAGCAGCTACCGCAGAT.

[0076] The base sequence of the downstream primer (5' -> 3') is as follows:

[0077] CGGTTTATTGATTAACAATCGATTACAGATTACGAGTCAGGTATCTGGTG.

[0078] The specific operation steps are: using the vector containing the low hepatotrophic serum type CAP as a template, the fragment containing random sequence is obtained by PCR amplification using the above primers. The fragment is subjected to gel electrophoresis and gel recovery to obtain a purified nucleic acid fragment; the nucleic acid fragment is connected into the low hepatotrophic serum type mutant library skeleton vector constructed in step (1) by Gibson homologous recombination connection, the connected vector is purified by PCR product purification kit, and then digested with Plasmid-Safe DNase to remove the fragments that are not connected; finally, the purified product is obtained by PCR product purification kit, that is, the constructed low hepatotrophic serum type mutant random polypeptide vector library, that is, the low hepatotrophic serum type mutant plasmid library.

[0079] (4) Production of low hepatotrophic mutant virus library

[0080] The mutant Rep-Cap plasmid constructed in step (2), the low hepatotrophic serum type mutant plasmid library constructed in step (3) and the pHelper plasmid are co-transfected into HEK-293T cells, and the adeno-associated virus is purified by iodixanol gradient ultracentrifugation, and the virus titer is measured to be 10 12 GC / mL~10 13 GC / mL is a suitable titer, and the low hepatotrophic serum type mutant virus library is obtained, which is placed at-80℃ for standby.

[0081] (5) Screening of mutants

[0082] (5.1) Animal injection and dissection

[0083] The low hepatotrophic serum type mutant virus library is injected into cynomolgus monkeys, and the animals are dissected and organs are taken 28 days after injection. The samples are immediately frozen in liquid nitrogen after sampling and used for subsequent RNA extraction experiments.

[0084] (5.2) Total RNA extraction and RT-PCR

[0085] Grinding of sample: 10 min in advance to pre-cool the grinder and set the grinding parameters. The animal tissue sample stored in the-80°C refrigerator was taken out, about 50-100 mg of tissue was cut into soybean size in a sterile culture dish, then transferred to a 1.5 mL RNase-free EP tube. According to the ratio of 1 mL TransZol Up per 50-100 mg of tissue, add an appropriate amount of TransZol Up, then add two clean and sterile 3mm grinding steel balls, and wrap the sealing film. Place the sample in the 24-well grinding adapter and level it, tighten the screw, and press the cover button. Start the grinding program, and after the instrument runs, take out the sample, observe the sample grinding particle size, and if there is no large piece of tissue residue, the subsequent extraction operation can be carried out. The ground sample was centrifuged at 4°C, 12,000xg for 2 min, and the supernatant was transferred to a new 1.5 mL RNase-free EP tube with the corresponding label.

[0086] Extraction of total RNA from sample: Refer to the TransZol Up Plus RNA Kit (Beijing Zoman, Catalog No: ER501) instruction manual. Add 0.2ml RNA Extraction Agent to 1mL TranZol up, shake vigorously for 5min; 12,000xg, 4°C centrifuge for 10min. At this time, the sample is divided into three layers, and the colorless aqueous phase is transferred to a new 1.5mL RNase-free EP tube, and an equal volume of anhydrous ethanol is added (at this time, a precipitate may appear), and mix gently; the obtained solution and precipitate are added to the centrifugal column, 12,000xg room temperature centrifugation for 30s, discard the filtrate; add 500μL CB9, 12,000xg room temperature centrifugation for 30s, discard the filtrate; repeat the above steps once; add 500μL WB9, 12,000xg room temperature centrifugation for 30s, discard the filtrate; repeat the above steps once; 12,000xg room temperature centrifugation for 2min, completely remove the residual ethanol; place the centrifugal column in a 1.5ml RNase-free EP tube, add 30-50μL (depending on the size of the tissue) RNase-free Water in the center of the centrifugal column, room temperature standing for 1min; 12,000xg room temperature centrifugation for 1min, elute RNA;

[0087] Determination of sample nucleic acid concentration: Use the micro nucleic acid quantifier detector to detect the RNA concentration, record the concentration, OD260 / 280, OD260 / 230, and store the RNA at-80°C.

[0088] RT-PCR: RNA samples were extracted and first strand cDNA synthesis was performed using PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, 6215A). Then, 2 rounds of PCR amplification were performed using NEB Q5 (first round using outer primers for amplification; second round using the first round product as template for amplification with NGS primers), and the PCR products corresponding to the band size were gel recovered for NGS sequencing;

[0089] NGS sequencing, data analysis and selection of candidate vectors: After sequencing, sequencing data analysis was performed, and sequences with high frequency and appearing in multiple samples were selected as candidates for subsequent AAV mutant construction and verification.

[0090] Example 2: Construction of AAV capsid protein mutants and virus production

[0091] (1) Construction of mutant serotype vectors and plasmid extraction

[0092] The AAV9 Rep-CAP plasmid (purchased from Guangzhou Pishen Biotechnology Co., Ltd.) was digested with Smi I and BshT I, gel electrophoresis was performed, and a fragment band of about 5000 bp was cut and gel recovered to obtain the digested backbone fragment.

[0093] According to the Cap sequence of mutant 1, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, the Cap-f+YJ573-R primers were used for amplification and gel recovery to obtain the target product YJ573-1, and the Rep-CAP plasmid of serotype 109 was used as a template, and the YJ573-F+cap-r primers were used for amplification and gel recovery to obtain the target product YJ573-2. By mixing the backbone fragment, YJ573-1, YJ573-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 1 can be recombined and constructed.

[0094] According to the Cap sequence of mutant 2, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, the Cap-f+YJ578-R primers were used for amplification and gel recovery to obtain the target product YJ578-1, and the Rep-CAP plasmid of serotype 109 was used as a template, and the YJ578-F+cap-r primers were used for amplification and gel recovery to obtain the target product YJ578-2. By mixing the backbone fragment, YJ578-1, YJ578-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 2 can be recombined and constructed.

[0095] According to the Cap sequence of mutant 3, the following primers are designed, and the specific steps are as follows: using the Rep-CAP plasmid of serotype 109 as a template, using Cap-f+YJ588-R primers for amplification and gel recovery to obtain the target product YJ588-1, using the Rep-CAP plasmid of serotype 109 as a template, using YJ588-F+cap-r primers for amplification and gel recovery to obtain the target product YJ588-2, by the following steps and proportion mixing the skeleton fragment, YJ588-1, YJ588-2, the Rep-CAP plasmid of mutant 3 can be recombined and constructed;

[0096] According to the Cap sequence of mutant 4, the following primers are designed, and the specific steps are as follows: using the Rep-CAP plasmid of serotype 109 as a template, using Cap-f+YJ581-R primers for amplification and gel recovery to obtain the target product YJ581-1, using the Rep-CAP plasmid of serotype 109 as a template, using YJ581-F+cap-r primers for amplification and gel recovery to obtain the target product YJ581-2, by the following steps and proportion mixing the skeleton fragment, YJ581-1, YJ581-2, the Rep-CAP plasmid of mutant 4 can be recombined and constructed;

[0097] According to the Cap sequence of mutant 5, the following primers are designed, and the specific steps are as follows: using the Rep-CAP plasmid of serotype 109 as a template, using Cap-f+YJ574-R primers for amplification and gel recovery to obtain the target product YJ574-1, using the Rep-CAP plasmid of serotype 109 as a template, using YJ574-F+cap-r primers for amplification and gel recovery to obtain the target product YJ574-2, by the following steps and proportion mixing the skeleton fragment, YJ574-1, YJ574-2, the Rep-CAP plasmid of mutant 5 can be recombined and constructed;

[0098] According to the Cap sequence of mutant 6, the following primers are designed, and the specific steps are as follows: using the Rep-CAP plasmid of serotype 109 as a template, using Cap-f+YJ585-R primers for amplification and gel recovery to obtain the target product YJ585-1, using the Rep-CAP plasmid of serotype 109 as a template, using YJ585-F+cap-r primers for amplification and gel recovery to obtain the target product YJ585-2, by the following steps and proportion mixing the skeleton fragment, YJ585-1, YJ585-2, the Rep-CAP plasmid of mutant 6 can be recombined and constructed;

[0099] The primers involved in the construction of the Rep-CAP vector of the above-mentioned AAV capsid protein mutant are shown in Table 1:

[0100] Table 1 primer sequence information

[0101]

[0102]

[0103] Take a clean 200 μL PCR tube and mark it on the ice box, prepare the reaction solution according to the above enzyme cutting skeleton, each target fragment, the molar ratio of skeleton: fragment is 1:3, PCR instrument 50 ℃ reaction 30 min for recombination. Take 50 μL competent cells on ice, 10 μL of the ligation product and DH5α competent cells are mixed, ice for 20-30 minutes; 42 ℃ heat shock for 45 seconds; quickly placed in ice bath for 2 minutes, add 400 μL of recovery SOC medium (without antibiotics), 37 ℃, 200 rpm for 1 h; evenly coated on Amp resistance plate (50 μg / mL), 37 ℃ for 14 hours. Select single colony in 4 mL liquid LB medium (Amp+ resistance) to expand culture, 37 ℃ for 14 hours.

[0104] The bacterial solution was centrifuged at 12000 rpm for 1 minute, and the supernatant culture medium was discarded; 250 μL of buffer P1 / RNaseA mixed solution was added, and the bacteria were resuspended by high-speed vortex; 250 μL of buffer P2 was added, and the solution was inverted 8-10 times; 350 μL of buffer P3 was added, and the solution was immediately inverted and mixed 8-10 times to completely neutralize the solution; 13000 rpm centrifugation for 10 minutes, take the supernatant and pass through the column; 12000 centrifugation for 1 minute, discard the waste liquid, add 500 μL of PW1, 12000 centrifugation for 1 minute, discard the waste liquid; add 600 μL of PW2, 12000 centrifugation for 1 minute, discard the supernatant; add 600 μL of PW2, 12000 centrifugation for 1 minute, discard the supernatant; 12000 rpm for 2 minutes; add 30-50 μL of preheated eluent at 55 ℃, stand for 2 minutes, 12000 rpm centrifugation for 1 minute. Use micro nucleic acid quantifier to detect the concentration.

[0105] The obtained plasmid was detected by concentration detection, and the positive plasmid identified by enzyme digestion was sent for sequencing by 10 μL. The positive plasmid was stored at -20 ℃. The sequencing results showed that the obtained plasmid could encode variant capsid protein VP1. Finally, according to the virus amount required for later test, the related Helper plasmid, each group of Rep-Cap plasmid (control serotype AAV2, AAV9, MyoAAV 4A, 109 and mutant 1-6) plasmid and GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) were extracted.

[0106] (2) Packaging and purification of mutant serotype virus

[0107] The Rep-Cap plasmid, GOI plasmid expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and pHelper plasmid of each group (control serum type and AAV mutants 1-6) were co-transfected in HEK-293T cells in appropriate amounts, AAV virus was purified by iodixanol gradient ultracentrifugation, and the virus titer was measured to be about 1E+13 GC / mL as an appropriate titer, and was placed at -80°C for standby.

[0108] Example 3: Comparison test of each index of mutant serum type

[0109] (1) Mouse injection and dissection

[0110] 6-8 week old Balb / c male mice were used for animal experiments, and the related viruses (mutants 5 and 6) were prepared according to the designed experimental group and control group (only 2 mice were used for mutants 5 and 6 due to low virus yield), each mouse was injected with 2E11 GC virus, and live imaging was performed at 14 days and 21 days after injection, respectively. After 21 days of injection, the animals were dissected and the organs were taken out, the samples were immediately frozen in liquid nitrogen, and were used for subsequent RNA extraction and WB detection experiments, etc.

[0111] (2) Live imaging

[0112] Live imaging was performed at 14 days and 21 days after mouse injection. Before imaging, the mouse was weighed, and the animal live imaging system (Guangzhou Bolvteng Biotechnology Co., Ltd., AniView100) was started in advance and the small animal anesthesia system was debugged. Set the image saving path, shooting parameters and other information. Each mouse was intraperitoneally injected with luciferin (15 mg / mL, Promega, E1605) at a dose of 150 mg / kg, i.e. 10 μL / g, and imaging was started 10 min after injection. The mice were imaged in the order of supine, left lateral, prone, and right lateral. After shooting, the mice were placed back in the cage to wake up from anesthesia, and the state of the mice was observed for abnormalities.

[0113] (3) Detection of mRNA expression level of target gene

[0114] (3.1) Total RNA extraction and reverse transcription

[0115] Grinding of samples: 10 min in advance to pre-cool the grinder and set the grinding parameters. The animal tissue samples stored in the -80°C refrigerator were taken out, about 50-100 mg of tissue was cut into soybean size in a sterile culture dish, then transferred to a 1.5 mL RNase-free EP tube. According to the ratio of 1 mL TransZol Up per 50-100 mg of tissue, add an appropriate amount of TransZol Up, then add two clean and sterile 3 mm grinding steel balls, and wrap the sealing film. Place the sample in the 24-well grinding adapter and level it, tighten the screw, and press the cover button. Start the grinding program, and after the instrument runs, take out the sample and observe the sample grinding particle size. If there is no large piece of tissue residue, the subsequent extraction operation can be carried out. The ground sample was centrifuged at 4°C, 12,000 x g for 2 min, and the supernatant was transferred to a new 1.5 mL RNase-free EP tube with the corresponding label.

[0116] Extraction of total RNA from samples: Refer to the TransZol Up Plus RNA Kit (Beijing Zoman, Catalog No: ER501) instruction manual. Add 0.2 mL RNA Extraction Agent to 1 mL TranZol up, and shake vigorously for 5 min; centrifuge at 12,000 x g for 10 min at 4°C. At this time, the sample is divided into three layers, and the colorless aqueous phase is transferred to a new 1.5 mL RNase-free EP tube. Add an equal volume of anhydrous ethanol (at this time, a precipitate may appear), mix gently by inverting; add the obtained solution and precipitate to the centrifugal column, centrifuge at 12,000 x g at room temperature for 30 s, discard the filtrate; add 500 μL CB9, centrifuge at 12,000 x g at room temperature for 30 s, discard the filtrate; repeat the above steps once; add 500 μL WB9, centrifuge at 12,000 x g at room temperature for 30 s, discard the filtrate; repeat the above steps once; centrifuge at 12,000 x g at room temperature for 2 min to completely remove the residual ethanol; place the centrifugal column in a 1.5 mL RNase-free EP tube, add 30-50 μL (depending on the size of the tissue) RNase-free Water to the center of the centrifugal column, and stand at room temperature for 1 min; centrifuge at 12,000 x g at room temperature for 1 min to elute the RNA;

[0117] Determination of nucleic acid concentration of sample: Use the micro nucleic acid quantifier detector to detect the RNA concentration, record the concentration, OD260 / 280, and OD260 / 230, and store the RNA at -80°C.

[0118] Reverse transcription: Use All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (Beijing Zoben, Cat No: AE341-03), the specific steps refer to the instruction.

[0119] (3.2) Quantitative PCR (qPCR) experiment:

[0120] Take each group of cDNA as a template, according to the 2x SYBR Green qPCR Master Mix (Bimake, Cat No: B21203) instruction to configure qPCR system:

[0121] Table 2 qPCR system

[0122] Reagents Amount 2x SYBR Green qPCR Master Mix 10 μL cDNA template 2 μL Upstream primer (10 μΜ) 1 μL Downstream primer (10 μΜ) 1 μL ROX Reference Dye 0.4 μL Deionized water Up to 20 μL

[0123] Table 3 qPCR primer information

[0124] Primer name Primer sequence (5' -> 3') Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC

[0125] Table 4 qPCR program settings

[0126]

[0127]

[0128] 3.3) Data analysis

[0129] According to the Ct value of each group, the relative expression amount is calculated according to the formula 2 -ΔΔct

[0130] (4) WB detects the expression level of the target protein

[0131] Sample pretreatment: cut the tissue into small pieces, weigh and record the weight, then put it into 1.5ml or 2ml centrifuge tube, label the tube, freeze at -80℃, precool the frozen grinder; dissolve RIPA (Biyun, P0013B) lysis buffer (add PMSF to make the final concentration of PMSF 1mM within a few minutes before use);

[0132] ​Add the complete lysis solution above to the tissue sample at a ratio of 150-250 μL lysis solution per 20 mg of tissue, then add two sterilized zirconium oxide grinding beads and grind the sample directly in the lysis solution (tissue samples such as brain, spinal cord, etc.: temperature -20°C, frequency 70 Hz, time 50 s of shaking with 10 s of pause, 3-4 cycles; muscle, liver, etc. samples: temperature -20°C, frequency 70 Hz, time 50 s of shaking with 10 s of pause, 5-7 times). After grinding the sample, centrifuge the sample in a refrigerated centrifuge at 4°C at 12,000 x g for 5-10 min, then transfer the supernatant to a new sterilized EP tube and store at -20°C or -80°C;

[0133] Protein concentration determination: After determining the protein concentration according to the method in the modified BCA method protein concentration determination kit (Shenguo, item number C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix with the corresponding amount of 5X SDS-PAGE protein loading buffer, and boil in water bath for 10 min. After cooling, centrifuge at low speed for a moment, and wait for loading.

[0134] WB (Western Blot) detection:

[0135] A. SDS-PAGE electrophoresis: determine the appropriate loading amount according to the protein concentration and expression level, less than 20 μL / well, and the loading amount of tissue homogenate protein is about 20-50 μg. The specific operation process of electrophoresis is as follows: pull out the comb on the precast gel, install the gel into the electrophoresis tank, and add electrophoresis buffer to the inner and outer tanks. Add freshly prepared buffer to the inner tank and check for leaks. If there is no leakage, add electrophoresis buffer to the outer tank. Take an appropriate amount of treated protein sample and load it. Use pre-stained standard proteins as a reference. Perform 100V constant voltage electrophoresis on a Tian Neng electrophoresis device. The electrophoresis time is 100 min, until the bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, and take out the gel and place it in the transfer buffer for subsequent operation.

[0136] B. Membrane transfer: cut 6 filter papers and 1 PVDF membrane according to the gel area. Soak the PVDF membrane in methanol for 5-10 sec, then transfer it to the transfer buffer for 5 min. Pre-wet the filter paper in the transfer buffer; install the transfer device: negative (blackboard) - sponge - 3 layers of wet filter paper - gel - PVDF membrane - 3 layers of wet filter paper - sponge - positive (transparent plate). Remove each layer of air bubbles to avoid affecting the transfer effect, clamp the support, and place it in the electric transfer tank; use 100V constant voltage ice bath to transfer the membrane for 100 min; determine whether the transfer is successful according to whether the pre-stained protein molecular weight standard band is completely transferred to the PVDF membrane; soak the transferred PVDF membrane in PBST solution at room temperature for 5 min, cut the PVDF membrane according to the needs, and pay attention not to dry the PVDF membrane during the cutting process;

[0137] C. Blocking and antibody incubation: Incubate the PVDF membrane with blocking solution (5% skim milk powder) for 2h at room temperature or overnight at 4°C; transfer the blocked PVDF membrane into the primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000, respectively, add to 4ml QuickBlock TM Western primary antibody dilution (Biocytex, P0256), i.e. primary antibody hybridization solution, incubate for 1h at room temperature or overnight at 4°C, then wash the membrane with PBST, 3x5min; transfer the washed PVDF membrane into the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, SA00001-2) at 1:5000, add to 4ml QuickBlock TM Western secondary antibody dilution (Biocytex, P0258), i.e. secondary antibody hybridization solution, incubate for 1h at room temperature, wash the membrane with PBST, 3x5min;

[0138] D. Color development: Mix equal volumes of A and B of the ECL chemiluminescence kit, shake well to mix, then drop the luminescence solution on the PVDF membrane to cover the entire PVDF membrane with the luminescence solution, adjust the exposure time to make the protein bands clear, and take a picture of the instrument.

[0139] (5) Cynomolgus monkey injection, puncture and NGS analysis

[0140] Animal experiments use about 4-year-old male cynomolgus monkeys, which are used after passing the AAV2 and AAV9 neutralizing antibody test before the experiment. Different serotype mutants and control serotypes are packaged with different GOIs (ssAAV.CAG.Fluc.WPRE.polyA vectors carrying different Barcodes), and are injected intravenously with equal virus amounts (the total virus dose is controlled at 3E13 GC / Kg), and different muscle punctures and liver punctures are performed at different sites at 2 weeks and 4 weeks, and finally tissue RNA extraction, RT-PCR and NGS sequencing are performed, and by analyzing the NGS data, the fold of each serotype mutant relative to the control AAV9 is determined.

[0141] Through different methods of mouse experiments, it is found that mutants 1-6 have better muscle targeting than AAV9 and retain the low liver tropism characteristics of the skeleton (from the 14-day and 28-day live imaging results of Figure 1 It can be observed intuitively that mutants 1 and 3 even exhibit stronger muscle targeting than 109 and MyoAAV 4A serotypes. The mRNA levels of mutant 1 in gastrocnemius, quadriceps, triceps brachii, biceps brachii, abdominal muscle and heart are 75.97 times, 37.27 times, 186.02 times, 13.79 times, 496.41 times and 10.06 times that of AAV9, respectively, and the mRNA levels of mutant 3 in gastrocnemius, quadriceps, triceps brachii, biceps brachii, abdominal muscle and heart are 71.95 times, 43.25 times, 112.55 times, 4.99 times, 247.96 times and 9.46 times that of AAV9, respectively Figure 2 .A- Figure 7 .A). The protein level results of mutants 1 and 3 are basically consistent with the mRNA level trend Figure 2 .B- Figure 7 .B). The liver results Figure 8 further confirm that the serotype mutants based on the low liver tropism skeleton all exhibit low liver targeting, with mRNA levels 50-100 times lower than AAV9, and still 9.5-19 times lower than MyoAAV 4A (obtained by screening based on the AAV9 skeleton), showing very good targeting specificity.

[0142] To further illustrate the potential clinical use value of the serotypes of the present application, the mutants and control serotype viruses are mixed in equal amounts and intravenously injected into cynomolgus monkeys, and finally the expression strength relationship of different serotypes in muscle and liver tissues is determined by NGS analysis. Mutants 1 and 3 have good effects in various muscles of cynomolgus monkeys, which are consistent with the results in mice, wherein the mRNA levels (4 weeks) of mutant 1 in gastrocnemius, biceps brachii, triceps brachii and quadriceps are 5.75 times, 13.31 times, 35.05 times and 15.76 times that of AAV9, respectively Figure 9 ), and the expression effects in other muscles are better than those of MyoAAV 4A, and the expression trend at 2 weeks is basically consistent with that at 4 weeks. The mutant 2 which performs slightly worse in mouse muscles has good effects in cynomolgus monkey muscles, and the effects in some muscles (such as gastrocnemius and quadriceps) are close to those of mutant 1. In addition, all the muscle mutants obtained by screening, whether in mice or in cynomolgus monkeys, exhibit much lower liver tropism than AAV9 and MyoAAV 4A, further illustrating the consistency and superiority of the skeleton in cross-species use.

[0143] In summary, by using the strategy of constructing a small AAV mutant library, a plurality of muscle targeting mutants better than AAV9 are obtained, and their effects in gastrocnemius muscle, quadriceps muscle, triceps brachii muscle, biceps brachii muscle and abdominal muscle and other muscle tissues are verified from mRNA and protein expression levels, respectively, and the liver tropism is lower and the specificity is better. These mutants can further evaluate their clinical application value and safety, and provide more useful and optional carrier tools for gene therapy of muscle diseases, and benefit the majority of patients.

[0144] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not a limitation on the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. An adeno-associated virus capsid protein mutant, characterized in that, The amino acid sequence of which is represented by SEQ ID No.

8.

2. A nucleic acid encoding an adeno-associated viral capsid protein mutant, characterized in that, The nucleotide sequence of which is represented by SEQ ID No.

14.

3. An expression vector, characterized by, The nucleic acid of claim 2.

4. A host cell, characterized in that, The expression vector of claim 3.

5. A host cell, characterized in that, The expression vector of claim 3.

6. A recombinant adeno-associated virus, characterized in that, The expression vector of claim 3.

7. The recombinant adeno-associated virus of claim 6, wherein, The expression vector of claim 3.

8. The recombinant adeno-associated virus of claim 7, wherein, The expression vector of claim 3.

9. A method of producing a recombinant adeno-associated virus, characterized in that, The expression vector of claim 3. The expression vector of claim 3.

10. The recombinant adeno-associated virus prepared by the method of claim 9.

12. Use of the adeno-associated virus capsid protein mutant of claim 1, the expression vector of claim 3, the host cell of claim 4 or 5, the recombinant adeno-associated virus of any one of claims 6-8, the recombinant adeno-associated virus of claim 10 in the manufacture of a preparation for the delivery of a gene product into cells or tissues of a subject, characterized in that, 11. A drug delivery tool comprising the recombinant adeno-associated virus of any one of claims 6-8 or the recombinant adeno-associated virus of claim 10, and a pharmaceutically acceptable carrier.

13. Use of the adeno-associated virus capsid protein mutant of claim 1, the expression vector of claim 3, the host cell of claim 4 or 5, the recombinant adeno-associated virus of any one of claims 6-8, the recombinant adeno-associated virus of claim 10 in the manufacture of a drug delivery tool for delivering a gene product into cells or tissues of a subject, characterized in that, The cell is a muscle cell or a cardiac cell; the tissue is muscle tissue or cardiac tissue. The cell is a muscle cell or a cardiac cell; the tissue is muscle tissue or cardiac tissue.

Citation Information

Patent Citations

  • Adeno-associated virus mutants and their applications

    CN116041443B

  • Adeno-associated virus mutant and application thereof

    CN117820442A

  • Adeno-associated virus mutant and application thereof

    CN117903261A