Monoclonal antibody 3B11 for resisting hog cholera virus E2 protein as well as preparation and application methods of monoclonal antibody 3B11

Abstract

The invention relates to the technical field of biology, and aims to provide a monoclonal antibody 3B11 for resisting hog cholera virus E2 protein as well as a preparation method and an application method of the monoclonal antibody 3B11. The monoclonal antibody comprises Ig structural domains VH CDR1, VH CDR2 and VH CDR3 of a heavy chain of the antibody, and Ig structural domains VL CDR1, VL CDR2 and VL CDR3 of a light chain of the antibody, wherein the amino acid sequences of the VH CDR1, the VH CDR2 and the VH CDR3 are respectively as shown in SEQ ID NO: 1 to SEQ ID NO: 3; the amino acid sequences of the VL CDR1, the VL CDR2 and the VL CDR3 are respectively as shown in SEQ ID NO: 4 to SEQ ID NO: 6. The monoclonal antibody provided by the invention is an IgG1 subtype, and has the advantages of high titer, strong specificity, high affinity and the like; the sensitivity is high, the specificity is strong, and specific reaction with hog cholera viruses with known genotypes at present can be generated; the kit can be further used for developing a classical swine fever virus diagnostic kit, and can effectively diagnose and purify the classical swine fever virus.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a monoclonal antibody 3B11 against E2 protein of classical swine fever virus and a preparation and application method thereof. Background Art

[0002] Classical swine fever is a highly lethal and highly contagious infectious disease caused by classical swine fever virus (CSFV). It mainly harms domestic pigs and wild boars, causing huge economic losses to the pig industry worldwide. The disease is listed as a Class A infectious disease by the World Organization for Animal Health (OIE). In my country, classical swine fever is also listed as a Class I animal infectious disease.

[0003] There are three main genotypes of swine fever virus. Each genotype is further divided into several subtypes, such as 1.1-1.4, 2.1-2.3 and 3.1-3.4. With the increase in the number of genotype 2.1 subtype strains identified, this subtype can be further divided into 10 sub-subtypes. Genotype 2 still dominates worldwide, with genotype 2.1 strains mainly prevalent in China and other Asian and European countries.

[0004] CSFV is a single-stranded positive-strand RNA virus belonging to the Flaviridae family and the Pestivirus genus. Its genome contains a large open reading frame (ORF) flanked by two untranslated regions (5' and 3' UTR). The ORF encodes a polyprotein precursor containing 3898 amino acid residues. The polyprotein is cleaved into 12 mature proteins under the action of specific proteases of the host cell and the virus itself, including 4 structural proteins (C, Erns, E1, E2) and 8 non-structural proteins (Npro, p7, NS2, NS3, NS4A, NS4B, NS5A, NS5B), of which Erns, E1 and E2 are envelope proteins of CSFV. Each mature protein plays a different role in the life cycle and infection process of classical swine fever virus. The E2 protein can induce the body to produce a large amount of neutralizing antibodies to resist the attack of lethal doses of the virus, and is the main immunogenic protein of classical swine fever virus. It is also the primary antigen for establishing the detection method of classical swine fever virus and the main region for studying the antigenic variation of classical swine fever virus. Currently, a variety of monoclonal antibodies against CSFV E2 and their recognized antigenic epitopes have been discovered, but most of them can only recognize a single genotype of classical swine fever virus; currently, no specific antibodies that can produce specific reactions with all known genotypes of classical swine fever viruses have been obtained for differential diagnosis of CSFV virus infection.

[0005] In addition, according to existing research results, the antigen for preparing CSFV E2 monoclonal antibody is mainly obtained through a prokaryotic expression system, which is quite different from the natural protein structure and lacks post-translational modification of the protein; the monoclonal antibodies prepared on this basis have problems such as low affinity to CSFV strains, poor reactivity, and low sensitivity.

[0006] Therefore, the present application intends to propose a new monoclonal antibody to solve the above technical problems. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a monoclonal antibody 3B11 against the E2 protein of classical swine fever virus and a preparation and application method thereof.

[0008] To solve the technical problem, the solution of the present invention is:

[0009] Provided is a monoclonal antibody 3B11 against the E2 protein of classical swine fever virus, the monoclonal antibody comprising the Ig domain V of the antibody heavy chain H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3 respectively; L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6, respectively.

[0010] As a preferred embodiment of the present invention, the monoclonal antibody is a full-length antibody, a Fab antibody or a F(ab')2 antibody.

[0011] As a preferred embodiment of the present invention, in the monoclonal antibody, the amino acid sequence of the light chain variable region is shown as SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.8.

[0012] The present invention also provides a gene encoding the aforementioned monoclonal antibody, wherein the gene sequence encoding the light chain variable region is shown as SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown as SEQ ID NO.10.

[0013] The present invention further provides a method for preparing the aforementioned monoclonal antibody, comprising the following steps:

[0014] (1) Based on the E2 protein gene sequence shown in SEQ ID NO: 11, a recombinant plasmid containing the E2 protein sequence was constructed using the primers shown in SEQ ID NO. 12 and SEQ ID NO. 13;

[0015] (2) expressing and purifying recombinant CSFV E2 protein using an insect expression system;

[0016] (3) Animal immunization with recombinant CSFV E2 protein;

[0017] (4) The monoclonal antibody 3B11 against the E2 protein of classical swine fever virus was screened and obtained by hybridoma monoclonal antibody technology. The present invention also provides an application method of any of the above-mentioned monoclonal antibodies, which is to prepare a kit for detecting classical swine fever virus using the monoclonal antibody.

[0018] The present invention also provides a kit for detecting classical swine fever virus, which comprises any one of the aforementioned monoclonal antibodies.

[0019] As a preferred embodiment of the present invention, the kit is an immunochromatographic diagnostic kit or an immunohistochemical kit, and the detection method when using the kit is etiological detection.

[0020] Compared with the prior art, the technical effects of the present invention are:

[0021] 1. The monoclonal antibody against classical swine fever virus provided by the present invention is of IgG1 subtype, which has the advantages of high titer, strong specificity, high affinity, etc.

[0022] 2. The monoclonal antibody provided by the present invention has high sensitivity and strong specificity, and can produce specific reactions with currently known genotypes of classical swine fever viruses.

[0023] 3. The monoclonal antibody provided by the present invention can be further used in the development of a diagnostic kit for classical swine fever virus, and can effectively diagnose and purify classical swine fever virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The indirect immunofluorescence, SDS-PAGE and Western blot analysis diagrams of the eukaryotically expressed and purified CSFV E2 protein in Example 1 are shown.

[0025] Figure 2 This is the analysis of serum antibody titer after mice were immunized with CSFV E2 protein in Example 2.

[0026] Figure 3 This is the titer determination analysis of the CSFV E2 3B11 monoclonal antibody in Example 2.

[0027] Figure 4 This is the subtype classification of the CSFV E2 3B11 monoclonal antibody in Example 2.

[0028] Figure 5 This is the specificity analysis of the CSFV E2 3B11 monoclonal antibody in Example 3 using the indirect immunofluorescence method.

[0029] Figure 6 This is the application of the CSFV E2 3B11 monoclonal antibody in Example 4 to specifically identify different genotypes of classical swine fever viruses in an indirect immunofluorescence method.

[0030] Figure 7 This is the application of the CSFV E2 3B11 monoclonal antibody in Example 5 to specifically identify E2 proteins of different genotypes of classical swine fever viruses in a Western blot method.

[0031] Figure 8 This is the application of the CSFV E2 3B11 monoclonal antibody in Example 6 to specifically identify the E2 proteins of different genotypes of classical swine fever viruses in the ELISA method.

[0032] Fig. 9 This is the identification of the antigenic epitope recognized by the CSFV E2 3B11 monoclonal antibody in Example 7.

[0033] Fig.10 This is the conservation analysis of the CSFV E2 3B11 monoclonal antibody antigenic epitope in Example 7. DETAILED DESCRIPTION

[0034] The invention obtains CSFV E2 protein with high purity, good activity and close to natural protein conformation through a eukaryotic expression system, and immunizes mice to obtain a monoclonal hybridoma cell line that secretes and specifically recognizes CSFV E2 protein.

[0035] "CDR" (complementarity-determining regions) is called complementarity-determining region or complementarity-determining cluster in immunology. It is a short segment of Ig and TCR protein, contains most of the sequence differences between different Ig or TCR and can contact with antigen. In the monoclonal antibody against CSFV E2 protein described in the present invention, there are 3 CDRs on each antigen receptor polypeptide chain, and 6 CDRs on each complete Ig or TCR molecule, namely VH CDR1, VH CDR2 and VH CDR3 and VLCDR1, VL CDR2 and VL CDR3, wherein VH and VL refer to the Ig domain of the antibody heavy chain and antibody light chain, respectively. These "hypervariable" segments are manifested as ring structures, which together form a surface that can complement the three-dimensional structure of the antigen.

[0036] Example 1: Preparation of CSFV E2 protein

[0037] Experimental methods:

[0038] (1) Construction of recombinant expression plasmid: The E2 protein gene sequence is shown in SEQ ID NO: 11. Specific primers (F: ACCGGGGCACAAGGGCGGCTGTCCTGTAAGGAAGACT, sequence SEQ ID NO. 12; R: CTCGACAAGCTTCTACACGTCCAGGTCAAACCAGTATT, sequence SEQ ID NO. 13) were used to perform PCR with viral genomic cDNA as a template. The target gene was inserted into the pFastBac eukaryotic expression vector containing the bee venom signal peptide by homologous recombination to obtain the recombinant plasmid pFastBac-CSFV-E2 containing the E2 protein gene sequence. The pFastBac-CSFV-E2 shuttle plasmid verified by sequencing was transformed into DH10Bac competent medium, revived at 37°C for 5 h, spread on a triple-antibody plate (kanamycin, tetracycline and gentamicin, KTG) containing 100 μL X-gal and 5 μL IPTG, and cultured at 37°C overnight for blue-white screening, selecting white colonies, and shaking culture at 37°C for 14 h. The bacterial solution was streaked again to isolate single white colonies and preserve them.

[0039] (2) Recombinant CSFV-E2 baculovirus transfection and expansion: The bacmid of the recombinant baculovirus Bac-CSFVE2 was extracted using a kit. 2 μL of bacmid (less than 8 μg in mass) and 16 μL of Cellfectin II Reagent transfection reagent were transfected into SF9 cells at a density of 80%-90% according to the instructions. After 5 hours of transfection, the SF900Π medium containing three antibodies was replaced, and the cell pathological changes were observed every day. About 5 days later, a large amount of CPE appeared in SF9 cells, the cells became larger and rounder, and a large area of ​​​​shedding was observed. After the cells were harvested and frozen and thawed, the supernatant was centrifuged to obtain the P1 generation virus stock solution, which was divided into 1.5mL EP tubes, 500 μL per tube, and stored at -80°C. Take 500 μL of P1 virus stock solution and add it to 90% density SF9 cells, culture at 27°C, observe for lesions every day, harvest cells after 72-96 days of a large number of lesions, centrifuge after freeze-thaw and take supernatant, obtain P2 virus stock solution, divide into 1.5mL EP tubes, 500 μL per tube, and store at -80°C. Use the same method to amplify P3 virus stock solution.

[0040] (3) IFA identification of recombinant CSFV-E2 baculovirus: SF9 cells with good growth status were selected and plated in 96-well cell plates. When the cell growth density reached 70% to 80% on the next day, 10 μL of P1 virus solution was inoculated into each well. Two wells were left untreated as negative controls and cultured in a 27°C incubator for 48 h. The cell culture medium was discarded and the cells were washed once with 10 mM PBS. Be careful to be gentle to prevent SF9 cells from falling off. 50 μL of -20°C precooled 80% acetone was added to each well and fixed in a -20°C refrigerator for 30 min. The acetone was discarded and the cells were washed twice with 10 mM PBS. The plates were gently inverted on paper to absorb the residual liquid. 100 μL of mouse His-Tag monoclonal antibody (1:1000 dilution) was added to each well and incubated at 37°C for 1 h. Wash twice with 10mM PBS, spin dry the liquid, add 100μL FITC-labeled goat anti-mouse fluorescent secondary antibody (1:1000 dilution) to each well, and incubate at 37℃ in the dark for 1h. Wash twice with 10mM PBS, gently turn it upside down on paper to dry, add 50μL DAPI (1:2000 dilution) to each well, and incubate at room temperature in the dark for 10min. Wash twice with 10mM PBS, gently turn it upside down on paper to dry, observe the corresponding fluorescent signal under a fluorescence microscope, and take pictures for preservation.

[0041] (4) Large-scale expression of recombinant CSFV-E2: SF9 cells in a cell culture flask were transferred to a flask containing 50 mL of Sf-900 TM III SFM medium in a cell shaker, 27℃112rpm shaking culture, monitoring cell density every 24h. When the cell density reaches 2.0×10 6 When the cell count was 1 cell / mL, 2 mL of P3 virus solution was added and cultured at 27°C and 112 rpm for 72 h. During this period, cell samples were taken every 24 h to observe CPE. After a large number of lesions appeared in the cells, the culture supernatant was harvested by centrifugation.

[0042] (5) Purification of recombinant CSFV-E2 protein: Take 2 mL of nickel agarose gel and add it to the protein purification column. After the ethanol storage solution has flowed out, add 10 times the volume of 50 mM PBS buffer to the column, control the flow rate (3 s / drop), and balance the nickel column. Add the nickel agarose gel to the supernatant of the above culture medium and slowly shake it at 4°C overnight to bind. Load the mixed solution incubated overnight onto the column without controlling the flow rate. Add 30 mL of 50 mM PBS containing 5 mM imidazole to slowly wash the impurities. Add 4 mL of 50 mM PBS containing 400 mM imidazole to resuspend the nickel agarose gel. After it is deposited at the bottom of the chromatography column, turn on the flow rate controller, slowly elute the target protein and collect it, divide it into portions, and store it at -20°C. Collect the liquid in the purification step, perform SDS-PAGE / Western-blot identification, and analyze the expression and purification of the target protein.

[0043] (6) SDS-PAGE analysis: Prepare SDS-PAGE gel, take 40 μL of purified CSFV E2 protein and SF9 cell lysate, add 10 μL of 5× Loading Buffer, mix well by pipetting, and heat in a boiling water pot for 10 min; assemble the electrophoresis tank, fill it with electrophoresis solution, load the sample, and perform electrophoresis at 80 V for 30 min and then at 120 V for 90 min; after the electrophoresis, place the gel in Coomassie brilliant blue dye solution, shake on a shaker at 37°C for 2 h for staining, and then place it in decolorizing solution for decolorization. Change the decolorizing solution every 1 h. After the bands are clearly visible, place it on a gel imager to take pictures and observe the results.

[0044] (7) Western blot analysis: Load the protein sample for SDS-PAGE electrophoresis. Cut out a PVDF membrane of similar size to the protein gel to be tested, soak the PVDF membrane in methanol for 30 seconds, and then transfer it to the wet transfer buffer for several minutes. The filter paper and sponge are also placed in the wet transfer buffer. Place them in layers in the order of (-) thick sponge-thin filter paper-gel-PVDF membrane-thin filter paper-thick sponge (+) and remove bubbles. Transfer at 200mA constant current for 40min. Wash the PVDF membrane 3 times with TBST, 5min each time, and place it in TBST containing 5% skimmed milk powder and block it at 37℃ on a shaker for 1h. Wash it 3 times with TBST, 5min each time, add swine fever positive serum (1:500 dilution), and incubate it at 4℃ on a shaker overnight. Wash the membrane 3 times with TBST, 5min each time, add HRP-labeled mouse anti-swine secondary antibody (1:5000 dilution), and incubate it at 37℃ on a shaker for 1h. The PVDF membrane was washed with TBST three times, 5 min each time, and Super Signal WestPico / Femto Chemiluminescent Substrate (5:1) was added for color development and photography.

[0045] Experimental results:

[0046] The CSFV E2 gene fragment (993 bp) was obtained by PCR amplification, and the target gene was inserted into the pFastTBac vector containing the bee pollen signal peptide and the His tag by homologous recombination. The recombinant pFastSTBac-CSFV E2 plasmid was obtained by colony PCR and sequencing. The shuttle plasmid was introduced into DH10Bac competent cells, and recombinant Escherichia coli DH10Bac-CSFV E2 was obtained after blue-white screening and PCR sequencing. The bacmid was extracted and transfected into SF9 cells, and baculovirus of P1, P2, and P3 generations was successfully obtained. CSFV E2 was successfully expressed in SF9 cells through IFA identification. The results are shown in the attached Figure 1-A. CSFV E2 protein was further expressed and purified in a shake flask to obtain a CSFV E2 protein with good purity, with a size of about 50 kDa and a protein concentration of 0.12 mg / mL. The results of SDS-PAGE Coomassie Brilliant Blue staining and Western Blot of purified CSFV E2 protein are shown in Figure 1 -B. The obtained CSFV E2 protein can be used for subsequent monoclonal antibody preparation.

[0047] Example 2: Preparation of CSFV E2 monoclonal antibody

[0048] Experimental methods:

[0049] (1) Animal immunization: After the purified recombinant CSFV E2 protein was emulsified with an equal volume of FCA, the antigen was injected subcutaneously at multiple points on the back of the mouse neck. An equal dose of E2ZJ protein emulsified with FIA adjuvant was injected subcutaneously 14 days after the first immunization. The third immunization was performed two weeks later, and the CSFV antibody titer in the mouse serum was determined by ELISA. Three days before cell fusion, the mice were intraperitoneally injected with an equal amount of recombinant CSFV E2 protein for the final shock immunization.

[0050] (2) Cell fusion: Obtain fresh blood and spleen from immunized mice. Separate the blood to obtain serum, which is used as a positive control for monoclonal antibody screening. Place the spleen in a well of a six-well plate, wash and remove tissue, fascia and fat outside the spleen. Place the washed spleen on a copper mesh. Crush the spleen with a sterilized test tube until the spleen is crushed and filtered through the copper mesh. Transfer the filtered cells to a centrifuge tube and centrifuge at 1200 rpm and 28°C for 10 minutes. Place four 75 cm 2 The SP2 / 0 cells in the square bottle were resuspended with 1640 medium, transferred to a centrifuge bottle, and centrifuged at 1200rpm, 28℃ for 10min. The cells obtained in the above two steps were resuspended with medium and combined into one bottle, and centrifuged at 1200rpm, 28℃ for 10min. Resuspend and centrifuge with new medium and wash again, then discard the supernatant. Suspend the centrifuge tube in a 37℃ water bath, drip PEG1450 preheated at 37℃ within 1min, shake the centrifuge tube while dripping, let it stand for 30s, then drip 1mL 1640 medium within 1min, let it stand for 30s, then drip 2mL, 3mL, 4mL, 5mL, 6mL 1640 medium within 1min, and let it stand for 30s to terminate the fusion. Centrifuge at 1200 rpm, 28°C for 10 min, discard the supernatant, add 1640 screening medium (containing triple antibody + 20% serum + 50×HAT) to resuspend, divide into 10 96-well plates, and culture at 37°C.

[0051] (3) Screening and monocloning of positive hybridoma cells: The established IFA detection method was used to screen positive hybridoma cells. When the confluence of PK-15 cells in the 96-well plate reached 80%, the old culture medium was discarded, and the cells were washed twice with Hanks solution. The PK-15 cells were infected with PCV2 at an MOI of 1. After 48 hours of infection, the culture supernatant was discarded. 50 μL of 4% paraformaldehyde was added to each well and fixed at room temperature for 30 minutes. After the hybridoma cell culture medium in the 96-well plate turned yellow, 100 μL of the culture supernatant was taken as the primary antibody. After incubation at 37°C for 1 hour, 100 μL of FITC-labeled goat anti-mouse fluorescent secondary antibody (1:1000 dilution) was added to each well and incubated at 37°C for 1 hour in the dark. The corresponding fluorescent signals were observed under a fluorescence microscope and the corresponding positive hybridoma cell wells were recorded. The hybridoma cell lines are subcloned multiple times by limiting dilution method until a monoclonal positive hybridoma cell line is screened, and the monoclonal positive hybridoma cell line is further expanded and cryopreserved.

[0052] (4) Preparation of monoclonal antibody ascites and titer determination: 8-week-old female Balb / c mice were selected and intraperitoneally injected with 1 mL of sterilized liquid paraffin. Seven days after the injection, the monoclonal hybridoma cell line was prepared with 1640 medium at a concentration of approximately 2×10 6 The cell suspension of each mouse was prepared. The prepared hybridoma cell suspension was injected intraperitoneally again. About 7 days after cell inoculation, the mouse abdomen was obviously swollen, and the abdominal fluid was carefully extracted. The ascites was centrifuged at 13000rpm / min for 10min, the supernatant was collected, and stored in aliquots at -20℃. After the mouse ascites was diluted in proportion, the antibody titer of the ascites was determined according to the established ELISA method.

[0053] (5) Determination of subtypes of monoclonal antibodies: The monoclonal antibodies obtained above were identified according to the instructions of the Proteintech antibody subtype identification kit. The principle of antibody subtype identification is to use enzyme-linked immunosorbent assay (ELISA) to measure the binding of the test antibody with different subtype-specific antibodies (provided in the identification kit), identify the antibody that specifically binds to the test antibody, and the subtype of the test antibody can be obtained based on the specificity of the binding antibody.

[0054] Experimental results:

[0055] After mice were immunized with recombinant CSFV E2 protein multiple times, the serum antibody titer was >1:128000 after ELISA test. Figure 2 As shown. After the mouse spleen cells with high serum titer were fused with myeloma cells, a high-affinity anti-CSFV E2 specific monoclonal antibody was successfully obtained through multiple rounds of IFA screening, named 3B11. At the same time, 10 mL of mouse ascites was prepared, and the ascites titer was >1∶512000 by ELISA. The results are shown in the attached Figure 3 After identification of the monoclonal antibody subtype, it was found that the monoclonal antibody 3B11 was IgG1 subtype with κ light chain. The results are shown in the attached Figure 4 .

[0056] Example 3: Specificity analysis of CSFV E2 3B11 monoclonal antibody

[0057] Experimental methods:

[0058] (1) When the confluence of SF9 cells in the 96-well plate reaches 80%, discard the old culture medium, wash twice with Hanks solution, and add 5 μL P3 generation CSFV E2 recombinant baculovirus. After 48 hours of infection, discard the culture medium supernatant. Add 50 μL 4% paraformaldehyde to each well and fix at room temperature for 30 minutes. Use 3B11 hybridoma cell supernatant as primary antibody, FITC-labeled goat anti-mouse IgG as secondary antibody, and add DAPI for nuclear staining. Observe under a fluorescence microscope and take pictures for IFA analysis to detect the specificity of antibodies secreted by 3B11 monoclonal hybridoma cell lines.

[0059] (2) When the confluence of PK-15 cells in the 96-well plate reaches 80%, discard the old culture medium, wash twice with Hanks solution, and infect PK-15 cells with CSFV (HZ08) at MOI = 1. After 48 hours of infection, discard the culture medium supernatant. Add 50 μL of 4% paraformaldehyde to each well and fix at room temperature for 30 minutes. Use 3B11 hybridoma cell supernatant as primary antibody, FITC-labeled goat anti-mouse IgG as secondary antibody, and add DAPI for nuclear staining. Observe under a fluorescence microscope and take pictures for IFA analysis to detect the specificity of antibodies secreted by 3B11 monoclonal hybridoma cell lines.

[0060] Experimental results:

[0061] As attached Figure 5 As shown, the CSFV E2 3B11 monoclonal antibody can bind to the CSFV E2 protein (see Figure 5 -A) and CSFV-HZ08 strain (attached Figure 5 -B), which shows that the CSFV E2 3B11 monoclonal antibody has good specificity.

[0062] Example 4: Application of CSFV E2 3B11 monoclonal antibody to specifically identify different genotypes of classical swine fever viruses in the indirect immunofluorescence method.

[0063] Experimental methods:

[0064] When the confluence of PK-15 cells in the 96-well plate reached 80%, the old culture medium was discarded, washed twice with Hanks solution, and PK-15 cells were infected with CSFV (type 2 HZ08, type 1 C strain) at MOI = 1. After 48 hours of infection, the culture supernatant was discarded, and 50 μL of 4% paraformaldehyde was added to each well and fixed at room temperature for 30 minutes. 3B11 monoclonal antibody (1:1000 dilution) was used as the primary antibody, mouse negative serum was used as the negative control, CSFV E2 positive mouse serum (1:1000 dilution) was used as the positive control, and FITC-labeled goat anti-mouse IgG was used as the secondary antibody to perform IFA analysis on the specific recognition of different genotypes of CSFV strains by monoclonal antibody 3B11.

[0065] Experimental results:

[0066] As attached Figure 6 As shown, the CSFV E2 3B11 monoclonal antibody can specifically recognize type 1 (C strain) and type 2 (HZ08) CSFV strains, indicating that it can be further used for the diagnosis of classical swine fever virus infection.

[0067] Example 5: Application of CSFV E2 3B11 monoclonal antibody to specifically identify E2 proteins of different genotypes of classical swine fever viruses in Western blot method.

[0068] Experimental methods:

[0069] Based on the baculovirus expression system, the proteins of CSFV type 1 strain C E2, type 2 strain HZ08 E2, and type 3 strain AY64 E2 were expressed and purified. 40 μL of protein sample was taken, 10 μL of 5× Loading buffer was added, and the sample was boiled in a water bath for 10 min. The protein sample was subjected to SDS-PAGE electrophoresis. Western blot analysis was performed using 3B11 monoclonal antibody (1:1000 dilution) as the primary antibody, CSFV E2 positive mouse serum (1:1000 dilution) as the positive control, and HRP-labeled goat anti-mouse IgG (H+L) as the secondary antibody.

[0070] Experimental results:

[0071] As attached Figure 7 As shown, the CSFV E2 3B11 monoclonal antibody can specifically recognize the E2 protein of classical swine fever type 1 C strain, the E2 protein of type 2 HZ08, and the E2 protein of type 3 AY64, indicating that it can be further used for the diagnosis of classical swine fever virus infection.

[0072] Example 6: Application of CSFV E2 3B11 monoclonal antibody to specifically recognize E2 proteins of different genotypes of classical swine fever viruses in ELISA method.

[0073] Experimental method: 5 μg / mL of recombinant C strain E2, HZ08 E2 and AY64 E2 proteins were coated overnight at 4°C. The coating solution was discarded the next day and washed 3 times with PBST for 5 minutes each time. 200 μL of blocking solution was added to each well and blocked at 37°C for 2 hours and then discarded. Washed 3 times with PBST for 5 minutes each time. 3B11 monoclonal antibody (1:1000 dilution) was added to the corresponding wells of the detection ELISA plate, 100 μL / well, incubated at 37°C for 1 hour, then the liquid was discarded and washed 3 times with PBST for 5 minutes each time. CSFV E2 positive mouse serum and negative mouse serum were used as positive and negative controls, respectively. HRP-labeled goat anti-mouse IgG (H+L) was diluted 1:5000 with secondary antibody diluent, added to the ELISA plate at 100 μL / well, reacted at 37°C for 1 hour, and washed 3 times with PBST for 3 minutes each time. 100 μL of TMB colorimetric solution was added to each well and reacted at 37°C in the dark for 10 minutes. 50 μL 2M H2SO4 was added to each well to stop the color development, and the absorbance value at 450 nm was measured to analyze the reactivity of 3B11 monoclonal antibody with different genotypes of CSFV E2 protein in the ELISA system.

[0074] Experimental results:

[0075] As attached Figure 8 As shown, in the ELISA reaction, the CSFV E2 3B11 monoclonal antibody had good reactivity with the E2 proteins of classical swine fever type 1 C strain, type 2 HZ08 E2, and type 3 AY64 E2, indicating that it can be further used for the diagnosis of classical swine fever virus infection.

[0076] Example 7: Identification of the antigenic epitope recognized by the CSFV E2 3B11 monoclonal antibody and analysis of its conservation.

[0077] Experimental methods: PCR amplification of truncated and single-point mutant type 2 CSFV E2 protein gene fragments was connected to the pET30a vector and transformed into DH5α competent cells. The positive monoclonal colonies with correct sequencing were expanded and cultured, and the plasmids were extracted and transformed into Rosseta competent cells. The positive monoclonal colonies were screened by PCR identification and expanded to OD600=0.6, and 1mMIPTG was added to induce the expression of truncated E2 protein at 6℃. The truncated E2 protein was further identified by Western blot and monoclonal antibody 3B11 to determine the antigenic epitope recognized by monoclonal antibody 3B11, and its conservation on the E2 protein of different CSFV strains was further analyzed.

[0078] Experimental results:

[0079] The results are as follows Fig. 9As shown in the figure, monoclonal antibody 3B11 reacts with recombinant proteins aa1-333, aa250-333, and aa1-260, but does not react with aa1-150 and aa255-333, indicating that the epitope region recognized by monoclonal antibody 3B11 is located in the aa250-260 interval. After further single-point mutation of the E2 protein, the antigen epitope recognized by monoclonal antibody 3B11 was determined to be 254 HECLIG 259 The distribution of the antigenic epitopes of monoclonal antibody 3B11 in 14 strains of classical swine fever virus with different genotypes was analyzed using MegAlign software. Fig.10 As shown, the antigen epitope recognized by monoclonal antibody 3B11 254 HECLIG 259 It is highly conserved among classical swine fever virus strains of different genotypes, indicating that it can be used in the development of classical swine fever virus diagnostic kits.

[0080] Example 8: Sequence analysis of the gene encoding the CSFV E2 3B11 monoclonal antibody

[0081] Experimental methods:

[0082] The total RNA of CSFV E2 3B11 monoclonal hybridoma cells was extracted using a kit and reverse transcribed into cDNA. Two pairs of degenerate primers were designed according to the variable regions of the heavy and light chains of the antibody, and PCR amplification was performed respectively. The target fragments were recovered and cloned into T vectors and sent to the company for sequencing.

[0083] Experimental results:

[0084] The V of 3B11 monoclonal antibody was obtained by IMGT analysis H CDR1, V H CDR2 and V H CDR3 and V L CDR1, V L CDR2 and V L CDR3, wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3, respectively. L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6. The amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.8; the gene sequence encoding the light chain variable region is shown in SEQ ID NO.9; and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.10.

[0085] Example 9: Specific application examples of monoclonal antibodies

[0086] The immunochromatographic colloidal gold rapid detection kit was prepared according to the following formula:

[0087] 1) Coating fluid

[0088] Take 50 mM CBS buffer at pH 9.6 and add 3% methanol.

[0089] 2) NC membrane blocking solution

[0090] Take 10 mM pH 7.4 PBS buffer, add 0.5% Tween 20, 0.5% PEG2000, 2% BSA and 0.02% NaN3.

[0091] 3) Gold label antibody diluent

[0092] Take 10 mM borate buffer (BB, pH 8.2), add 8% sucrose, 2% BSA and 0.05% NaN3.

[0093] 4) Immunochromatographic colloidal gold immunochromatographic test strips

[0094] The detection line (T line) was coated with CSFV polyclonal antibody, the quality control line C line was coated with goat anti-mouse IgG, the C line and T line were arranged from top to bottom on the NC membrane, and the gold-labeled CSFV monoclonal antibody 3B11 was fixed on the gold label pad.

[0095] The kit was used in the following manner:

[0096] During the test, take an appropriate amount of the sample to be tested and drop it into the sample well. If the sample contains CSFV virus, it will bind to the polyclonal antibody coated on the T line and to the corresponding gold-labeled 3B11 monoclonal antibody, thereby developing color.

[0097] Example 10: Specific application examples of monoclonal antibodies

[0098] Prepare the immunohistochemistry kit according to the following recipe:

[0099] 1) 10 mM pH 7.4 PBS buffer

[0100] NaCl 8g, KCl 0.2g, Na2HPO4·12H2O 3.58g, KH2PO4 0.27g, add deionized water to 800mL, adjust pH to 7.4, and make up to 1L.

[0101] 2) 10 mM pH 7.4 PBST buffer

[0102] 10 mM pH 7.4 PBS buffer, add 500 μL of tween-20 per liter.

[0103] 3) Fixative

[0104] 4% paraformaldehyde.

[0105] 4)Permeabilizing fluid

[0106] 0.5% Triton-X100.

[0107] 5) Primary antibody diluent

[0108] Take 10 mM pH 7.4 PBS buffer and add 0.05 g / mL mannitol, 0.05 g / mL sucrose, 0.1% proclin-300, and 0.01 g / mL BSA at a final concentration.

[0109] 6) Enzyme-labeled secondary antibody dilution solution

[0110] Take 10 mM pH 7.4 PBS buffer, add 0.05% Tween-20 (Tween-20), 0.1% proclin-300, and 0.01 g / mL BSA at a final concentration.

[0111] The kit was used in the following manner:

[0112] 1) Take the sample to be tested and add the fixative solution, and incubate at 4°C overnight.

[0113] 2) Discard the fixative solution and wash three times with PBS, 3 minutes each time.

[0114] 3) Add permeabilization solution and incubate at room temperature for 15 minutes.

[0115] 4) Discard the permeabilization solution and wash three times with PBS, each time for 3 minutes.

[0116] 5) Add CSFV 3B11 monoclonal antibody diluted with primary antibody diluent and incubate in a humidified box at 37° C. for 1 h.

[0117] 6) Discard the primary antibody and wash with PBS three times, 3 min each time.

[0118] 7) Add HRP-labeled anti-mouse IgG antibody diluted with enzyme-labeled secondary antibody diluent, incubate in a wet box at 37°C for 1 hour; discard the secondary antibody, and wash 3 times with PBS, 3 minutes each time.

[0119] 8) Observe the image using a microscope.

[0120]

[0121]

[0122]

Claims

1. A monoclonal antibody 3B11 against the E2 protein of classical swine fever virus, characterized in that: The monoclonal antibody comprises the Ig domain V of the antibody heavy chain H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3 respectively; L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6, respectively.

2. The monoclonal antibody according to claim 1, characterized in that The monoclonal antibody is a full-length antibody, a Fab antibody or a F(ab')2 antibody.

3. The monoclonal antibody according to claim 1 or 2, characterized in that In the monoclonal antibody, the amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

8.

4. The gene encoding the monoclonal antibody according to claim 3, characterized in that: The gene sequence encoding the light chain variable region is shown in SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.

10.

5. The method for preparing a monoclonal antibody according to claim 1, characterized in that: The following steps are involved: (1) Based on the E2 protein gene sequence shown in SEQ ID NO: 11, a recombinant plasmid containing the E2 protein sequence was constructed using the primers shown in SEQ ID NO. 12 and SEQ ID NO. 13; (2) expressing and purifying recombinant CSFV E2 protein using an insect expression system; (3) Animal immunization with recombinant CSFV E2 protein; (4) The monoclonal antibody 3B11 against the E2 protein of classical swine fever virus was screened and obtained through hybridoma monoclonal antibody technology.

6. The method for using any one of the monoclonal antibodies according to claim 1 or 2, characterized in that: The monoclonal antibody is used to prepare a test kit for detecting classical swine fever virus.

7. A kit for detecting classical swine fever virus, characterized in that: The kit comprises any one of the monoclonal antibodies described in claim 1 or 2.

8. The kit according to claim 7, characterized in that The kit is an immunochromatographic diagnostic kit or an immunohistochemistry kit, and the detection method when using the kit is pathogen detection.

Images