A recombinant yeast with high squalene production, and its construction method and use

Abstract

The present invention relates to a recombinant yeast with high squalene production, a construction method and a use thereof, wherein the recombinant yeast is a saccharomyces cerevisiae that expresses or overexpresses HMGR gene, ADA gene, LEU2 gene, MVA pathway gene and squalene synthase gene ERG9. The present invention integrates acetaldehyde dehydrogenase gene ADA and HMG-CoA reductase gene tHMGR in multiple copies in saccharomyces cerevisiae, integrates the screened high-activity phosphoketolase gene PK and phosphotransacetylase gene PTA, weakens epoxysqualene synthesis, strengthens the mevalonate pathway, overexpresses yeast endogenous squalene synthase gene, etc. to obtain a recombinant yeast with high squalene production, so that the production in the shake flask stage of the production process exceeds 5g / L, and the production in the fed batch fermentation stage exceeds 50g / L, breaking through the current bottleneck of microbial synthesis of squalene production, and is suitable for practical promotion and application.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering fermentation, and in particular relates to a recombinant yeast with high squalene production, a construction method and application thereof. Background Art

[0002] Squalene is a natural open-chain triterpenoid compound with a molecular formula of C 30 H 50 , composed of 6 isoprene units, is widely distributed in plants, fungi, insects, animals and humans, and is a precursor for the synthesis of a variety of triterpenes and sterols in eukaryotic organisms. As a linear polyunsaturated triterpene, it has many applications in the cosmetic and pharmaceutical industries, such as vaccine adjuvants and nutritional supplements. The richest source of squalene is shark liver oil, but the growth in demand will cause overfishing of sharks, so it is impossible to rely on this method to produce squalene in the long term. Due to the limited natural resources of traditional squalene, people have been vigorously exploring alternative methods for the industrial-scale production of squalene in recent years.

[0003] The use of microorganisms to produce squalene is a very promising alternative. Yeast, as a host bacteria with high biosafety, has a natural mevalonate pathway and has the potential to be modified to produce squalene. Patent CN113684141B discloses a recombinant Saccharomyces cerevisiae strain, which produces only 893.58 mg / L of squalene in shake flask fermentation and only 6995.81 mg / L of squalene in fermentation tanks. In 2023, Zhou Jingwen's team at Jiangnan University modified Saccharomyces cerevisiae to produce squalene. By improving the strain's tolerance to ethanol, the output in a 5-L fermenter reached 27.33 g / L and 650 mg / g dry weight, which is the highest yield of squalene produced by microbial modified fermenters. Although these modified yeasts have achieved certain results in producing squalene, they still lack advantages compared to the cost of plant extraction. Therefore, the strains need to be further modified to improve squalene production capacity in order to achieve industrial expansion of production. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a recombinant yeast with high squalene production, wherein the recombinant yeast is a saccharomyces cerevisiae that expresses or overexpresses the following genes:

[0005] HMGR gene, ADA gene, LEU2 gene, MVA pathway gene, ERG9 gene;

[0006] The nucleotide sequence of the ADA gene is shown in SEQ ID NO.1;

[0007] The nucleotide sequence of the HMGR gene is shown in SEQ ID NO.44;

[0008] The nucleotide sequence of the LEU2 gene is shown in SEQ ID NO.45;

[0009] The accession number of the ERG9 gene in NCBI is NM_001179321.

[0010] Further, the MVA pathway genes include ERG10 gene, ERG13 gene, tHMG1 gene, ERG12 gene, ERG8 gene, ERG19 gene, and IDI1 gene;

[0011] The accession number of the ERG10 gene on NCBI is NM_001183842, the accession number of the ERG13 gene on NCBI is NM_001182489, the accession number of the tHMG1 gene on NCBI is NM_001182434, the accession number of the ERG12 gene on NCBI is NM_001182715, the accession number of the ERG8 gene on NCBI is NM_001182727, the accession number of the ERG19 gene on NCBI is NM_001183220, and the accession number of the IDI1 gene on NCBI is NM_142705.

[0012] Furthermore, a PGSY2 promoter is inserted before the start codon of the ERG1 gene in the Saccharomyces cerevisiae;

[0013] The nucleotide sequence of the PGSY2 promoter is shown in SEQ ID NO.2;

[0014] The accession number of the ERG1 gene in NCBI is NM_001181304.1.

[0015] Furthermore, the Saccharomyces cerevisiae also expresses or overexpresses the mPK gene and / or the PTA gene;

[0016] The nucleotide sequence of the mPK gene is shown in SEQ ID NO.3;

[0017] The accession number of the PTA gene in NCBI is EDK33432.1.

[0018] Furthermore, the Saccharomyces cerevisiae also expresses or overexpresses the ZWF1 gene, the GND1 gene, the TKL1 gene and / or the TAL1 gene;

[0019] The accession number of the ZWF1 gene in NCBI is NM_001183079.1

[0020] The accession number of the GND1 gene in NCBI is NM_001179314.3

[0021] The accession number of the TKL1 gene in NCBI is NM_001184171.1

[0022] The accession number of the TAL1 gene in NCBI is NM_001182243.1.

[0023] Furthermore, the brewer's yeast includes Saccharomyces cerevisiae CEN.PK2-1C.

[0024] Furthermore, the recombinant yeast is Saccharomyces cerevisiae CEN.PK2-1C into which the following genes are introduced:

[0025] HMGR gene, ADA gene, LEU2 gene, ERG10 gene, ERG13 gene, tHMG1 gene, ERG12 gene, ERG8 gene, ERG19 gene, IDI1 gene, ERG9 gene, mPK gene, PTA gene, ZWF1 gene, GND1 gene, TKL1 gene, TAL1 gene;

[0026] The PGSY2 promoter is inserted before the start codon of the ERG1 gene in the recombinant yeast.

[0027] The present invention also provides a method for high-yield squalene, which is fermented by the aforementioned recombinant yeast.

[0028] Furthermore, the fermentation step is:

[0029] The seed liquid of the recombinant yeast is taken and inoculated into the fermentation medium for shake flask fermentation or fermentation tank fermentation.

[0030] Furthermore, the formula of the fermentation medium is:

[0031] Glucose 40g / L, potassium dihydrogen phosphate 2.2g / L, dipotassium hydrogen phosphate 2.9g / L, yeast powder 10g / L, peptone 20g / L, and the rest is water.

[0032] Furthermore, the conditions for the shake flask fermentation are as follows: the inoculation amount of the seed liquid is 1%; the fermentation temperature is 25-35° C., the rotation speed is 100-300 rpm, and the time is 80-120 h;

[0033] And / or: The fermentation conditions of the fermentation tank are:

[0034] The inoculation amount of the seed liquid is 10%; the fermentation temperature is 30°C, the pH value of the fermentation liquid is maintained at 5.0, and the air flow range is 1-2vvm; when the glucose concentration drops to 1g / L during the fermentation, the feed medium is added and the residual glucose concentration is adjusted to above 1g / L;

[0035] The formula of the feed medium is: 500-800 g / L glucose, 9 g / L KH 2 PO 4 、2.5g / L MgSO 4 , 3.5g / LK 2 SO 4 , 0.28g / L Na 2 SO 4 , 10ml / L trace element solution, 12ml / L vitamin solution, and the rest is water;

[0036] The trace element solution contains 15g / L EDTA, 10.2g / L ZnSO 4 7H 2 O, 0.5 g / L MnCl 2 ·4H 2 O, 0.5 g / LCuSO 4 , 0.86 g / L CoCl 2 6H 2 O, 0.56 g / L Na 2 MoO 4 ·2H 2 O, 3.84 g / L CaCl 2 ·2H 2 O, 5.12g / LFeSO 4 7H 2 O in aqueous solution;

[0037] The vitamin solution is an aqueous solution containing 0.05 g / L biotin, 1 g / L calcium pantothenate, 1 g / L nicotinic acid, 25 g / L inositol, 1 g / L thiamine hydrochloride, 1 g / L pyridoxine and 0.2 g / L p-aminobenzoic acid.

[0038] The recombinant yeast with high squalene production of the present invention is obtained by integrating multiple copies of acetaldehyde dehydrogenase gene ADA and HMG-CoA reductase gene tHMGR in saccharomyces cerevisiae, integrating the selected high-activity phosphoketolase gene PK and phosphotransacetylase gene PTA, weakening epoxysqualene synthesis, strengthening mevalonate pathway, overexpressing yeast endogenous squalene synthase gene, etc., and the recombinant yeast with high squalene production can complete the biosynthetic pathway of synthesizing squalene from glucose ( Figure 8 ). This enables the production to exceed 5g / L in the shake flask stage of the production process and to exceed 50g / L in the fed-batch fermentation stage, breaking through the current bottleneck of microbial production of squalene and making it suitable for practical promotion and application.

[0039] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0040] The above contents of the present invention are further described in detail below through specific implementation modes in the form of embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 pSS01 Plasmid Map

[0042] Figure 2 HMGR-ADA expression cassette integrated into yeast genome at multiple copy sites

[0043] Figure 3 Replacement of the endogenous ERG1 promoter in Saccharomyces cerevisiae

[0044] Figure 4 pSS06-PTA Plasmid Map

[0045] Figure 5 pSS06-PTA-PK Plasmid Map

[0046] Figure 6 pKLAC1-ERG9-mPK-PTA Plasmid Map

[0047] Figure 7 Squalene accumulation after 96 h of culture of recombinant yeast in shake flask

[0048] Figure 8 Biosynthetic pathway for squalene from glucose DETAILED DESCRIPTION

[0049] Nucleotide sequence information involved in the present invention

[0050] (I) ADA codon-optimized nucleotide sequence (SEQ ID NO.1):

[0051] ATGGAACACAGCGTTATTGAACCAACGGTGCCCATGCCAATGCCCGCTATGTTTGAC

[0052] GCCCCCTCTGGCATTTTTGACTCTTTGGACGACGCCGTTCAAGCTTGCTGTGTACGCC

[0053] CAACAACAATTAAATAGTGTTGAATTAAGGCAGCAAGTTATTAAGGCTATTAGAGTC

[0054] GCTGTGTGAAAGGTATGCTCAGGTTCTTGCTGAAATGGCTGTTGCTGAAACTGGTATG

[0055] GGTAGAGTCGTTGATAAATATATTAAGAACGTCTCTCAGGCTAGGCATACTCCAGGTA

[0056] TTGAATGTCTATCAGCTGAAGTTTTGACTGGTGATAATGGTTTGACTTTGATTGAGAA

[0057] CGCTCCATGGGGTGTGGTGGCTTCCGTCACTCCATCTACTAATCCAGCTGCTACAGTT

[0058] ATTAATAATGCTATTTCTATGATCGCCGCAGGTAATTCTGTTTTTGCTCCACATCC

[0059] CTCTGCTAAGAATGTTTCTTTGAGAACTATTTCTCTGTTGAATAAGGCTATTGTTGCTA

[0060] CCGGTGGACCAGAGAATTTGTTGGTTTCTGTTTCTGATCCAAATATTGAAACTGCTC

[0061] AAAGGTTGTTTAGATATCCTGGTATTGGTTTGTTGGTTGTGACTGGAGGGTGAAGCTG

[0062] TTGTTGAAGCTGCTAGGAAGCATACTGATAAAGATTGATTGCTGCTGGTGCTGGCA

[0063] ATCCACCAGTGTTGTTGACGAAACTGCCGATATTCCTAAAGCTGCTAGAGCTATAGT

[0064] TAAGGGTGCATCTTTTGATAATAACATTATCTGTGCAGACGAGAAAGTTTTGATAGTT

[0065] GTCGATTCTGTTGCTGATGCTCTATTGGAAGAAATGCAAAGGAATCATGCAGTTTTGT

[0066] TGACCCCAGCTCAAACTGAACAATTGTTGCCAGCTTTGTTGTCTGATATTGATGAAC

[0067] AAGGTAAAGGTAGGGTTAATAGAGATTATGTTGGTAGGGATGCAACTAAATTAGCTG

[0068] AGGCTATCGGTTTGGAAGTTAATGAATATACTAGATTGCTGTTGGCTGAGACAGATGC

[0069] TTCTCATCCATTTGCAGTTACAGAACTGATGATGCCAGTTTTGCCAGTTGTCAGGGTT

[0070] AAGAATGTTGATGAGGCTATTGCTTTGGCTTTGAAGTTGGAAAATGGTTGTAGACAT

[0071] ACTGCTGCTATGCATAGTACTAACATTAGAAATTTGAACAGGATGGCTAATGCTATTA

[0072] ATACGTCAATTTTCGTTAAGAACGGTCCTTGTATTGCTGGTTTGGGTTTGGGTGGTGA

[0073] AGGCTGGACTTCGATGACGATTTCGACCCCAACTGGTGAAGGTGTGACTTCGGCTA

[0074] GGACTTTTGTTAGGTTGAGGAGATGTGTTTTGGTTGATATGTTTAGGATTGCTTAA

[0075] (2) Nucleotide sequence with codon optimization of HMG reductase gene (HMGR) (SEQ ID NO. 44)

[0076]

[0077] (III) Nucleotide sequence of LEU2 gene (SEQ ID NO.45):

[0078]

[0079] (4) Promoter P GSY2 Nucleotide sequence (SEQ ID NO.2):

[0080] AATGGAATATTGAAACTGGAGTGACTTCTGATGAAGTTTCCAATTATTTATATGTATAC

[0081] ATTATTTATTTGTCTATCATTAAAATTTCTGTCAAGTAATGGCTTTTTATGTTTATTTCAT

[0082] GGATTACGAAATTTGCTGGCTTTTTAGAGTGACCGATGAGTTGCATGTACATATGTGC

[0083] GAAATAAAACAATACGGTAGTAAAACATGAATACTTCGAGAAGTAAATTCAAGATTG

[0084] CAGGCGTAGCACAAGAATGTCCTTCCGCCTGCTAGTGTGTTGAGCAAAGCACGCCA

[0085] TCACTAATGGAACCCTTACAAAATCTCGCATGGAGCAGCAAACCTTAAATCCATTTT

[0086] CTATCATTCGTTCCTGAGGACCCGGATATCGTTTTAGAGACAAAAATAGATACTACAA

[0087] GAGGAATAGGGATATCTGCACATGGGGCCTCGAGCATGGCTCATTTTCGATTTTCCG

[0088] GCACGATGCTGACTTAGTACTATCATGCCAGGCAGGACAGGCCTTATGGGGTTCTTG

[0089] CAGCTTACCAATTCTGACACTGGACTGCCCCTGGATTAGCGACCCCGCGACCCCGCG

[0090] ACCAGACTCCCTGAAAATGGTAATTGGTGATGATATATGTGACTGAGTTCAGCCTGG

[0091] GCATACAATGTTTAACCCTTTTGGACATGGAATTAGGCCAGCAAAGGGAGCAGCTTT

[0092] CCCCGAAAGCGTAGTTTTTCTCCAGGAACGCAATTCACCCCTTTCTTTCTTATGCAA

[0093] GCTCCTCGTACATATATAAAAATATATGAGTATATATAGTGCTTCTACAGCATAATCAAT

[0094] TTAAGGTTCCTTGCCTTTCCTTAAATATGTTAGCTATCTCTAAAGCATCACTGAGAAG

[0095] TGGTAGTTTTTTTGATAACTGTGATTGAAGTTTTGACTACCTCAGAGAAAAATTTTGA (V) The accession number of ERG10 gene in NCBI is NM_001183842

[0096] The accession number of ERG13 gene in NCBI is NM_001182489

[0097] The accession number of tHMG1 gene in NCBI is NM_001182434

[0098] The accession number of ERG12 gene in NCBI is NM_001182715

[0099] The accession number of ERG8 gene in NCBI is NM_001182727

[0100] The accession number of ERG19 gene in NCBI is NM_001183220

[0101] The accession number of IDI1 gene in NCBI is NM_142705

[0102] The accession number of squalene synthase gene ERG9 in NCBI is NM_001179321

[0103] The accession number of ERG1 gene in NCBI is NM_001181304.1

[0104]

[0105] (VIII) ZWF1 gene accession number at NCBI: NM_001183079.1

[0106] (IX) The accession number of GND1 gene in NCBI is NM_001179314.3

[0107] (X) The accession number of TKL1 gene in NCBI is NM_001184171.1

[0108] (XI) TAL1 gene accession number in NCBI: NM_001182243.1

[0109] (IV) Primer information involved

[0110] Table 1 Nucleotide sequences of primers

[0111]

[0112]

[0113]

[0114] Example 1 Construction of the high-yield squalene brewer's yeast strain of the present invention

[0115] (1) Integration of HMGR and ADA genes at multiple copy sites

[0116] The HMG reductase gene HMGR from Ruegeria pomeroyi and the aldehyde dehydrogenase gene ADA from Dickeya zeae were first codon-optimized and then chemically synthesized by Shanghai Qingke Biotechnology Co., Ltd.; the HMG reductase gene and the aldehyde dehydrogenase gene were amplified by PCR using HMGR-F / HMGR-R and ADA-F / ADA-R as primers, respectively, and the PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified by a clean-up kit;

[0117] The target plasmid pSS01 ( Figure 1) for double enzyme digestion, the digestion product was detected by 1.0% agarose gel electrophoresis and the linearized vector fragment was recovered and purified by gel cutting; then the purified HMGR gene fragment was connected to the linearized plasmid pSS01 using the one-step cloning kit of Novozymes (37°C, 30min); the connection product was transformed into E.coli DH5α to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing ampicillin at a final concentration of 100mg / L), and after a single clone was obtained, the plasmid was extracted and sequenced after culture at 37°C and 220rpm for 8-12h. If the verification was correct, the HMG reductase gene HMGR plasmid pSS01-HMGR was obtained;

[0118] The target plasmid pSS01-HMGR was double-digested with NotI and BcuI, and the digestion products were detected by 1.0% agarose gel electrophoresis and the linearized vector fragment was recovered and purified by gel cutting; then the purified acetaldehyde dehydrogenase gene fragment was connected with the linearized plasmid pSS01-HMGR using a one-step cloning kit of Novozymes (37°C, 30 min); the connection product was transformed into E. coli DH5α to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing ampicillin at a final concentration of 100 mg / L), and after obtaining a single clone, the plasmid was extracted and sequenced after culture under the conditions of 37°C and 220 rpm. If the verification is correct, the expression plasmid pSS01-HMGR-ADA of the acetaldehyde dehydrogenase ADA gene and the HMG reductase HMGR gene is obtained;

[0119] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C or BY4741 as a template, PCR products of homologous arms rDNA-UP and rDNA-Dn were obtained by PCR using primers rDNA-UF / rDNA-UR and rDNA-DF / rDNA-DR. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit;

[0120] Using plasmid pSS01-HMGR-ADA as template, PCR products of HMGR and ADA expression cassettes were obtained by PCR using primers rDNA-F / rDNA-R. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit;

[0121] Using Saccharomyces cerevisiae S288C as a template, the PCR product of the LEU2 gene expression cassette was obtained by PCR using primers LEU2-F / LEU2-R. The PCR product was detected by 1.0% agarose gel electrophoresis and the gene fragment was purified using a clean-up kit;

[0122] The purified products of the homologous arms rDNA-UP and rDNA-Dn, the HMGR and ADA expression cassettes, and the purified products of the LEU2 expression cassette were transformed into Saccharomyces cerevisiae CEN.PK2-1C competent cells to obtain transformation products; the transformation products were spread on SD-ΔLEU solid culture medium and inverted in a 30°C constant temperature incubator for about 48 hours to obtain transformants. This transformant is the yeast engineering strain Sq01 ( Figure 2 ).

[0123] (2) Weakening the ability to synthesize epoxysqualene

[0124] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C or BY4741 as a template, the PCR product of the promoter PGSY2 was obtained by PCR using primers PGSY2-F / PGSY2-R. The PCR product was detected by 1.0% agarose gel electrophoresis and the gene fragment was purified using a clean-up kit;

[0125] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C or BY4741 as a template, PCR was performed using primers pERG1-UF / pERG1-UR and pERG1-DF / pERG1-DR to obtain the PCR products of homology arms pERG1-UP and pERG1-Dn. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit.

[0126] The purified products of homology arms pERG1-UP and pERG1-Dn and the promoter fragment P GSY2 The purified product was then inserted into the ERG1 gene in the strain Sq01 using CRISPR / Cas9 gene editing technology before the start codon (ATG) of the ERG1 gene. Figure 3 ), the promoter of ERG1 was replaced with PGSY2 to obtain the yeast engineering strain Sq02.

[0127] (3) Enhanced expression of the MVA pathway and squalene synthase

[0128] Taking the construction method of plasmid pSS01-HMGR-ADA as an example, the genome of Saccharomyces cerevisiaeCEN.PK2-1C or BY4741 was used as a template and plasmid pSS01 was used as a vector to construct expression plasmids of seven genes ERG10, ERG13, tHMG1, ERG12, ERG8, ERG19, IDI1 of the MVA pathway and squalene synthase gene ERG9, namely pSS02-ERG10-tHMG1, pSS03-ERG12-ERG13, pSS04-ERG19-ERG8 and pSS05-IDI1-ERG9.

[0129] Taking the construction method of yeast engineering strain Sq02 as an example, the expression plasmids pSS02-ERG10-tHMG1, pSS03-ERG12-ERG13, pSS04-ERG19-ERG8 and pSS05-IDI1-ERG9 of the above-mentioned 7 genes of the MVA pathway were used as templates, and PCR products of the 7 genes of the MVA pathway and the corresponding expression cassettes of ERG9 were obtained by PCR. The corresponding expression cassettes of the 7 genes of the MVA pathway were integrated into the genome of the yeast engineering strain Sq02 using CRISPR / Cas9 gene editing technology to obtain the yeast engineering strain Sq08.

[0130] Example 2 The present invention screens the highly active phosphoketolase gene PK and integrates it into the genome

[0131] (1) Construction of phosphoketolase gene mutants by error-prone PCR

[0132] The phosphoketolase genes BbPK, BaPK, and LmPK from Bifidobacterium breve, Bifidobacterium adolescentis, and Leuconostoc mesenteroides were chemically synthesized (Shanghai Qingke Biotechnology Co., Ltd.); BbPK-F / BbPK-R, BaPK-F / BaPK-R, and LmPK-F / LmPK-R were used as primers, and the phosphoketolase genes BbPK, BaPK, and LmPK were amplified by PCR using an error-prone PCR kit, and the PCR products were detected by 1.0% agarose gel electrophoresis, and the gene fragments were purified using a clean-up kit;

[0133] The target plasmid pSS06-PTA (PTA derived from Clostridium kluyveri synthesized by Qingke Company) was oxidized by two enzymes, BamH1 and HindIII. Figure 4) for double enzyme digestion, the digestion product was detected by 1.0% agarose gel electrophoresis and the linearized vector fragment was recovered and purified by gel cutting; then the purified gene fragment was connected with the linearized plasmid pSS06-PTA using the one-step cloning kit of Novozymes (37°C, 30min); the connection product was transformed into E.coli DH5α to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing ampicillin at a final concentration of 100mg / L), and after obtaining a single clone, the plasmid was extracted and sequenced after culture at 37°C and 220rpm for 8-12h. If the verification is correct, the phosphoketolase PK mutant library plasmid pSS06-PTA-PK ( Figure 5 );

[0134] The PK mutant library plasmid constructed above was transformed into Saccharomyces cerevisiae BY4741 to obtain a transformation product; the transformation product was spread on SD-URA solid culture medium and inverted in a constant temperature incubator at 30°C for about 48 hours to obtain a transformant, which is the recombinant yeast engineering strain Saccharomyces cerevisiaeBY4741pSS06-PTA-PK.

[0135] (2) The above-mentioned recombinant yeast engineering strain Saccharomyces cerevisiae BY4741 pSS06-PTA-PK was inoculated into a seed culture medium and cultured for 24 h. The seed solution was inoculated into a fermentation medium at 1% (v / v), and cultured in a shaking incubator at 30°C and 200 rpm for 72 h. The yield of each engineering strain was detected and compared, and it was determined that the high-activity phosphoketolase gene PK was derived from Leuconostoc mesenteroides and contained the K356F / S379V / T743V mutation (hereinafter referred to as mPK);

[0136] The formula of the seed culture medium is: peptone 20g / L, yeast powder 10g / L, glucose 20g / L;

[0137] The formula of the fermentation medium is 20 g / L of galactose and glycerol, 2.2 g / L of potassium dihydrogen phosphate, 2.9 g / L of dipotassium hydrogen phosphate, 10 g / L of yeast powder, and 20 g / L of peptone.

[0138] (3) Integrate PK and PTA expression cassettes into the yeast genome

[0139] Taking the construction method of the yeast engineering strain Sq01 in Example 1 as an example, the above-mentioned high-activity mPK and PTA expression cassette plasmid pSS06-PTA-mPK was used as a template, and the PCR products of the corresponding expression cassettes of the phosphoketolase gene mPK and the phosphotransacetylase gene PTA were obtained by PCR. By homologous recombination, the mPK and PTA expression cassettes were integrated into the multi-copy rDNA site of the yeast engineering strain Sq08 to obtain the yeast engineering strain Sq42.

[0140] (4) Strengthening the pentose phosphate pathway

[0141] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C or BY4741 as a template, PCR products of genes ZWF1 and GND1 were obtained by using primers ZWF1-F / ZWF1-R and GND1-F / GND1-R. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit;

[0142] The target plasmid pSS01 was double-digested with BamHI and HindIII, and the digestion products were detected by 1.0% agarose gel electrophoresis and the linearized vector fragment was recovered and purified by gel cutting; then the purified ZWF1 gene fragment was connected to the linearized plasmid pSS01 using the Novozymes one-step cloning kit (37°C, 30min); the connection product was transformed into E.coli DH5α to obtain the transformation product; the transformation product was spread on LB solid medium (containing ampicillin at a final concentration of 100mg / L), and after obtaining a single clone, the plasmid was extracted and sequenced after culture at 37°C and 220rpm for 8-12h. If the verification was correct, the plasmid pSS07-ZWF1 expressing the ZWF1 gene was obtained;

[0143] The target plasmid pSS07-ZWF1 was double-digested with EcoRI and BcuI, and the digestion products were detected by 1.0% agarose gel electrophoresis and the linearized vector fragment was recovered and purified by gel cutting; then the purified GND1 gene fragment was connected with the linearized plasmid pSS07-ZWF1 using the one-step cloning kit of Novozymes (37°C, 30min); the connection product was transformed into E.coli DH5α to obtain the transformation product; the transformation product was spread on LB solid culture medium (containing ampicillin at a final concentration of 100mg / L), and after obtaining a single clone, the plasmid was extracted and sequenced after culture at 37°C and 220rpm for 8-12h. If the verification was correct, the expression plasmid pSS07-ZWF1-GND1 of the ZWF1 gene and the GND1 gene was obtained;

[0144] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C or BY4741 as a template, PCR products of genes TKL1 and TAL1 were obtained by using primers TKL1-F / TKL1-R and TAL1-F / TAL1-R. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit.

[0145] Taking the construction method of the above-mentioned plasmid pSS07-ZWF1-GND1 as an example, the expression plasmid pSS08-TKL1-TAL1 of the TKL1 gene and the TAL1 gene was constructed.

[0146] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C or BY4741 as a template, PCR products of homology arms GRE3-UP and GRE3-Dn were obtained by PCR using primers GRE3-UF / GRE3-UR, GRE3-DF / GRE3-DR. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit;

[0147] Using plasmid pSS07-ZWF1-GND1 as a template, PCR products of ZWF1 and GND1 expression cassettes were obtained by PCR using primers GRE3-F / TTPS1-R. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit;

[0148] Using plasmid pSS08-TKL1-TAL1 as a template, PCR products of TKL1 and TAL1 expression cassettes were obtained by PCR using primers TADH1-F / GRE3-R. The PCR products were detected by 1.0% agarose gel electrophoresis and the gene fragments were purified using a clean-up kit;

[0149] The purified products of homology arms GRE3-UP and GRE3-Dn, the purified products of ZWF1 and GND1 expression cassettes, and the purified products of TKL1 and TAL1 expression cassettes were integrated into the yeast engineering strain Sq42 GRE3 site using CRISPR / Cas9 gene editing technology to obtain the yeast engineering strain Sq61.

[0150] Example 3 Construction of the Squalene-producing Kluyveromyces lactic acid strain of the present invention

[0151] Taking the plasmid construction method in Examples 1 and 2 as an example, the screened phosphoketolase gene mPK and phosphotransacetylase gene PTA, as well as the squalene synthase gene ERG9, were constructed into the Kluyveromyces lactis integration plasmid pKLAC1 to obtain the plasmid pKLAC1-ERG9-mPK-PTA ( Figure 6 ).

[0152] The pKLAC1-ERG9-mPK-PTA plasmid constructed above was transformed into Kluyveromyces lactis GG799 to obtain a transformation product; the transformation product was spread on a fluoroacetamide-resistant solid culture medium and inverted in a constant temperature incubator at 30° C. for about 48 hours to obtain a transformant, which is the recombinant yeast engineering strain SqK06.

[0153] Example 4 Fermentation of the recombinant yeast strain producing squalene of the present invention

[0154] 1) Shake flask fermentation

[0155] The recombinant Saccharomyces cerevisiae engineering strains Sq01 / Sq08 / Sq42 / Sq61 constructed in Examples 1 and 2 and the lactic acid Kluyveromyces engineering strain SqK06 constructed in Example 3 were inoculated into seed culture medium, cultured on a shaker at 30°C and 200rpm for 24h, and the seed solution was inoculated into the fermentation medium at 1% (v / v), and cultured on a shaker at 30°C and 200rpm for 96h. The fermentation broth was centrifuged to obtain the bacterial cells, the cells were broken by a freezing grinder, and then extracted with an organic solvent ethyl acetate, filtered and quantified by GC, and the yield of squalene in the fermentation broth of the Saccharomyces cerevisiae engineering strain Sq61 reached more than 5g / L, and the yield of squalene in the fermentation broth of the lactic acid Kluyveromyces engineering strain SqK06 reached 600mg / L ( Figure 7 ).

[0156] The formula of the seed culture medium is: peptone 20g / L, yeast powder 10g / L, glucose 20g / L;

[0157] The formula of the fermentation medium is 40 g / L glucose, 2.2 g / L potassium dihydrogen phosphate, 2.9 g / L dipotassium hydrogen phosphate, 10 g / L yeast powder, 20 g / L peptone, and the rest is water.

[0158] 2) Fed-batch fermentation

[0159] Take the recombinant Saccharomyces cerevisiae engineered strain Sq61 constructed in Example 2, inoculate it in a seed culture medium, and culture it on a shaker at 30°C and 200rpm for 24h. Take the seed solution and inoculate it into a 5L fermenter containing 2L fermentation medium at 10% (v / v). Fed-batch fermentation was carried out at 30°C, and the pH in the fermentation system was maintained at 5.0 by automatically adding 5M ammonium hydroxide. The air flow rate ranged from 1vvm to 2vvm (air volume / working volume / minute). When the glucose concentration in the culture medium dropped to 1g / L, start adding the feed culture medium solution and adjust the residual glucose concentration to above 1g / L. After fermentation for about 120h, take the fermentation broth and centrifuge it to obtain the bacterial cells. The squalene yield exceeded 50g / L by cell disruption.

[0160] Batch feeding: During the slow growth phase (i.e. the adjustment period of the first 24 hours or so), adjust the sugar feeding rate to maintain the residual sugar at 1-2g / L. During the rapid growth phase (i.e. the logarithmic growth phase after 24 hours), control the feeding rate to 1.5ml / L / h--7mL / L / h (maximum rate).

[0161] Feed medium: 500-800 g / L glucose, 9 g / L KH 2 PO 4 、2.5g / L MgSO 4 , 3.5g / LK 2 SO 4 , 0.28g / L Na 2 SO 4 , 10ml / L trace element solution and 12ml / L vitamin solution;

[0162] Trace element solution: 15g / L EDTA, 10.2g / L ZnSO 4 7H 2 O, 0.5 g / L MnCl 2 ·4H 2 O, 0.5 g / LCuSO 4 , 0.86 g / L CoCl 2 6H 2 O, 0.56 g / L Na 2 MoO 4 ·2H 2 O, 3.84 g / L CaCl 2 ·2H 2 O, 5.12g / LFeSO 4 7H 2 O, the rest is water. After the solution is prepared, sterilize at 121℃ for 20min and store at 4℃;

[0163] Vitamin solution: 0.05 g / L biotin, 1 g / L calcium pantothenate, 1 g / L niacin, 25 g / L inositol, 1 g / L thiamine hydrochloride, 1 g / L pyridoxine, 0.2 g / L p-aminobenzoic acid, and the rest is water; the solution is filtered and sterilized and stored at 4°C.

[0164] In summary, the present invention obtains a recombinant yeast with high squalene production by integrating multiple copies of the acetaldehyde dehydrogenase gene ADA and the HMG-CoA reductase gene tHMGR in the grain wine yeast, integrating the selected high-activity phosphoketolase gene PK and the phosphotransacetylase gene PTA, weakening the synthesis of epoxysqualene, strengthening the mevalonate pathway, overexpressing the endogenous squalene synthase gene in the yeast, etc., so that the output in the shake flask stage of the production process exceeds 5g / L, and the output in the fed-batch fermentation stage exceeds 50g / L, breaking through the current bottleneck of squalene production synthesized by microorganisms, and being suitable for practical promotion and application.

Claims

1. A recombinant yeast with high squalene production, characterized in that: The recombinant yeast is a cerevisiae yeast expressing or overexpressing the following genes: HMGR gene, ADA gene, LEU2 gene, MVA pathway gene, ERG9 gene; The nucleotide sequence of the ADA gene is shown in SEQ ID NO.1; The nucleotide sequence of the HMGR gene is shown in SEQ ID NO.44; The nucleotide sequence of the LEU2 gene is shown in SEQ ID NO.45; The accession number of the ERG9 gene in NCBI is NM_001179321.

2. The recombinant yeast according to claim 1, characterized in that: The MVA pathway genes include ERG10 gene, ERG13 gene, tHMG1 gene, ERG12 gene, ERG8 gene, ERG19 gene, and IDI1 gene; The accession number of the ERG10 gene on NCBI is NM_001183842, the accession number of the ERG13 gene on NCBI is NM_001182489, the accession number of the tHMG1 gene on NCBI is NM_001182434, the accession number of the ERG12 gene on NCBI is NM_001182715, the accession number of the ERG8 gene on NCBI is NM_001182727, the accession number of the ERG19 gene on NCBI is NM_001183220, and the accession number of the IDI1 gene on NCBI is NM_142705.

3. The recombinant yeast according to claim 1, characterized in that: A PGSY2 promoter is inserted before the start codon of the ERG1 gene in the Saccharomyces cerevisiae; The nucleotide sequence of the PGSY2 promoter is shown in SEQ ID NO.2; The accession number of the ERG1 gene in NCBI is NM_001181304.

1.

4. The recombinant yeast according to claim 3, characterized in that: The saccharomyces cerevisiae also expresses or overexpresses the mPK gene and / or the PTA gene; The nucleotide sequence of the mPK gene is shown in SEQ ID NO.3; The accession number of the PTA gene in NCBI is EDK33432.

1.

5. The recombinant yeast according to claim 4, characterized in that: The cerevisiae yeast also expresses or overexpresses the ZWF1 gene, the GND1 gene, the TKL1 gene and / or the TAL1 gene; The accession number of the ZWF1 gene in NCBI is NM_001183079.1 The accession number of the GND1 gene in NCBI is NM_001179314.3 The accession number of the TKL1 gene in NCBI is NM_001184171.1 The accession number of the TAL1 gene in NCBI is NM_001182243.

1.

6. The recombinant yeast according to any one of claims 1 to 3, characterized in that: The brewer's yeast includes Saccharomyces cerevisiae CEN.PK2-1C.

7. A method for high-yield squalene, characterized in that: The method is fermented by using the recombinant yeast described in any one of claims 1 to 6.

8. The method according to claim 7, characterized in that: The fermentation steps are: The seed liquid of the recombinant yeast is taken and inoculated into the fermentation medium for shake flask fermentation or fermentation tank fermentation.

9. The method according to claim 8, characterized in that: The formula of the fermentation medium is: Glucose 40g / L, potassium dihydrogen phosphate 2.2g / L, dipotassium hydrogen phosphate 2.9g / L, yeast powder 10g / L, peptone 20g / L, and the rest is water.

10. The method according to claim 8, characterized in that: The conditions for the shake flask fermentation are as follows: the inoculation amount of the seed liquid is 1%; the fermentation temperature is 25-35°C, the rotation speed is 100-300 rpm, and the time is 80-120 hours; And / or: The fermentation conditions of the fermentation tank are: The inoculation amount of the seed liquid is 10%; the fermentation temperature is 30°C, the pH value of the fermentation liquid is maintained at 5.0, and the air flow range is 1-2vvm; when the glucose concentration drops to 1g / L during the fermentation, the feed medium is added and the residual glucose concentration is adjusted to above 1g / L; The feed medium has a formula of: 500-800 g / L glucose, 9 g / L KH2PO4, 2.5 g / L MgSO4, 3.5 g / L K2SO4, 0.28 g / L Na2SO4, 10 ml / L trace element solution, 12 ml / L vitamin solution, and the rest is water; The trace element solution is an aqueous solution containing 15 g / L EDTA, 10.2 g / L ZnSO4·7H2O, 0.5 g / L MnCl2·4H2O, 0.5 g / L CuSO4, 0.86 g / L CoCl2·6H2O, 0.56 g / L Na2MoO4·2H2O, 3.84 g / L CaCl2·2H2O, and 5.12 g / L FeSO4·7H2O; The vitamin solution is an aqueous solution containing 0.05 g / L biotin, 1 g / L calcium pantothenate, 1 g / L nicotinic acid, 25 g / L inositol, 1 g / L thiamine hydrochloride, 1 g / L pyridoxine and 0.2 g / L p-aminobenzoic acid.

Images