A fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, and its preparation method and application
The fusion strain PL-35 of Lactobacillus paracasei and Bifidobacterium adolescentis was prepared through protoplast fusion technology, which solved the problem of lack of excellent strain resources in the lactic acid bacteria industry, achieved efficient strain improvement and optimization of fermentation characteristics, and improved the storage quality and antibacterial effect of dairy products.
Patent Information
- Application Number
- CN202411971410.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-12-30
AI Technical Summary
my country's lactic acid bacteria industry lacks high-quality strain resources, the strain selection and improvement costs are high and the efficiency is low, and it is difficult to maintain high activity of bifidobacteria for a long time. The post-acidification phenomenon during the fermentation of Lactobacillus paracasei is serious, which affects the development and storage of preparations.
The protoplast fusion technology was used to prepare a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis. The protoplasts were inactivated by ultraviolet or heat, and then fused in a water bath using PEG 6000 to obtain the fusion strain PL-35 with the excellent properties of Bifidobacterium and Lactobacillus paracasei.
The successfully prepared fusion strain PL-35 maintained good characteristics during the fermentation process, had a significant effect in inhibiting pathogenic bacteria, maintained a stable number of viable bacteria during storage, and had excellent viscosity and quality, making it suitable for dairy product development.
Smart Images

Figure CN119752722B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of strain breeding, in particular to a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, and a preparation method and application thereof. Background Art
[0002] my country's lactic acid bacteria industry is currently experiencing rapid growth, but key core technologies such as strain development and processing lag behind. This has resulted in limited access to high-quality strains, including lactic acid bacteria starters and probiotic preparations, often hailed as the "chips" of the dairy industry. Furthermore, some probiotics fail to achieve the desired effects after administration, necessitating the selection and improvement of strains to improve product quality and reduce production costs.
[0003] Microbial breeding is a method based on genetic principles and techniques to select strains for specific production targets. This method can significantly optimize strain performance and practical applications, increase product diversity, and optimize process conditions. Common strain breeding methods include natural selection, mutation breeding, and hybridization.
[0004] Compared with other methods, protoplast fusion technology has many unique advantages: the parents are less restricted by the binding type or fertility type, and due to the lack of cell wall barriers, the fusion strains can cross the boundaries of species and achieve distant hybridization with large genetic gaps, that is, it can effectively overcome the main physical and physiological barriers, thereby obtaining new types with outstanding excellent traits and improving the genetic characteristics of the strains; the fusion of protoplasts will form contact between the parental genes and realize gene exchange between strains, generating different recombinants of various gene types, and even forming strains with specific functions or traits, and the recombination frequency in this process is very high, and the genetic material is transmitted completely; the genes obtained from other methods are transferred to the strains. The beneficial traits obtained are combined and fused into one strain, that is, other breeding techniques and protoplast fusion technology are combined; more than two parents can also be fused into one strain, so as to select new strains with more advantages; in addition, inactivated protoplasts can also be fused. After being treated with temperature and ultraviolet irradiation, the parent becomes passivated and fused with the protoplast of another parent that maintains activity. This can effectively remove one parent in the strain selection process and greatly improve the efficiency; compared with genetic engineering breeding methods, this method can avoid relatively complex genetic operations such as separation and purification, shearing, and splicing, and is simple and easy to implement, so this method is highly feasible.
[0005] As an important probiotic, Bifidobacterium has been widely used in a variety of fields, including food, health products, and pharmaceuticals. Lactobacillus paracasei is a key member of the Lactobacillus genus and is one of the "three major probiotics for human health." Years of research have shown that the main functions of Bifidobacterium and Lactobacillus paracasei include maintaining and improving the stability of the intestinal microbiome, promoting digestion and absorption, producing antimicrobial substances, inhibiting the growth of some pathogens, reducing inflammatory responses, enhancing immune function, delaying aging, fighting tumors, lowering cholesterol, and promoting host health. However, because Bifidobacterium is a strict anaerobic bacterium, it is difficult to maintain a high level of viable bacteria in preparations for a long time. During the fermentation process of Lactobacillus paracasei, post-acidification is severe, and the accumulation of lactic acid to high levels will produce an autoinhibitory effect, which has plagued the development and storage of Bifidobacterium and Lactobacillus paracasei preparations. Summary of the Invention
[0006] The present invention aims to provide a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, and a preparation method and application thereof, so as to solve the problems of scarcity of excellent bacterial strain resources in my country, high cost and low efficiency in strain selection and improvement, and to provide a fusion strain having the excellent traits of both Bifidobacterium and Lactobacillus paracasei.
[0007] To achieve the above object, the present invention provides a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, the fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis is Lactobacillus paracasei PL-35, Lactobacillus paracasei is classified and named (Lacticaseibacillus paracasei), and is deposited in the General Microbiology Center of China Culture Collection of Microorganisms on July 8, 2024, with the deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.31228; Lactobacillus paracasei PL-35 is prepared from Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11.
[0008] A food comprising the above-mentioned Lactobacillus paracasei and Bifidobacterium adolescentis fusion strain, wherein the viable cell count concentration of the Lactobacillus paracasei and Bifidobacterium adolescentis fusion strain in the food is not less than 1×10 7 CFU / mL.
[0009] Preferably, the food is fermented milk.
[0010] A method for preparing the above-mentioned fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, comprising the following steps:
[0011] S1. Protoplast preparation: Lactobacillus paracasei and Bifidobacterium adolescentis strains cultured to the logarithmic growth phase were collected, washed and resuspended in a protoplast preparation solution, and then enzymatically hydrolyzed with lysozyme. After the enzymatic hydrolysis was completed, the enzyme solution was removed, and the strains were washed and resuspended again with a protoplast preparation solution;
[0012] S2. Inactivation of protoplasts: The protoplasts obtained in S1 are inactivated by UV inactivation or heat inactivation;
[0013] S3, protoplast fusion: Take equal amounts of inactivated protoplasts obtained in S2 and mix them to obtain mixed solution A. After mixing, add PEG 6000 to obtain mixed solution B, and perform fusion in a water bath;
[0014] The protoplast preparation solution in S1 was a mixture of 0.2 mmol / L PBS buffer and 0.8 mol / L mannitol;
[0015] The concentration of mixed solution B in S3 was 40% of that of mixed solution A, and the conditions for water bath fusion were 37°C for 7 min;
[0016] PEG6000 contains 0.02 mol / L CaCl2·2H2O and 0.02 mol / L MgCl2·H2O.
[0017] Preferably, the conditions for ultraviolet inactivation in S2 are: preheating the ultraviolet lamp for 30 minutes, and irradiating the protoplast preparation solution containing protoplasts under the ultraviolet lamp for no less than 210 seconds.
[0018] Preferably, the heat inactivation condition in S2 is: keeping the protoplast preparation solution containing the protoplasts at 40-50° C. for 30 minutes.
[0019] Preferably, the enzyme concentration of Bifidobacterium adolescentis in S1 is 0.75 mg / mL, the enzyme concentration of Lactobacillus paracasei is 1 mg / mL, and the enzymolysis time is 30 min.
[0020] Therefore, the present invention provides a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, and its preparation method and application, and its specific technical effects are as follows:
[0021] (1) The method provided by the present invention was used to successfully prepare a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis. The prepared fusion strain obtained a new morphology, which was straighter and arranged in a chain; a new carbon source, L-proline, which could be utilized by both parents, was not available; the inhibitory effect on three pathogenic bacteria, Salmonella enteritidis, Staphylococcus aureus, and Escherichia coli, was significantly higher than that of the two parents; and the fusion strain had the advantages of both parents, being tolerant to both vancomycin and mupirocin lithium, and having the same sensitivity to 12 antibiotics and adaptability to growth conditions as the parent PC-92.
[0022] (2) The fusion strain PL-35 of Lactobacillus paracasei and Bifidobacterium adolescentis prepared by the present invention has good fermentation characteristics. The pH is 4.51 at the end of fermentation, 4.05 after 28 days of storage, the titer is 114°T, and the viable cell count can still be maintained at 1×10 7 CFU / mL and above, which are all within the optimal drinking range specified by national standards; the viscosity value shows an upward trend with the extension of storage period. After 28 days of storage, the viscosity value is 2260mPa·s, the hardness is 37.462g, and the consistency is 282.04g·s. The storage quality is excellent and can be used for the development and application of dairy products;
[0023] (3) The present invention optimizes the preparation method conditions and obtains the optimal parameter combination for preparing the fusion strain of Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11. The obtained protoplasts have strong regeneration ability, high vitality, and high fusion rate, providing experimental data support for the protoplast fusion technology in the selection of excellent lactic acid bacteria strains. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0025] Figure 1 The effect of lysozyme concentration on the formation rate and regeneration rate of protoplasts in Example 1 of the present invention;
[0026] Figure 2 The effect of enzymatic hydrolysis time on the formation rate and regeneration rate of protoplasts in Example 1 of the present invention;
[0027] Figure 3 This is a photo of the fusion process of Bifidobacterium adolescentis and Lactobacillus paracasei in Example 1 of the present invention, wherein A is Lactobacillus paracasei and B is Bifidobacterium adolescentis;
[0028] Figure 4 This is a gel electrophoresis diagram of the PCR products during the verification of the fusion gene level in Example 1 of the present invention; wherein M represents Maker, 1-8 are the PCR amplification results using the universal primers for Lactobacillus as templates, 9 and 19 are negative controls, 10 and 20 are positive parent controls, and 11-18 are the PCR amplification results using the primers for Bifidobacterium as templates;
[0029] Figure 5The following are photos of the colony morphology (A) and cell morphology (D) of the PC-92 strain, the colony morphology (B) and cell morphology (E) of the L6R11 strain, and the colony morphology (C) and cell morphology (F) of the fusion strain PL-35 in Example 1 of the present invention;
[0030] Figure 6 The growth of the strains in Example 1 of the present invention is shown in Figure 1, when MRS was supplemented with mupirocin lithium (A), vancomycin (B), both mupirocin lithium and vancomycin (C), and no antibiotics (D).
[0031] Figure 7 These are the growth kinetics curves of PC-92, L6R11, and the fusogen in Example 2 of the present invention in A-arabinose (A), L-proline (B), and D-ribose (C);
[0032] Figure 8 This is the growth kinetics curve of PC-92, L6R11 and 8 fusion strains in Example 2 of the present invention at pH 9.5;
[0033] Figure 9 is the viable cell count of PC-92 and fusion product PL-35 in Example 5 of the present invention;
[0034] Figure 10 is the change of pH (A) and titratable acidity (B) of PL-35 during storage in Example 6 of the present invention;
[0035] Figure 11 is the change in viable bacterial count of PL-35 during storage in Example 6 of the present invention;
[0036] Figure 12 is the change in water holding capacity of PL-35 during storage in Example 6 of the present invention;
[0037] Figure 13 is the change in viscosity of PL-35 during storage in Example 6 of the present invention;
[0038] Figure 14 The texture changes of PL-35 in Example 6 of the present invention during storage; wherein A is the viscosity index inspection result; B is the cohesion inspection result; C is the consistency inspection result; and D is the hardness inspection result. DETAILED DESCRIPTION
[0039] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0040] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.
[0041] The instruments, equipment, and reagents used in the examples were all commercially available. Methods not described in detail in the examples are conventional techniques in the art. Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11 were obtained from the Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University, and Salmonella enterica (CICC 10982), Bacillus cereus (CICC 10277), and Escherichia coli (CICC 23657) were obtained from the Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University.
[0042] Example 1
[0043] Preparation of a fusion of Bifidobacterium adolescentis and Lactobacillus paracasei, the specific steps are as follows:
[0044] S1. Prepare culture medium and reagents.
[0045] Regeneration solid culture medium: Add 25 g gelatin, 20 mmol / LMgCl2, and 0.5 mol / L sucrose to MRS agar medium (without Tween 80).
[0046] Protoplast preparation solution: 0.2 mmol / L PBS buffer (19 mL 0.2 mmol / L NaH2PO4 solution, 81 mL 0.2 mmol / L Na2HPO4 solution), 0.8 mol / L mannitol.
[0047] Enzyme solution: Prepare 10 mg / mL lysozyme stock solution using protoplast preparation solution, sterilize by filtration using a filter membrane, dispense into 2 mL centrifuge tubes, and store at -80°C until use.
[0048] Polyethylene glycol (PEG6000) solution: Weigh 30.0 g of polyethylene glycol and gradually dissolve it into the protoplast preparation solution. At the same time, add 0.02 mol / L CaCl2·2H2O and 0.02 mol / LMgCL·H2O to make up to 100 ml. Autoclave at 121°C for 15 minutes.
[0049] S2. Activate the strains. Use an inoculating loop to streak Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11 (stored at -80°C) onto MRS solid plates. Incubate in a 37°C incubator for 48 hours. Then, pick a single pure colony from the plate and inoculate it into 4.5 mL of MRS liquid medium. Incubate at 37°C for 24 hours, then subculture and incubate for another 24 hours.
[0050] S3. Prepare protoplasts.
[0051] (1) Investigate the effect of enzyme concentration on protoplast preparation and determine the optimal enzyme concentration.
[0052] After the strain was cultured to the logarithmic growth phase, the cells were collected by centrifugation, and then washed twice with protoplast preparation solution, resuspended in protoplast preparation solution, centrifuged again, and then an appropriate amount of lysozyme was added to make the lysozyme concentrations of 5 mg / mL, 7.5 mg / mL, and 10 mg / mL, respectively. The cell walls were removed by enzymatic hydrolysis in a 37°C water bath for 30 min. After the treatment, the enzyme solution was immediately removed by centrifugation, and the cells were washed twice with protoplast preparation solution. Finally, the protoplasts were resuspended in protoplast preparation solution to obtain protoplast fluid.
[0053] The protoplast formation rate was calculated using the following formula (1), and the protoplast regeneration rate was calculated using formula (2). The results are as follows: Figure 1 As shown, the optimal enzyme concentration of Bifidobacterium adolescentis L6R11 is 0.75 mg / mL, and the optimal enzyme concentration of Lactobacillus paracasei PC-92 is 1 mg / mL.
[0054]
[0055] Among them, A-colony count of bacterial suspension on MRS solid medium; B-colony count of protoplast fluid on MRS solid medium; C-colony count of protoplast fluid on regeneration solid medium.
[0056] (2) Investigate the effect of enzymatic hydrolysis time on protoplast preparation and determine the optimal enzymatic hydrolysis time.
[0057] After the strain is cultured to the logarithmic growth phase, centrifuge to collect the bacteria, then use the protoplast preparation solution to wash the bacteria twice, then resuspend in the protoplast preparation solution, centrifuge again, and then add lysozyme to make the lysozyme concentration 1mg / mL. The bacterial solution is treated in a 37℃ water bath for 30min, 60min, and 120min respectively to remove the cell wall. After the treatment is completed, the enzyme solution is immediately centrifuged to remove it, and it is washed twice with the protoplast preparation solution. Finally, the protoplast solution is resuspended in the protoplast preparation solution. The protoplast formation rate and regeneration rate are calculated using formula (1) and formula (2), respectively. The results are as follows: Figure 2 As shown in the figure, the optimal enzymatic hydrolysis time is 30 min.
[0058] S4. Optimization of protoplast inactivation conditions.
[0059] (1) Optimization of UV inactivation conditions. Preheat the UV lamp for 30 min to stabilize the UV lamp irradiation intensity. Take 1 mL of the protoplast preparation solution containing protoplasts and irradiate it under the UV lamp for 90 s, 210 s, 360 s, and 600 s. Perform gradient dilutions of the protoplast preparation solution containing protoplasts with different treatments, then spread it on the regeneration solid culture medium plate and culture it in a 37°C incubator for 48 h.
[0060] The inactivation rate was calculated using formula (3).
[0061] Wherein, A is the number of colonies of the protoplast preparation liquid of inactivated protoplasts on the regeneration solid culture medium; B is the number of colonies of the protoplast preparation liquid of non-inactivated protoplasts on the regeneration solid culture medium.
[0062] The results are shown in Table 1. Extended UV irradiation time resulted in a gradual increase in the inactivation rate of protoplasts. When the UV irradiation time reached 210 seconds, the inactivation rate reached 99.99%, indicating that the protoplasts were completely inactivated. Therefore, 210 seconds was selected as the optimal UV inactivation time.
[0063] Table 1
[0064] UV irradiation time (s) 90 210 360 600 Inactivation rate (100%) 64 99.99 100 100
[0065] (2) Optimization of heat inactivation conditions. The protoplast preparation solution containing protoplasts was incubated at 50°C, 70°C, and 90°C for 10 min, and the protoplast preparation solution containing protoplasts with different treatments was diluted in a gradient manner. The solution was then spread on a regeneration solid culture medium plate and cultured in a 37°C incubator for 48 h.
[0066] The inactivation rate was calculated using formula (3). The results are shown in Table 2. As the temperature increased, the inactivation rate gradually showed an increasing trend, reaching 99.96% at 50°C, indicating that the protoplasts were almost completely inactivated at 50°C. Therefore, it is effective to select 50°C as the heat inactivation temperature.
[0067] Table 2
[0068] Inactivation temperature (℃) 50 70 90 Inactivation rate (100%) 99.96 100 100
[0069] Determination of the optimal time for heat inactivation. Take 1 mL of protoplast preparation solution containing protoplasts respectively and keep it warm at 50°C for 30 min, 40 min, 50 min and 60 min respectively. The protoplast preparation solution containing protoplasts with different treatments is diluted in a gradient manner, then spread on a regeneration solid culture medium plate and cultured in a 37°C incubator for 48 h. The inactivation rate is calculated using formula (3). The results are shown in Table 3. The heat inactivation time also has a certain effect on the protoplasts. At 30 min, the protoplasts are almost completely inactivated, with an inactivation rate of 99.98%. Therefore, 30 min is selected as the heat inactivation time when performing heat inactivation treatment. In order to ensure the accuracy of subsequent experiments and ensure that the protoplasts are killed, it is necessary to strictly control the inactivation time and temperature.
[0070] Table 3
[0071] Heat inactivation time (min) 30 40 50 60 Inactivation rate (100%) 99.98 100 100 100
[0072] S5. Optimization of protoplast fusion conditions.
[0073] (1) Determine the optimal PEG concentration. Take 1 mL of inactivated protoplast fluid of Lactobacillus paracasei PC-92 and 1 mL of protoplast fluid of Bifidobacterium adolescentis L6R11, respectively, mix them, centrifuge to remove the supernatant, add 2 mL of 300 g / L, 400 g / L, and 500 g / L PEG6000 (containing 0.02 mol / L CaCl2·2H2O and 0.02 mol / L MgCl2·H2O), mix well, and incubate in a 37°C water bath for 7 min. Finally, spread the mixture on a regeneration solid culture medium containing mupirocin lithium salt (50 μg / mL) and culture at 37°C for 3 days before counting.
[0074] The fusion rate was then calculated according to formula (4). The results are shown in Table 4. The optimal PEG concentration is 40%, where 300 g / L×100%=300 / 1000×100%=30%.
[0075]
[0076] Table 4
[0077] PEG concentration (%) 30 40 50 <![CDATA[Fusion rate (10 -8 )]]> 6.5 7.9 5.8
[0078] (2) Determine the optimal fusion time.
[0079] 1 mL of inactivated protoplast fluid from Lactobacillus paracasei PC-92 and 1 mL of protoplast fluid from Bifidobacterium adolescentis L6R11 were mixed, centrifuged, and the supernatant removed. 2 mL of 400 g / L PEG 6000 (containing 0.02 mol / L CaCl2·2H2O and 0.02 mol / L MgCl2·H2O) was added to each solution and mixed thoroughly. The mixture was then incubated in a 37°C water bath for 5, 7, 10, and 15 minutes, respectively. Finally, the mixture was applied to a regeneration solid medium containing mupirocin lithium salt (50 μg / mL) and cultured at 37°C for 3 days before the total number of colonies was counted. The fusion rate was calculated using Equation (4). The results are shown in Table 5, indicating that the optimal fusion time was 7 minutes.
[0080] Table 5
[0081] Fusion time (min) 5 7 10 15 <![CDATA[Fusion rate (10 -8 )]]> 5.6 7.9 7.2 6.7
[0082] (3) Determine the optimal fusion temperature.
[0083] 1 mL of inactivated protoplast fluid from Lactobacillus paracasei PC-92 and 1 mL of protoplast fluid from Bifidobacterium adolescentis L6R11 were mixed, centrifuged, and the supernatant removed. 2 mL of 400 g / L PEG 6000 (containing 0.02 mol / L CaCl2·2H2O and 0.02 mol / LM MgCl2·H2O) was added to each solution and mixed thoroughly. The mixture was then incubated at 4°C, 28°C, 37°C, and 42°C for 7 minutes. Finally, the mixture was spread onto a regeneration solid medium containing mupirocin lithium (50 μg / mL) and incubated at 37°C for 3 days before counting the total number of colonies.
[0084] Then the fusion rate was calculated according to formula (4). The results are shown in Table 6. The optimal fusion temperature was 37°C.
[0085] Table 6
[0086] Fusion temperature (℃) 4 28 37 42 <![CDATA[Fusion rate (10 -8 )]]> 7.2 6.9 7.9 7.5
[0087] As can be seen from Tables 4 to 6, the optimal fusion conditions for protoplasts are: 40% PEG as a fusogen, 37°C water bath for 7 min.
[0088] Furthermore, studies on fusion time revealed that a 7-minute fusion time yielded a higher fusion rate. If the time is too short, PEG fails to effectively promote fusion, while if the time is too long, the fusion rate decreases, likely due to PEG's toxicity to protoplasts. Therefore, choosing a 7-minute fusion time allows for a deeper understanding of the impact of time on fusion rates, which will help uncover key factors in the fusion process.
[0089] The results of the temperature experiment showed that the protoplast fusion rate did not increase with increasing fusion temperature. This suggests that within a certain range, temperature has little effect on fusion. In summary, the optimal protoplast fusion conditions are: 40% PEG as a fusogen, in a 37°C water bath for 7 minutes. This experimental result provides experimental data support for related research and lays a solid foundation.
[0090] Methylene blue staining can be used to observe the fusion process of protoplasts. Figure 3 As shown in the optical microscope (×1000), two protoplasts can be seen to exist at the same time and to be in contact with each other, wherein A is Lactobacillus paracasei and B is Bifidobacterium adolescentis.
[0091] S6. Genetic verification of the fusion product.
[0092] The parent strain, Lactobacillus paracasei, used universal primers for Lactobacillus, with the forward primer sequence shown in SEQ ID NO. 1 and the reverse primer sequence shown in SEQ ID NO. 2. The parent strain, Bifidobacterium adolescentis, used universal primer sequences for Bifidobacterium, with the forward primer sequence shown in SEQ ID NO. 3 and the reverse primer sequence shown in SEQ ID NO. 4. A successfully fused subgenome should contain both DNA sequences from Lactobacillus paracasei and Bifidobacterium adolescentis.
[0093] SEQ ID NO.1:GGTAWYYAACYAGAAAGTCAC
[0094] SEQ ID NO.2:CTGAGAHMRGCTTTCAGAGAT
[0095] SEQ ID NO.3:GAAAGAAGAAGGCCACCAAGTAA
[0096] SEQ ID NO.4:GGTAAGAGTCGGACGCTGTGCAATAA
[0097] The extracted fusion product genomic DNA was used as a template and PCR amplification was performed using the primers shown in SEQ ID NO.1 to SEQ ID NO.4. Water was used as a negative control and the parent was used as a positive control. The amplification system for the PCR reaction was: 1.5 μL each of the forward and reverse primers (10 μM), 4 μL of dNTPs, 10× buffer (amplification buffer, containing Mg 2+ions) 5 μL, r-Taq enzyme (Taq DNA polymerase) 0.5 μL, DNA template (100 ng / μL) 2 μL, ddH2O 35.5 μL. PCR amplification conditions: initial denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 58°C for 1 min, extension at 72°C for 2 min, 30 cycles of denaturation, annealing, and extension; terminal extension at 72°C for 10 min; PCR products were terminated at 4°C and stored.
[0098] The results are as follows Figure 4 As shown, bands were obtained in the products of PCR amplification using Lactobacillus primers and Bifidobacterium primers, and the negative control had no amplification product band, while the positive control amplification product band was clear, indicating that the fusion product had both parental genes and was successfully prepared.
[0099] S7. Analyze the physiological characteristics of the fusogens.
[0100] (1) Morphological analysis of fusogens.
[0101] The fusion product PL-35 was selected for subsequent experiments. The photo of the fusion product colony grown on solid MRS medium for 48 hours is shown in the figure below. Figure 5 As shown, part A is PC-92, part B is L6R11, and part C is PL-35 fusion. The colonies of PC-92 and PL-35 are milky white with neat edges and produce stringy mucus, while the colonies of L6R11 are extremely small and white.
[0102] The colonies on the solid MRS medium were picked for Gram staining and observed under an optical microscope at ×1000. Figure 5 Figure 5 shows sections D-F of the fusion strain. Section D represents PC-92, section E represents L6R11, and section F represents the PL-35 fusion strain. All three strains were Gram-positive. PC-92 cells were curved rod-shaped and arranged singly; L6R11 cells showed irregular morphology, with some showing a typical Y-shape; and PL-35 cells showed straight morphology and arranged in chains.
[0103] (2) Investigate the growth of strains under different antibiotic conditions.
[0104] During the fusion process, numerous colonies are produced. Adding antibiotics can effectively eliminate strains that do not possess traits from both parents. Streak the fusion product onto solid MRS medium supplemented with antibiotics (50 μg / mL mupirocin lithium and 10 μg / mL vancomycin) and incubate for 48 hours for observation.
[0105] The results are as follows Figure 6As shown in the figure, parts AD are the growth of the strains in ordinary MRS medium with mupirocin lithium salt, vancomycin, mupirocin lithium salt and vancomycin added at the same time, and no antibiotics added. Figure 6 It can be seen that PC-92 can grow when vancomycin is added, but is intolerant to mupirocin lithium, and does not grow after adding both antibiotics at the same time; L6R11 does not grow when vancomycin is added, but grows when mupirocin lithium is added, indicating that it is intolerant to vancomycin and does not grow after adding both antibiotics at the same time; the fusion product PL-35 can grow when both vancomycin and mupirocin lithium are added, and grows normally when added at the same time, which shows that the fused strain is tolerant to both antibiotics at the same time, which may be due to changes in the genetic information of the fused strain.
[0106] Example 2
[0107] PM high-throughput phenotyping to identify the metabolism of the PL-35 strain. The specific steps are as follows:
[0108] To characterize the growth characteristics of strains under different environments, experiments were conducted using the OmniLog PM Phenotyping System. Carbon source metabolism was assessed using a PM 0196-well microplate, with each well containing a specific carbon source; osmotic pressure metabolism was assessed using a PM 0996-well microplate, with each well containing a specific osmotic pressure; and pH metabolism was assessed using a PM 1096-well microplate, with each well containing a specific pH. Aside from bacterial culture, the experimental procedures and inoculum preparation were carried out according to the accompanying manual.
[0109] The main experimental procedures are as follows: A single colony of the target strain was isolated by streaking on an MRS solid plate. Using a disposable inoculating loop, cells from the single colony were picked from the MRS solid plate and placed into a sterile capped tube. The cell suspension was stirred to homogenize. The turbidity was measured to ensure a T of 81%. The cell suspension was then added to the prepared inoculum of PM 01, PM 09, and PM 10, mixed thoroughly, and inoculated into the corresponding microplates (100 μL / well). All PM microplates were incubated at 37°C for 72 hours in an OmniLog. The experiment was repeated three times.
[0110] (1) Fusion carbon source utilization.
[0111] The PM analysis kinetic curves of the fusion product PL-35 and its parents showed that the utilization of carbon sources by PL-35 was largely similar to that of its parent PC-92, but quite different from that of its parent L6R11. The carbon sources A-arabinose (A-Arabino), D-ribose (D-Xylose) and L-proline (L-Proline) were selected and measured under an automatic growth curve instrument for 48 hours to further verify the accuracy of the data. The verification results are as follows Figure 7As shown, the growth curve of PL-35 on L-proline was significantly different from that of the two parents.
[0112] Ma Ruifen et al. studied the carbon source utilization of the commercial Lactobacillus paracasei strain L. casei Zhang and found that it does not utilize D-ribose and L-proline (laboratory evolution study with continuous passage to 3000 generations [D]. Inner Mongolia Agricultural University, 2015). However, the fusion product PL-35 provided by the present invention has less restriction on growth and metabolic capacity, and a wider variety of raw materials can be selected during fermentation.
[0113] (2) Fusion pH.
[0114] The PM analysis kinetic curves of the fusion product PL-35 and the parent showed that both the fusion product and the parent can grow at pH 8.5-9.5. The growth kinetic curves of PL-35 and the parent PC-92 highly overlapped, but differed greatly from the parent L6R11. The data accuracy was further verified by measuring the growth curve at pH 9.5 for 48 hours under an automatic growth curve analyzer. The verification results are as follows Figure 8 As shown, this indicates that the fusion product and the parent can indeed grow under alkaline conditions without any difference.
[0115] (3) Osmotic pressure of the fusogen.
[0116] The results showed that both the fusion product and the parent could grow only in the presence of sodium dihydrogen phosphate and a neutral pH, and there was no difference between the strains.
[0117] Example 3
[0118] The antibacterial ability of the fusion product PL-35 was investigated. The specific steps are as follows:
[0119] The Oxford cup method was used to determine the inhibitory effects of the supernatants of the fusants PL-35, PC-92 and L6R11 on three pathogenic bacteria: Salmonella enterica CICC 10982, Staphylococcus aureus ATCC12600 and Escherichia coli CICC 23657.
[0120] The specific operation steps are as follows: PC-92, L6R11, and the fusion product PL-35 were cultured in MRS liquid medium at 37°C for 12 hours, then centrifuged (5000×g, 4°C, 10 minutes) and the supernatant was collected. The supernatant was filtered through a 0.22μm filter. The bacterial suspension concentration of Salmonella enterica (CICC 10982), Staphylococcus aureus (ATCC 12600), and Escherichia coli (CICC 23657) was adjusted to 10 6 Approximately 1% CFU / mL of indicator bacteria suspension was added to NA medium at a 1% inoculum volume, mixed thoroughly, and then plated onto sterile plates for incubation. Place a sterile Oxford cup in the NA medium and gently press. After solidification, add 100 μL of CFS to each well and incubate at 37°C for 18 hours. Measure the diameter of the inhibition zone. Prepare three replicates for each indicator bacteria to ensure accurate and reliable experimental results.
[0121] The results are shown in Table 7. PC-92, L6R11 and the fusion product PL-35 all have antibacterial ability against different pathogens. The fusion product PL-35 maintains the good antibacterial ability of its parent PC-92, and its antibacterial effect against the three pathogens is significantly higher than that of the two parents.
[0122] Table 7
[0123] strains Staphylococcus aureus Salmonella Enteritidis Escherichia coli PC-92 <![CDATA[24.43±0.25 b mm]]> <![CDATA[22.72±0.08 d mm]]> <![CDATA[20.57±0.33 e mm]]> L6R11 <![CDATA[5.12±0.257 f mm]]> <![CDATA[4.24±0.08 i mm]]> <![CDATA[5.25±0.142 j mm]]> PL-35 26.85±0.34amm <![CDATA[26.08±0.29 a mm]]> <![CDATA[21.57±0.42 b mm]]>
[0124] Note: Different lowercase letters represent significant differences among different strains (P < 0.05)
[0125] Zhang Qijin et al. conducted an antibacterial evaluation of the commercial Lactobacillus paracasei strain L. casei Zhang. The results showed that the inhibition zone of L. casei Zhang against Salmonella enterica was 13.28±2.09 mm, and against Escherchia coli was 12.22±2.01 mm (Study on Anti-Infection and Immune Synergy [D]. Inner Mongolia Agricultural University, 2006). The PL-35 fusion provided by the present invention showed significantly higher antibacterial activity against Salmonella enterica and Escherchia coli than the commercial L. casei Zhang strain.
[0126] Example 4
[0127] The antibiotic susceptibility of PC-92, L6R11, and PL-35 strains was assessed by measuring the minimum inhibitory concentration (MIC) of the strains in the presence of 12 different antibiotics, according to the international standard ISO 10932-2010. The specific steps are as follows:
[0128] (1) Preparation of antibiotics:
[0129] The antibiotics used are divided into two categories: water-soluble and water-insoluble. Water-soluble antibiotics are dissolved in LSM (90% IST + 10% MRS), while water-insoluble antibiotics need to be dissolved in the corresponding organic solvent (Rif is dissolved in methanol, Chl and Ery are dissolved in 95% ethanol, Tri is dissolved in glacial acetic acid, and Cip is dissolved in LSM). LSM liquid culture medium is then used as a diluent to dilute the dissolved antibiotic stock solution to prepare antibiotic dilution solutions with the corresponding concentration gradient.
[0130] (2) Activation and cultivation of strains:
[0131] The preserved PC-92, L6R11 and fusion product PL-35 were streaked twice on MRS solid medium, and single colonies were selected and picked, and mixed with 0.85% physiological saline. Then the concentration of the bacterial suspension was adjusted to make OD 625nm In the range of 0.16 to 0.2, the bacterial suspension was then diluted with LSM liquid culture medium, and the corresponding volume of bacterial suspension was added according to the corresponding antibiotics.
[0132] (3) Determination of minimum inhibitory concentration:
[0133] According to the international standard ISO 10932-2010, the minimum inhibitory concentration (MIC) of PC-92, L6R11, and the fusion strain PL-35 against 12 antibiotics (kanamycin sulfate, streptomycin sulfate, neomycin sulfate, clindamycin hydrochloride, tetracycline hydrochloride, ampicillin, linezolid, erythromycin, rifampicin, ciprofloxacin, chloramphenicol, and trimethoprim) was determined using the broth microdilution method. During the experiment, a sterile 96-well plate was used. 100 μL of antibiotic dilutions of varying concentrations (see Table 9) was added to wells 2 through 11, starting from the lowest concentration and increasing to the highest. To ensure the accuracy of the experimental data, a blank control was created in the first well of each row, with no bacterial suspension added, and a growth control was created in the 12th well, without antibiotic addition. The diluted bacterial suspension was then added to each well of the MIC plate, which was sealed and incubated at 37°C for 48 h. Three replicates were performed for each antibiotic concentration to ensure the accuracy of the results. Antibiotic resistance was determined according to the EFSA and international standards ISO 10932-2010 for Lactobacillus paracasei and Bifidobacterium.
[0134] Each strain was compared to the EFSA-published antibiotic resistance threshold for Lactobacillus paracasei, also known as the MIC. If the value exceeded the EFSA-published antibiotic resistance threshold, the strain was considered resistant; if the value was below or equal to the threshold, the strain was considered susceptible. Table 8 shows the susceptibility of PC-92, L6R11, and the fusion strain PL-35 to 12 different antibiotics. The resistance of the fusion strain PL-35 was consistent with that of PC-92, with the strain being sensitive to trimethoprim and tolerant to the other antibiotics.
[0135] Table 8
[0136] strains Str Kana Neo Cli Tet Amp Lin Ery Rif Cip Chl Tri PC-92 R R R R R R R R R R R S L6R11 R R R S R S R R R R R S PL-35 R R R R R R R R R R R S
[0137] Note: Antibiotic sensitivity: sensitive (S), resistant (R), streptomycin (Str), kanamycin (Kana), neomycin (Neo), clindamycin (Cli), tetracycline (Tet), ampicillin (Amp), linezolid (Lin), erythromycin (Ery), rifampicin (Rif), ciprofloxacin (Cip), chloramphenicol (Chl), trimethoprim (Tri).
[0138] Table 9
[0139]
[0140] Example 5
[0141] Investigate the growth of the strains under the same conditions. The specific steps are as follows:
[0142] To investigate the growth variations between the fusion strains and their parents, PC-92 and PL-35 were inoculated with the same inoculum size (2%, v / v) in MRS liquid medium. The cultures were then cultured in a 37°C incubator. To monitor growth, viable cell counts and pH values were measured every two hours throughout the growth process. This data provided a comprehensive understanding of the growth of the different strains under the same conditions.
[0143] Viable bacterial count determination: The viable bacterial count of the strain was determined using the plate count method. First, the bacterial solution at different time points was serially diluted with PBS buffer solution. 1 mL of the appropriate serial dilution solution was pipetted into a sterile culture dish. MRS solid culture medium was poured into the dish and cultured in a 37°C incubator. After 48 hours of incubation, individual colonies were counted.
[0144] The viable bacterial count and pH change values of the strains at different time points were used to draw curves to evaluate the fusion strain PL-35 and the parent PC-92. The results are as follows Figure 9 As shown, PC-92 and PL-35 exhibited similar growth trends, entering a logarithmic growth phase within 2-12 hours, followed by a slow change in viable cell count and a steady growth phase. The viable cell count of the fusion strain PL-35 was not significantly different from that of the parent strain at any time point (P>0.05). There was also no significant difference in pH values during growth between the two strains (P>0.05).
[0145] Example 6
[0146] To evaluate the fermentation characteristics of the strain, the specific steps are as follows:
[0147] After the skim milk was hydrated at 55-60℃ for 30min, it was homogenized at 65℃ and 20Mpa, sterilized at 95℃ for 5min, and cooled rapidly. 7 The inoculated strain is stirred and aliquoted, then placed in a 37°C incubator for incubation. When the fermented milk reaches the end of fermentation, it is stored at 4°C. During storage, the pH, titratable acidity, and viable bacterial count of the sample should be monitored. These indicators are measured on the day of storage (i.e., day 0), day 7, day 14, day 21, and day 28. Viscosity, texture, and water holding capacity are also measured on day 1 and day 28 to assess product quality.
[0148] (1) Evaluate the acid-producing ability of the fusates.
[0149] The acid production capacity of lactic acid bacteria was investigated by monitoring the pH and titratable acidity during the fermentation process. Figure 10As shown, the pH of fermented milk showed a downward trend. PL-35 had a pH of 4.51 at the end of fermentation and 4.05 at the end of storage. The optimal pH range for fermented milk during storage is 4.0-4.35. Therefore, the pH of fermented milk remained within the optimal drinking range during storage. The overall pH showed a significant downward trend, likely due to decreased lactic acid bacteria activity and insufficient acid production in the later stages of storage. The titratable acidity of the samples increased significantly during storage, reaching 114°T for PL-35 at the end of storage. The titratable acidity remained below 120°T, indicating that the product is well-accepted within this range.
[0150] (2) Determination of the number of viable bacteria in fermented milk.
[0151] The results are as follows Figure 11 As shown in Figure 2, the number of viable bacteria continued to decrease during the storage period, but after the end of storage, the number of viable probiotics could still be maintained at 1×10 7 A live bacteria count level above CFU / mL can effectively ensure that probiotics enter the human body in a sufficient amount of live bacteria to exert their probiotic effects.
[0152] (3) Determination of water holding capacity of fermented milk.
[0153] Water holding capacity refers to the amount of water in fermented milk, which directly affects its taste, texture, and shelf life. Fermented milk with a higher water holding capacity is more stable, while fermented milk with a lower water holding capacity will release whey, resulting in a rough texture.
[0154] The results are as follows Figure 12 As shown in the figure, the water holding capacity of PL-35 reached a maximum of 63.39% at the end of storage for 1 day, and then decreased to 60.27% at the end of storage for 28 days. The water holding capacity of the strains was within the range.
[0155] (4) Determination of the viscosity of fermented milk.
[0156] Viscosity is one of the important indicators for evaluating the flavor and quality of fermented milk. The viscosity value reflects whether the tissue state of the fermented milk is good, thereby judging the taste and texture of the product. Figure 13 As shown, the initial viscosity of the sample is low, but the viscosity shows an upward trend with extended storage, indicating that over time, under the action of lactic acid bacteria, the internal structure of the fermented milk may change, resulting in an increase in viscosity. The viscosity of PL-35 increased from 1003 MPa·s to 2260 MPa·s.
[0157] (5) Determination of texture characteristics of fermented milk.
[0158] For fermented milk, texture can reflect the overall quality of the product. Its evaluation indicators mainly include hardness, consistency, cohesion and viscosity index. Among them, hardness has a significant impact on the quality of yogurt. The higher the hardness value of fermented milk, the better the fermentation degree of the product, and the better the taste and quality of the product. Figure 14 As shown in the data, during storage, the texture hardness and consistency increased. The hardness of PL-35 increased by 37.462 g; the consistency of PL-35 increased by 282.04 g·s. This may be due to the shrinkage of the gel structure, which increased the strength of the gel and increased its indexes, while reducing the cohesiveness and viscosity index. The strain has good storage properties, indicating that it can be used in the development and application of dairy products.
[0159] Therefore, the method provided by the present invention was used to successfully prepare a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis. The prepared fusion strain obtained a new morphology, broadened the range of carbon source utilization, and had a significantly higher inhibitory effect on three pathogenic bacteria, Salmonella enteritidis, Staphylococcus aureus, and Escherichia coli, than the two parents. It also possessed the advantages of both parents and was resistant to both vancomycin and mupirocin lithium salt. It also had good fermentation characteristics. After 28 days of storage, the pH was 4.05, the titer was 114°T, and the viable cell count was still maintained at 1×10 7 The protoplasts obtained by the method have a CFU / mL concentration of above 2260 mPa·s, a viscosity of 2260 mPa·s, a hardness of 37.462 g, and a consistency of 282.04 g·s, all of which are within the optimal drinking range specified by national standards. The protoplasts have excellent storage quality and can be used for the development and application of dairy products. The protoplasts obtained by the provided preparation method have strong regeneration ability, high vitality, and high fusion rate, providing experimental data support for the selection of excellent lactic acid bacteria strains using protoplast fusion technology.
[0160] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, characterized in that The fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis is Lactobacillus paracasei ( Lacticaseibacillus paracasei ) PL-35, deposited on July 8, 2024 in the General Microbiology Center of China Culture Collection Administration, the address of the deposit unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.31228.
2. A food comprising the fusion strain PL-35 of Lactobacillus paracasei and Bifidobacterium adolescentis according to claim 1, characterized in that: The viable bacterial count concentration of the fusion strain PL-35 of Lactobacillus paracasei and Bifidobacterium adolescentis in the food is not less than 1×10 7 CFU / mL.
3. The food according to claim 2, characterized in that: The food is fermented milk.