Genetically engineered bacterium of high-yield heparosan and application of genetically engineered bacterium

Abstract

The invention discloses a high-yield heparosan gene engineering bacterium and application thereof, and belongs to the technical field of gene engineering and metabolic engineering. The invention discloses a high-yield heparosan genetically engineered bacterium which is prepared by the following steps: taking corynebacterium glutamicum BDH as an original strain, and knocking out a glucose-6-phosphate dehydrogenase gene and a lactic dehydrogenase gene; a fructose-1, 6-diphosphate aldolase gene is weakened; according to the invention, a transglutamine-6-phosphate fructose transaminase gene, a nucleoside diphosphate kinase gene, an NADH oxidase gene, a glutamine synthetase gene and a polyphosphate kinase gene are over-expressed. The gene engineering bacterium constructed by the invention can be used for producing 23.05 g / L of heparosan.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering and metabolic engineering, and more specifically to a genetic engineering bacterium with high heparosan production and application thereof. Background Art

[0002] Heparin is an anticoagulant drug expressed by mast cells in mammalian connective tissue. It is a natural glycosaminoglycan composed of uronic acid and glucosamine. Heparin plays a variety of roles in vertebrates, such as embryonic development, resistance to bacterial / viral infections (such as COVID-19), inflammatory response, and blood coagulation. With increasing global demand, heparin is expected to have a market share of more than $14 billion in the next 10 years. The anticoagulant effect of heparin is mainly achieved by forming a complex with antithrombin (AT) and promoting AT to inhibit activated coagulation factors. It can stimulate ATIII to mediate the inactivation of coagulation factor Xa. The chemical structure of heparin is generally composed of hexuronic acid and D-glucosamine units alternately connected by 1,4-glycosidic bonds, with irregular sulfonation modifications. The hexuronic acid unit is glucuronic acid (GlcA) or its isomer iduronic acid (IdoA), which may be 2-O-sulfonated, i.e. GlcA2S or IdoA2S. The N position of the D-glucosamine unit may have three different substitution forms: acetyl, sulfonic acid and unsubstituted, i.e. GlcNAc, GlcNS and GlcN. The 6-OH and 3-OH positions of the unit may also be sulfonic acid substituted, i.e. GlcNAc (6S), GlcNS (6S), GlcNS (3S) and GlcNS (3,6S). Because of the polydisperse sulfonic modification and structural changes on the heparin sugar chain, heparin may interact with many different bioactive genes and thus realize its bioactive function.

[0003] Heparosan is a disaccharide repeating unit formed by alternating glucuronic acid and glucosamine. Its polysaccharide backbone is similar to heparin, except that glucuronic acid is not isomerized to iduronic acid, and no corresponding sulfation modification is performed. So far, heparosan has been found in E. coli K5, E. coli Nissle1917, Avibacterium paragallinarum, and Pasteurella multocida type D, but E. coli K5 and E. coli Nissle1917 are used for fermentation production of heparosan, with yields of 15 g / L and 12.2 g / L, respectively. However, E. coli K5 is a pathogenic bacterium, and the heparosan produced is not suitable for direct use in medicinal research. It needs to undergo multiple rounds of mutations to reduce toxicity before it can be used. This increases the cost and difficulty of the research process. Based on this, the safe preparation of heparosan has become a current research hotspot.

[0004] Therefore, providing a genetically engineered bacterium with high heparosan production and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a genetically engineered bacterium with high heparosan production and application thereof. The genetically engineered bacterium is safe and non-toxic, can produce high heparosan by microbial fermentation, and has low production cost.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: Rational allocation of metabolic fluxes for recombinant Corynebacterium glutamicum BDH (see patent 201811190689.3) to achieve high yield of target products is a major challenge in metabolic engineering. The key metabolic node of the pentose phosphate pathway (PPP) and the heparosan biosynthesis pathway is glucose-6-phosphate (G6P). Glucose-6-phosphate dehydrogenase (encoded by zwf) catalyzes the oxidation of G6P to 6-phosphogluconolactone, which is then transferred to the PPP. By knocking out zwf, the competition for G6P and the consumption of precursors can be reduced, thereby effectively directing carbon flux to the synthesis of heparosan. Since cell growth and metabolism consume glucose, which hinders the production of heparosan, the direct competition between heparosan biosynthesis and central carbon metabolism for precursor supply severely limits the production of heparosan. In order to overcome this limitation and further improve the synthesis of heparosan, it is necessary to change the central metabolism and introduce more carbon flux to the heparosan biosynthesis pathway. In the glycolysis pathway, fba (encoding fructose-1, 6-bisphosphate aldolase) needs to be downregulated. Fructose-6-phosphate (F6P) is another key metabolic node for heparosan synthesis, connecting the glycolysis and heparosan synthesis pathways. Weakening the expression of fba can promote the synthesis of heparosan and improve the conversion rate of glucose. The present invention designs an antisense RNA (asfba) for fba weakening. In addition, lactic acid is mainly considered to be a by-product of heparosan synthesis. Therefore, the ldh (lactate dehydrogenase) gene was knocked out to further increase the yield of heparosan.

[0007] In the process of heterologous synthesis of heparosan by Corynebacterium glutamicum, many cofactors are required, such as NAD +, UDP, glutamine, ATP and acetyl CoA, etc. UDP is required in the synthesis of the two precursors of heparosan, UDP-GlcA and UDP-GlcNAc. Nucleoside diphosphate kinase catalyzes the reaction of UTP to UDP. Overexpression of nucleoside diphosphate kinase (ndk) is beneficial to the synthesis of UDP. The present invention finds that the reaction of fructose-6-phosphate to D-glucosamine-6-phosphate is the rate-limiting step in the synthesis of heparosan. Therefore, strengthening this reaction helps to promote the synthesis of the product. The core of the present invention is to strengthen the rate-limiting step by means of genetic engineering, synergistically strengthening the expression of glutamine-6-phosphate fructose transaminase (Glutamine-fructose-6-phosphate aminotransferase) GlmS and strengthening the expression of glutamine synthetase (Glutamine synthetase) glnA, thereby increasing the yield of recombinant Corynebacterium glutamicum heterologous production of heparosan.

[0008] At the same time, UTP-glucose-1-phosphate uridyltransferase (GalU) is a NADH-dependent enzyme. The core of the present invention is to oxidize NADH to NAD by heterologously expressing NADH oxidase nox (NADH oxidase). + . Intracellular ATP was enhanced by introducing a PPK-based ATP regeneration system. Rapid growth and heparosan production of Corynebacterium glutamicum require more ATP and higher dissolved oxygen. Polyphosphate kinase (PPK), encoded by ppk, catalyzes the reversible transfer of ATP to inorganic polyphosphate (polyP) with good economy.

[0009] A genetically engineered bacterium with high heparosan production, The genetically engineered bacteria uses Corynebacterium glutamicum BDH as a starting strain, and knocks out the glucose-6-phosphate dehydrogenase zwf gene and the lactate dehydrogenase ldh gene; Attenuation of the fructose-1, 6-bisphosphate aldolase fba gene; and / or Overexpression of the glutamine-6-phosphofructotransferase glms gene; and / or Overexpression of nucleoside diphosphate kinase ndk gene or NADH oxidase nox gene; and / or Overexpression of the glutamine synthetase glnA gene; and / or

[0010] Overexpression of polyphosphate kinase ppk gene.

[0011] Furthermore, the weakened fructose-1, 6-bisphosphate aldolase fba gene is weakened by antisense RNA (asfba) of fructose-1, 6-bisphosphate aldolase fba; the antisense RNA of fructose-1, 6-bisphosphate aldolase fba is derived from endogenous Corynebacterium glutamicum; The glutamine-6-phosphofructotransaminase glms gene is a glutamine-6-phosphofructotransaminase glms gene derived from Bacillus subtilis 168, referred to as bsglmS gene; The nucleoside diphosphate kinase ndk gene is a nucleoside diphosphate kinase ndk gene derived from endogenous Corynebacterium glutamicum; The NADH oxidase nox gene is a NADH oxidase nox gene derived from Lactobacillus brevis NCTC13768; The glutamine synthetase glnA gene is derived from endogenous Corynebacterium glutamicum or Lactobacillus acidophilus ATCC4356, which are abbreviated as cgglnA and laglnA genes, respectively; The polyphosphate kinase ppk gene is a polyphosphate kinase ppk gene derived from endogenous Corynebacterium glutamicum, Escherichia coli K12 or Rhodobacter sphaeroides KD131, which are respectively abbreviated as cgppk, ecppk and rspppk genes.

[0012] Furthermore, the nucleotide sequence of the antisense RNA of fructose-1, 6-bisphosphate aldolase fba derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.19; The nucleotide sequence of the glutamine-6-phosphofructotransaminase glms gene derived from Bacillus subtilis 168 is shown in SEQ ID NO.28; The nucleotide sequence of the nucleoside diphosphate kinase ndk gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.33; The nucleotide sequence of the exogenous NADH oxidase nox gene is shown in SEQ ID NO.47; The nucleotide sequence of the glutamine synthetase glnA gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.38; The nucleotide sequence of the glutamine synthetase glnA gene derived from Lactobacillus acidophilus ATCC4356 is shown in SEQ ID NO.43; The nucleotide sequence of the polyphosphate kinase ppk gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.52; The nucleotide sequence of the polyphosphate kinase ppk gene derived from Escherichia coli K12 is shown in SEQ ID NO.59; The nucleotide sequence of the polyphosphate kinase ppk gene derived from other exogenous genes is shown in SEQ ID NO.63.

[0013] Furthermore, the genetically engineered bacteria are used in the production of heparosan.

[0014] Furthermore, the genetically engineered bacteria are used to increase the yield of heparosan.

[0015] Furthermore, a method for producing heparosan is provided, which comprises fermenting the genetically engineered bacteria.

[0016] In addition to Corynebacterium glutamicum ATCC 13032 and genetically engineered strains based thereon, other strains of Corynebacterium glutamicum, Escherichia coli, Bacillus subtilis or lactic acid bacteria capable of producing heparosan and genetically engineered strains based thereon can also be used in the present invention after appropriate verification.

[0017] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a genetically engineered bacterium with high heparosan production and its application. The genetically engineered bacterium constructed by the present invention can produce 23.05 g / L of heparosan. DETAILED DESCRIPTION

[0018] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0019] LBHIS medium: peptone 5.0 g / L, yeast powder 2.5 g / L, NaCl 5.0 g / L, brain heart extract (BHI) 18.5 g / L, sorbitol 91.0 g / L. The corresponding LBHIS solid medium is supplemented with 1.8%-2% agar.

[0020] LBG medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, glucose 20.0 g / L.

[0021] EPO medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, glycine 30.0 g / L, Tween80 10.0 g / L.

[0022] 30% sucrose medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, sucrose 300.0 g / L.

[0023] 20% sucrose solid medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, sucrose 200.0 g / L, agar 15.0 g / L.

[0024] Fermentation medium: glucose 65.0 g / L, urea 5.0 g / L, corn extract 20.0 g / L, biotin 4×10 -4 g / L, VB1 4×10 -4 g / L, K2HPO4 1.0 g / L, KH2PO4 1.0 g / L, CaCl2•2H2O 29.4 mg / L, MgSO4•7H2O1.2325 g / L, trace element solution 0.2%.

[0025] Preparation method of trace element solution: weigh 1g FeSO4·7H2O, 1g MnSO4·H2O, 0.1g ZnSO4·7H2O, 0.2g CuSO4, 0.002g NiCl2·6H2O, add water to make up to 100 mL, then add 100 μl concentrated hydrochloric acid to adjust the pH, then filter the bacteria through a membrane, and add 0.2% to the fermentation medium system.

[0026] Example 1 (1) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, primers zwf-up-F / zwf-up-R were used to amplify zwf-up (as shown in SEQ ID NO.1), and primers zwf-down-F / zwf-down-R were used to amplify zwf-down (as shown in SEQ ID NO.2), thereby obtaining the upstream and downstream homologous arms of the zwf knockout.

[0027] The primer sequences are as follows: zwf-up-F: 5'-ATTCGAGCTCGGTACCCGGGGATCC GCAACCCCAGGTTCTTTG-3'; SEQ ID NO.3.

[0028] zwf-up-R: 5'-TGACCGTTGC GTTTGTCCAGCTGGAGGG -3; SEQ ID NO.4.

[0029] zwf-down-F: 5'-CTGGACAAAC GCAACGGTCACACCTGGC -3'; SEQ ID NO.5.

[0030] zwf-down-R: 5'-TAAAACGACGGCCAGTGCCAAGCTT TGGTGCGAACGATCTCCAG -3'; SEQ ID NO.6.

[0031] Gene amplification system: PrimestarMax (Takara) 25 μL, upstream and downstream primers 2 μL each, template 1 μL, ddH2O 20 μL.

[0032] Gene amplification program: pre-denaturation at 98 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 57 °C for 30 s, extension at 72 °C for 10 s / kb, 35 cycles; extension at 72 °C for 10 min.

[0033] The PCR products were subjected to agarose gel electrophoresis and product recovery to obtain gene fragments zwf-up and zwf-down.

[0034] The plasmid vector pk18mobsacb was linearized with primers pK18-zwf-F / pK18-zwf-R to obtain the pk-zwf vector. The specific primer sequences are as follows: pK18-zwf-F: 5'-AAGCTGGCACTGGCCGTCGTTTTA-3'; SEQ ID NO. 7.

[0035] pK18-zwf-R: 5'-GGATCCCCGGGTACCGAGCTCGAAT-3'; SEQ ID NO. 8.

[0036] Add 3 μL zwf-up, 3 μL zwf-down, 4 μL pK-zwf vector and 10 μl Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL.

[0037] The total 20 μl ligation system of Gibson ligation was transformed into E. coli Trans10 commercial competent cells (Beijing Quanshijin Biotechnology) for culture. The transformation process was strictly carried out according to the instructions: after culturing at 37 °C for 1 h, the plate was spread on LB plates (containing 50 μg / mL kanamycin), and then cultured at 37 °C for another 12 h, and 10-20 single colonies were selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were zwf-up-F / zwf-down-R.

[0038] A correct single colony was selected and named Escherichia coli EC001, and the plasmid was named pK18-zwf. After multiplication and plasmid extraction, the pK18-zwf plasmid was obtained and electroporated into the competent cell of Corynebacterium glutamicum ATCC13032.

[0039] The competent cells of Corynebacterium glutamicum ATCC13032 were prepared as follows: the glycerol-preserved strain of Corynebacterium glutamicum ATCC13032 was streaked on an LBHIS plate, and cultured in a 30°C incubator until the colonies were clear. The colonies were picked from the plate and inoculated into LBHIS liquid test tube culture medium for 12 h, and then the initial OD was calculated. 600 The OD value was about 0.3, and then the cells were inoculated into EPO medium. 600 The concentration of the plasmid was 0.9, and the bacterial solution was placed in a centrifuge tube, placed in an ice bath for 15 min, and centrifuged at 4500 rpm for 10 min to collect the bacteria (packed in 1.5 mL centrifuge tubes), and the bacteria were resuspended with 100 μL of pre-cooled 10% glycerol, and the above centrifugation was repeated three times. After washing, the bacteria were resuspended with 100 μL of 10% sterile glycerol, which was the competent cells of Corynebacterium glutamicum ATCC13032. The electroporation method was as follows: 4 μL of plasmid was added to each tube of competent cells and placed in an ice bath for 10 min. The mixed solution was transferred to a pre-cooled electroporation cup and electroporated at 1.8 kv, 5 ms, 50 μF, and 100 Ω. After the electroporation, 800 μL of LBHIS medium was added immediately, followed by a 46 ℃ water bath for 6 min, and then placed at 30 ℃ for 3 h, and then spread on a solid LBHIS plate containing 50 μg / mL kanamycin, and cultured at 30 ℃ for 36 h for verification.

[0040] For the knockout strain, several single colonies grown on the above plates should be selected for verification of the sacB gene. The verification primers are as follows: sacB-F: 5'-CTCAAGCGTTTGCGAAAGAAACG-3'; SEQ ID NO. 9.

[0041] sacB-R: 5'-GAGTCAGTGAACAGGTACCATTTGCC-3'; SEQ ID NO. 10.

[0042] The verified strain was inoculated into 30% sucrose medium and cultured for 24 h. After the bacterial solution became turbid, it was streaked onto 20% sucrose medium and verified using primers zwf-up-F / zwf-down-R. If the PCR fragment result was 2000 bp, it was confirmed to be the target gene knockout strain and could be kept for later use. It was named Corynebacterium glutamicum CG1.

[0043] (2) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, primers ldh-up-F / ldh-up-R were used to amplify ldh-up (as shown in SEQ ID NO.11), and primers ldh-down-F / ldh-down-R were used to amplify ldh-down (as shown in SEQ ID NO.12), thereby obtaining the upstream and downstream homology arms of the ldh knockout.

[0044] The primer sequences are as follows: ldh-up-F: 5'-gattacgaattc AAAACCCTGGTCACGGTGAATG -3'; SEQ ID NO.13.

[0045] ldh-up-R: 5'-GGGATCGAAA ATCTTTGGCGCCTAGTTGGC -3'; SEQ ID NO.14.

[0046] ldh-down-F: 5′-GGCGCCAAAGAT TTTCGATCCCACTTCCTGATTTCCC -3'; SEQ ID NO.15.

[0047] ldh-down-R: 5'-gtaccgagctc TTTCATACGACCACGGGCTACCC -3'; SEQ ID NO.16.

[0048] The plasmid vector pk18mobsacb was linearized with primers pK18-ldh-F / pK18-ldh-R to obtain the pk-ldh vector. The primer sequences are as follows: pK18-ldh-F: 5'-GTGGTCGTATGAAAgagctcggtacccgggga-3'; SEQ ID NO. 17.

[0049] pK18-ldh-R: 5'-CGTGACCAGGGTTTTgaattcgtaatcatgtcatagctgtttcctg-3'; SEQ ID NO. 18.

[0050] The gene amplification system and gene amplification procedure were the same as above to obtain ldh-up, ldh-down and pk-ldh vectors. The connection transformation verification method was the same as above to obtain Escherichia coli EC002. The plasmid was named pK18-ldh. After expansion and plasmid extraction, the pK18-ldh plasmid was obtained.

[0051] Plasmid pK18-ldh was electroporated into competent cells of Corynebacterium glutamicum CG1. Competent cell preparation, electroporation, sacB verification, and sucrose medium culture were the same as above, and the primers for ldh knockout verification were the above-mentioned ldh-up-F / ldh-down-R.

[0052] The strain that has been successfully knocked out of ldh by verifying the primers is inoculated into LBHIS liquid medium for culture, and streaked onto LBHIS solid medium plates for purification and re-verification. After confirmation, the strain can be preserved for use and named Corynebacterium glutamicum CG2.

[0053] (3) For the antisense RNA of fba (asfba), the genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template and the primers asfba-F / asfba-R were used to amplify the asfba fragment (as shown in SEQ ID NO. 19).

[0054] The primer sequences are as follows: asfba-F: 5'-TTCCTTCTGGCAGTGGTCAGTG-3'; SEQ ID NO. 20.

[0055] asfba-R: 5'-ATGCCTATCGCAACTCCCGAG-3'; SEQ ID NO. 21.

[0056] The plasmid vector pEC-XK99E-kfiA-kfiC (see patent 201811190689.3) was linearized with primers pEC-F1 / pEC-R1 to obtain the pEC-XK99E-kfiA-kfiC linear vector. The primer sequences are as follows: pEC-F1: 5'-CTCGGGGAGTTGCGATAGGCATAAGGAGGATATACATATGAACGCAGAATATATAAATTTAGTTGAACG-3'; SEQ ID NO. 22.

[0057] pEC-R1: 5'-CACTGACCACTGCCAGAAGGAAggtctgtttcctgtgtgaaattgtt-3'; SEQ ID NO. 23.

[0058] The gene amplification system and gene amplification procedure were the same as above. The asfba fragment and the pEC-XK99E-kfiA-kfiC linear vector were obtained. 3 μL of asfba fragment, 2 μL of pEC-XK99E-kfiA-kfiC linear vector and 5 μl of Gibson ligase were added to the PCR tube. The ligation temperature was 50 °C and the ligation time was 15 min. The total system was 10 μL.

[0059] The total 10 μl ligation system of Gibson ligation was transformed into E. coli Trans10 commercial competent cells (Beijing Quanshijin Biotechnology) for culture. The transformation process was strictly carried out according to the instructions: after culturing at 37 °C for 1 h, the plate was spread on LB plates (containing 50 μg / mL kanamycin), and then cultured at 37 °C for another 12 h, and 10-20 single colonies were selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were asfba-F / asfba-R.

[0060] A correct single colony was selected and named Escherichia coli EC003, and the plasmid was named pEC-XK99E-kfiA-kfiC-asfba. After expansion and plasmid extraction, the pEC-XK99E-kfiA-kfiC-asfba plasmid was obtained.

[0061] Plasmids pEC-XK99E-kfiA-kfiC-asfba and PXMJ19-kfiB-kfiD-hasB (see patent 201811190689.3) were electroporated into the competent cells of Corynebacterium glutamicum CG2. The competent cells were prepared as above. 2 μL of pEC-XK99E-kfiA-kfiC-asfba and PXMJ19-kfiB-kfiD-hasB were added to the competent cells of Corynebacterium glutamicum CG2, mixed gently, and placed on ice for 6 min. The mixture was then transferred into a pre-cooled 0.2 cm electroporation cup. The electroporation conditions were: 1.8 kV, 5 ms, 50 μF, 100 Ω. Immediately after the electroporation, add 800 μL of LBHIS medium preheated at 46 ℃, mix gently, then aspirate and place in a 1.5 mL centrifuge tube, place in a 46 ℃ water bath for 6 min, and then place at 30 ℃ for 3 h of recovery. After the recovery is complete, a certain amount of bacterial liquid is spread on 50 mg / mL kanamycin and 5 mg / mL chloramphenicol LBHIS solid medium, culture at 30 ℃ for 24-36 h, and the kana and cm genes of the single colonies grown are verified. Only the bacteria that can grow on the kana and chloramphenicol double-resistant plates and can amplify the kana and cm genes are the target strains. The verification primers are as follows: kana-F: 5'-ATGATTGAACAAGATGGATTGCACG-3'; SEQ ID NO. 24.

[0062] kana-R: 5'-TCAGAAGAACTCGTCAAGAAGGC-3'; SEQ ID NO. 25.

[0063] Cm-R: 5'-CCTGCCACTCATCGCAGTAC-3'; SEQ ID NO. 26.

[0064] Cm-F: 5'-ATGGAGAAAAAAATCACTGGATATACCACC-3'; SEQ ID NO. 27.

[0065] (4) Select a suitable positive clone and inoculate it into a 4 mL LBHIS medium test tube. After overnight culture, name it Corynebacterium glutamicum HS1 and store it in a -80 ℃ refrigerator. Fermentation verification of Corynebacterium glutamicum HS1 was performed in a 50 mL system.

[0066] The fermentation of Corynebacterium glutamicum HS1 is divided into three steps: ① Connect the test tubes: Take 100 μL of Corynebacterium glutamicum HS1 stored at -80°C, transfer it to a test tube containing 4 mL of LBHIS liquid culture medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and culture it at 30°C for 12 h-14 h.

[0067] ②Inoculum: Take out the test tube after 12-14 hours of culture, take 1 mL of the bacterial solution in the test tube and transfer it to 20 mL of LBG liquid culture medium (the container is a 100 mL unbaffled conical flask, containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol), and place it in a constant temperature shaker at 30°C and 200 rpm for 12-14 hours.

[0068] ③ Fermentation medium: The amount of seeds inoculated in 50 mL of fermentation broth (the container is a 250 mL baffled conical flask, and the fermentation medium contains 50 μg / mL kanamycin and 5 μg / mL chloramphenicol) is 5% of the total fermentation system, and the final concentration OD 600 The pH of the fermentation broth was adjusted to 0.3 with concentrated ammonia water, and the culture was placed in a constant temperature shaker at 30 °C and 200 rpm for 48 h (0.8 mM IPTG was added for induction at 2 h of culture), and the OD was detected at 48 h. 600 And the concentration of the target product heparosan.

[0069] 1) OD600 Detection: The fermentation liquid was injected into a cuvette, diluted 50 times with deionized water, and then the absorbance (600 nm) was measured with a UV spectrophotometer to measure the OD 600 .

[0070] 2) Determination of heparosan content The invention adopts the carbazole sulfate method to quantify heparosan, and indirectly quantifies heparosan by measuring the content of glucuronic acid. Heparosan will be hydrolyzed into glucuronic acid and glucosamine in the presence of concentrated sulfuric acid, wherein glucuronic acid reacts with a carbazole reagent to generate a purple-red substance, which is proportional to the content of glucuronic acid. The content of heparosan is determined by the proportion of glucuronic acid in the heparin precursor.

[0071] The specific determination method is as follows: take 1 mL of the treated sample to be tested into a colorimetric tube, slowly add 5 ml of borax sulfuric acid solution in an ice bath (weigh 0.954 g of Na2B4O7•10H2O reagent, add 100 mL of concentrated sulfuric acid to dissolve it), mix well and insert into an ice water bath to release heat, and after the heat release is completed, heat with boiling water for 10 minutes, and then cool the sample in an ice water bath. After cooling to room temperature, add 0.2 mL of carbazole reagent (weigh 0.125 g of carbazole reagent and dissolve it in 100 mL of anhydrous ethanol), mix well, and heat with boiling water for 15 minutes to color it. After the reaction is completed, wait for the sample to cool to room temperature and measure its OD 530 .

[0072] Determination of standard curve: Use volumetric flasks to accurately prepare glucuronic acid standard solutions with concentrations of 10, 20, 30, 40, and 50 mg / L, and use the above-mentioned carbazole sulfate method to determine the OD of each standard solution. 530 According to the measurement results, the concentration of glucuronic acid is used as the horizontal axis, and OD 530 Plot the standard curve as the ordinate.

[0073] OD of Corynebacterium glutamicum HS1 after 48h of fermentation 600 The results of heparosan content are shown in Table 1.

[0074] Table 1

[0075] Note: For BDH strain, see 201811190689.3.

[0076] Example 2 Using the genomic DNA of Bacillus subtilis 168 as a template, primers bsglmS-F and bsglmS-R were used to amplify the fragment bsglmS (as shown in SEQ ID NO. 28), and the bsglmS fragment derived from Bacillus subtilis 168 with seamless cloning homology arms connected to the plasmid was obtained.

[0077] The primer sequences are as follows: bsglmS-F: 5'-GTTGCGATAGGCATAAGGAGGATATACAT atgtgtggaatcgtaggttatatcg -3'; SEQ ID NO.29.

[0078] bsglmS-R: 5'-ttctctcatccgccaaaacagccCT ttactccacagtaacactcttcgcaag -3'; SEQ ID NO.30.

[0079] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba was linearized using primers PEC-F2 / PEC-R2 to obtain the pEC-XK99E-kfiA-kfiC-asfba linear vector. The primer sequences are as follows: PEC-F2: 5'-ggctgttttggcggatgagagaag-3'; SEQ ID NO. 31.

[0080] PEC-R2: 5'-ccacacatATGTATATCCTCCTTATGCCTATCGCAACTCCCG-3'; SEQ ID NO. 32.

[0081] The gene amplification system and gene amplification procedure are the same as in Example 1. The bsglmS fragment and the pEC-XK99E-kfiA-kfiC-asfba linear vector are obtained. 3 μl of the bsglmS fragment and 2 μl of the pEC-XK99E-kfiA-kfiC-asfba linear vector, as well as 5 μl of Gibson enzyme are added to the PCR tube. The connection and transformation method is the same as in Example 1. Several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are the above-mentioned bsglmS-F / bsglmS-R. The sequencing method is to pass the test. The bacterial solution with correct sequencing is extracted with plasmid to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS plasmid. The corresponding colony is named Escherichia coli EC004.

[0082] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS and PXMJ19-kfiB-kfiD-hasB were simultaneously electroporated into the competent cell of Corynebacterium glutamicum CG2. The experimental steps were the same as those in Example 1. The kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified at the same time. The strain in which both genes were verified to be correct was named Corynebacterium glutamicum HS2.

[0083] Corynebacterium glutamicum HS2 was fermented in a 50 mL shake flask, and the fermentation medium and fermentation operation were the same as in Example 1.

[0084] In a 50 mL shake flask fermentation, the OD of Corynebacterium glutamicum HS2 was 0.1767 W / m at 48 h. 600 was 39.7, producing 1076.3 mg / L of heparosan.

[0085] Example 3 Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the primers ndk-F / ndk-R were used to amplify the fragment ndk (as shown in SEQ ID NO. 33), thereby obtaining the ndk fragment derived from Corynebacterium glutamicum ATCC13032 with seamless cloning homology arms connected to the plasmid.

[0086] The primer sequences are as follows: ndk-F: 5′-TGGAAGGGTAA AAGGAGGATATACATATGACTGAACGTACTCTCATCCTTATCAAG -3'; SEQ ID NO.34.

[0087] ndk-R:5'- TTACAGGTTAGGGAACCAGATGGAGATCTC -3'; SEQ ID NO.35.

[0088] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS was linearized using primers PEC-F3 / PEC-R3 to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector. The primer sequences are as follows: PEC-F3: 5'-CCATCTGGTTCCCTAACCTGTAA agaaggccatcctgacggatggccttttgcgtctg ag -3'; SEQ ID NO.36.

[0089] PEC-R3: 5'-TTCAGTCATATGTATATCCTCCTTTTACCCTTCCACATTATACACTAATTCGAGGTTAA-3'; SEQ ID NO. 37.

[0090] The gene amplification system and gene amplification procedure are the same as in Example 1. The ndk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector are obtained. 3 μl of the ndk fragment and 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector are added to the PCR tube, and 5 μl of Gibson enzyme. The connection and transformation method is the same as in Example 1. Several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are the above-mentioned ndk-F / ndk-R. The sequencing method is to pass the test. The bacterial solution with correct sequencing is extracted with plasmid to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-ndk plasmid. The corresponding colony is named Escherichia coli EC005.

[0091] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-ndk and PXMJ19-kfiB-kfiD-hasB were simultaneously electroporated into the competent cell of Corynebacterium glutamicum CG2. The experimental steps were the same as those in Example 1. The kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified at the same time. The strain in which both genes were verified to be correct was named Corynebacterium glutamicum HS3.

[0092] Corynebacterium glutamicum HS3 was fermented in a 50 mL shake flask, and the fermentation medium and fermentation operation were the same as in Example 1.

[0093] In a 50 mL shake flask fermentation, the OD of Corynebacterium glutamicum HS3 was 0.1767 W / m at 48 h. 600 was 52.1, producing 1177.5 mg / L of heparosan.

[0094] Example 4 (1) Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the primers cgglnA-F / cgglnA-R were used to amplify the fragment cgglnA (as shown in SEQ ID NO. 38), thereby obtaining the cgglnA fragment derived from Corynebacterium glutamicum ATCC 13032 with seamless cloning homology arms connected to the plasmid.

[0095] The primer sequences are as follows: cgglnA-F: 5'-CACGTGATATTTTCCAGCGTGACTAAAAGGAGGATATACATatggtggcgtttgaaaccc-3'; SEQ ID NO. 39.

[0096] cgglnA-R: 5'-gccaagctgaattcgatcctctaga ttgcagtcgaagtacaattcgaattc -3'; SEQ ID NO.40.

[0097] The plasmid vector PXMJ19-kfiB-kfiD-hasB was linearized using primers PX-F1 / PX-R1 to obtain the PXMJ19-kfiB-kfiD-hasB linear vector. The primer sequences are as follows: PX-F1: 5'-tctagaggatcgaattcagcttggc-3'; SEQ ID NO. 41.

[0098] PX-R1: 5'-TTAGTCACGCTGGAAAATATCACGTG-3'; SEQ ID NO. 42.

[0099] The gene amplification system and gene amplification procedure are the same as in Example 1. The cgglnA fragment and the PXMJ19-kfiB-kfiD-hasB linear vector are obtained. 3 μl of the cgglnA fragment and 2 μl of the PXMJ19-kfiB-kfiD-hasB linear vector, as well as 5 μl of Gibson enzyme are added to the PCR tube. The ligation and transformation method is the same as in Example 1. Several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are cgglnA-F / cgglnA-R, and the sequencing method is to pass through. The plasmid is extracted from the bacterial solution with correct sequencing to obtain the PXMJ19-kfiB-kfiD-hasB-cgglnA plasmid.

[0100] (2) Using the genome of Lactobacillus acidophilus ATCC4356 as a template, the primers laglnA-F / laglnA-R were used to amplify the fragment laglnA (as shown in SEQ ID NO.43), thereby obtaining the laglnA fragment derived from Lactobacillus acidophilus ATCC4356 with seamlessly cloned homology arms connected to the plasmid.

[0101] The primer sequences are as follows: laglnA-F: 5'-ACACGTGATATTTTCCAGCGTGACTAAAAGGAGGATATACAT atgagtaaacaata cactgcag -3'; SEQ ID NO.44.

[0102] laglnA-R:5'- atcctctaga ttaccagttcatgtaacgttgacgttccc-3'; SEQ ID NO. 45.

[0103] The plasmid vector PXMJ19-kfiB-kfiD-hasB was linearized with primers PX-F2 / PX-R1 to obtain the PXMJ19-kfiB-kfiD-hasB2 vector. The primer sequences are as follows: PX-F2: 5'-gaactggtaatctagaggatcgaattcagcttggctgttttgg-3'; SEQ ID NO. 46.

[0104] PX-R1: Same as above.

[0105] The gene amplification system and gene amplification procedure are the same as in Example 1. The laglnA fragment and the PXMJ19-kfiB-kfiD-hasB2 linear vector are obtained. 3 μl of the laglnA fragment and 2 μl of the PXMJ19-kfiB-kfiD-hasB2 linear vector and 5 μl of Gibson enzyme are added to the PCR tube. The ligation and transformation method is the same as in Example 1. Several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are the above-mentioned laglnA-F / laglnA-R. The sequencing method is to pass the test. The bacterial solution with correct sequencing is used to extract the plasmid to obtain the PXMJ19-kfiB-kfiD-hasB-laglnA plasmid.

[0106] The plasmid pEC-XK99E-kfiA-kfiC-asfba-bsglmS-ndk was electroporated simultaneously with PXMJ19-kfiB-kfiD-hasB-cgglnA and PXMJ19-kfiB-kfiD-hasB-laglnA into the competent cell of Corynebacterium glutamicum CG2, and the experimental steps were the same as those in Example 1. The kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified at the same time. The strains in which both genes were verified to be correct were named Corynebacterium glutamicum HS4 and Corynebacterium glutamicum HS5.

[0107] Corynebacterium glutamicum HS4 and Corynebacterium glutamicum HS5 were fermented in 50 mL shake flasks respectively, and the fermentation medium and fermentation operation were the same as in Example 1.

[0108] OD of Corynebacterium glutamicum HS4 and HS5 after 48h of fermentation 600 The results of heparosan content are shown in Table 2.

[0109] Table 2

[0110] The results in Table 2 showed that strain HS4 produced 1207.0 mg / L of heparosan in a 50 mL shake flask fermentation; strain HS5 produced 1220.0 mg / L of heparosan in a 50 mL shake flask fermentation.

[0111] (3) Corynebacterium glutamicum HS5 was fermented in a 50 mL shake flask system, and 2, 4, 6, and 8 g / L of sodium glutamate were added to the fermentation medium (Table 3).

[0112] Table 3

[0113] The results in Table 3 show that the heparosan yield was the highest when 6 g / L of sodium glutamate was added to the fermentation medium.

[0114] Example 5 The synthetic gene nox (as shown in SEQ ID NO.47) of BGI was used as a template and the primers nox-F / nox-R were used to amplify the fragment nox to obtain the nox fragment with seamless cloning homology arms connected to the plasmid.

[0115] The primer sequences are as follows: nox-F: 5'-gcgaagagtgttatactgtggagtaaAAGGAGGATATACAT atgaaagtcacagttgttgg ttgtac -3'; SEQ ID NO.48.

[0116] nox-R: 5'-ctctcatccgccaaaacagcc ttaagcgttaactgattgggcaactttc -3'; SEQ ID NO.49.

[0117] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS was linearized using primers PEC-F4 / PEC-R4 to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector. The primer sequences are as follows: PEC-F4: 5'-ggctgttttggcggatgagag-3'; SEQ ID NO. 50.

[0118] PEC-R4: 5'-actttcatATGTATATCCTCCTTttccacagtaacactcttcgcaag-3'; SEQ ID NO. 51.

[0119] The gene amplification system and gene amplification procedure are the same as in Example 1, and the nox fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector are obtained. 3 μl of the bsglmS fragment and 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector, as well as 5 μl of Gibson enzyme are added to the PCR tube. The ligation and transformation method is the same as in Example 1, and several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are the above-mentioned nox-F / nox-R, and the sequencing method is to pass through. The bacterial solution with correct sequencing is extracted with plasmid to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox plasmid.

[0120] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox and PXMJ19-kfiB-kfiD-hasB-laglnA were simultaneously electroporated into the competent cell of Corynebacterium glutamicum CG2. The experimental steps were the same as those in Example 1. The kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified at the same time. The strain in which both genes were verified to be correct was named Corynebacterium glutamicum HS6.

[0121] Corynebacterium glutamicum HS6 was fermented in a 50 mL shake flask system. The fermentation medium and fermentation operation were the same as in Example 1, and 6 g / L sodium glutamate was added to the fermentation medium.

[0122] In a 50 mL shake flask fermentation, the OD of Corynebacterium glutamicum HS6 was 0.1767 W / m at 48 h. 600 It was 42.6, producing 2060.7 mg / L of heparosan.

[0123] Example 6 (1) Using the genomic DNA of Corynebacterium glutamicum ATCC 13032 as a template, the primers cgppk-F / cgppk-R were used to amplify the fragment cgppk (as shown in SEQ ID NO. 52), thereby obtaining the cgppk fragment derived from Corynebacterium glutamicum ATCC 13032 with seamless cloning homology arms connected to the plasmid.

[0124] The primer sequences are as follows: cgppk-F:5'-gttaacgcttaaAAGGAGGATATACAT ATGGTGGGTAAACTTCCCATCATG -3'; SEQ ID NO.53.

[0125] cgppk-R:5'- CTAGTCACCGATCTGGTCGCGC -3'; SEQ ID NO.54.

[0126] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox was linearized using primers PEC-F5 / PEC-R5 to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox linear vector. The primer sequences are as follows: PEC-F5:5'- GGCGCGACCAGATCGGTGACTAG ggctgttttggcggatgag-3'; SEQ ID NO. 55.

[0127] PEC-R5: 5'-GTTTACCCACCATATGTATATCCTCCTTttaagcgttaactgattgggcaactttc-3'; SEQ ID NO. 56.

[0128] The gene amplification system and gene amplification procedure are the same as in Example 1. The cgppk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox linear vector are obtained. 3 μl of the cgppk fragment and 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox linear vector, as well as 5 μl of Gibson enzyme are added to the PCR tube. The ligation and transformation method is the same as in Example 1. Several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are jun-F / jun-R, and the sequencing method is to pass the sequencing. The plasmid is extracted from the bacterial solution with correct sequencing to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-cgppk plasmid. The primer sequences are as follows: jun-F: 5'-cttgctccgttggtatctgttg-3'; SEQ ID NO. 57.

[0129] jun-R: 5'-ttccctactctcgcatggggag-3'; SEQ ID NO. 58.

[0130] (2) Using Escherichia coli K12 genomic DNA as a template, primers ecppk-F / ecppk-R were used to amplify the fragment ecppk (as shown in SEQ ID NO. 59) to obtain the Escherichia coli K12-derived ecppk fragment with seamless cloning homology arms connected to the plasmid.

[0131] The primer sequences are as follows: ecppk-F:5'-tgcgaagagtgttatactgtggagtaaAAGGAGGATATACAT atgggtcaggaaaagct attackcg-3'; SEQ ID NO.60.

[0132] ecppk-R: 5'-ctctcatccgccaaaacagcc ttattcaggttgttcgagtgatttgatgtag -3'; SEQ ID NO.61.

[0133] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox was linearized using primers PEC-F4 / PEC-R6 to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox2 linear vector. The primer sequences are as follows: PEC-F4: Same as above.

[0134] PEC-R6: 5'-ttactccacagtaacactcttcgcaag-3'; SEQ ID NO. 62.

[0135] The gene amplification system and gene amplification procedure are the same as in Example 1, and the ecppk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox2 linear vector are obtained. 3 μl of the ecppk fragment and 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox2 linear vector and 5 μl of Gibson enzyme are added to the PCR tube. The ligation and transformation method is the same as in Example 1, and several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are jun-F / jun-R, and the sequencing method is test-through. The bacterial solution with correct sequencing is extracted with plasmid to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-ecppk plasmid.

[0136] (3) Using the rspppk gene synthesized by BGI (as shown in SEQ ID NO. 63) as a template, the rspppk fragment was amplified using primers rsppk-F / rsppk-R to obtain the rspppk fragment with seamless cloning homology arms connected to the plasmid.

[0137] The primer sequences are as follows: rspppk-F:5'-cagttaacgcttaaAAGGAGATATACAT ATGGCCGAAGACCGCGCGA -3'; SEQ ID NO.64.

[0138] rspppk-R:5'-tctctcatccgccaaaacagcc TTATCCCTGACGCGGCTTGCGCA -3'; SEQ ID NO.65.

[0139] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox was linearized with primers PEC-F4 / PEC-R7 to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox3 linear vector. The primer sequences are as follows: PEC-F4: Same as above.

[0140] PEC-R7: 5'-CGGCCATATGTATATCCTCCTTttaagcgttaactgattgggcaactttc-3'; SEQ ID NO. 66.

[0141] The gene amplification system and gene amplification procedure are the same as in Example 1, and the rspppk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox3 linear vector are obtained. 3 μl of the rspppk fragment and 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox3 linear vector and 5 μl of Gibson enzyme are added to the PCR tube. The ligation and transformation method is the same as in Example 1, and several colonies that have grown are picked and sent to BGI for sequencing. The sequencing primers are jun-F / jun-R, and the sequencing method is test-through. The bacterial solution with correct sequencing is extracted with plasmid to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-rspppk plasmid.

[0142] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-cgppk, pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-ecppk, and pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-rspppk were electroporated into the competent medium of Corynebacterium glutamicum CG2 simultaneously with PXMJ19-kfiB-kfiD-hasB-laglnA, and the experimental steps were the same as those in Example 1. The kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified at the same time, and the strains in which both were verified to be correct were named Corynebacterium glutamicum HS7, HS8, and HS9.

[0143] (4) Corynebacterium glutamicum HS7, HS8, and HS9 were fermented in a 50 mL shake flask. The fermentation medium and fermentation operation were the same as in Example 1, and 6 g / L sodium glutamate was added to the fermentation medium; sodium tripolyphosphate (5 g / L or 10 g / L) or sodium hexametaphosphate (5 g / L or 10 g / L) was also added.

[0144] OD of Corynebacterium glutamicum HS7, HS8, and HS9 after 48 h of fermentation 600 The results of heparosan content are shown in Table 4.

[0145] Table 4

[0146] The results in Table 4 show that the HS7 strain had the highest heparosan production when 6 g / L sodium glutamate + 10 g / L sodium hexametaphosphate were added to the fermentation medium.

[0147] (5) Fed-batch fermentation in a 5L fermenter Corynebacterium glutamicum HS7 was used as the fermentation strain, and fermentation was carried out in a fermentation medium supplemented with 6 g / L sodium glutamate and 10 g / L sodium hexametaphosphate. The fermentation conditions were 30 °C, 500 rpm, initial pH 7.0, and the final inoculation concentration OD 600 =0.4 (inoculation volume is about 5-10% of the fermentation volume), 0.2 L / min ventilation; the fermentation tank filling volume is 1.5L; during the fermentation process, 10% sulfuric acid and 25% ammonia water are used to automatically adjust the pH to 7.0, and ferment until OD 600 At 15°C, the inducer IPTG (final concentration 0.8 mM) was added, samples were taken at different time points and the residual glucose concentration was detected by HPLC, and 800 g / L glucose was added to adjust the glucose feeding rate. The results are shown in Table 5.

[0148] Table 5: Heparosan results in 5L fermenter

[0149] The results in Table 5 show that in a 5 L fermenter, the HS7 strain produced 23.05 g / L of heparosan at 76 h.

[0150] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium that produces high heparosan yield, characterized in that: The genetically engineered bacteria uses Corynebacterium glutamicum BDH as a starting strain, and knocks out the glucose-6-phosphate dehydrogenase gene and the lactate dehydrogenase gene; Attenuation of the fructose-1, 6-bisphosphate aldolase gene; and / or Overexpression of the glutamine-6-phosphofructotransferase gene; and / or Overexpression of nucleoside diphosphate kinase gene or NADH oxidase gene; and / or Overexpression of the glutamine synthetase gene; and / or Overexpression of polyphosphate kinase gene.

2. A genetically engineered bacterium with high heparosan production according to claim 1, characterized in that: The weakened fructose-1, 6-bisphosphate aldolase gene is weakened by antisense RNA (asfba) of fructose-1, 6-bisphosphate aldolase; the antisense RNA of fructose-1, 6-bisphosphate aldolase is derived from endogenous Corynebacterium glutamicum; The glutamine-6-phosphate fructose aminotransferase gene is a glutamine-6-phosphate fructose aminotransferase gene derived from Bacillus subtilis 168; The nucleoside diphosphate kinase gene is a nucleoside diphosphate kinase gene derived from endogenous Corynebacterium glutamicum; The NADH oxidase gene is derived from Lactobacillus brevis NCTC13768; The glutamine synthetase gene is a glutamine synthetase gene derived from endogenous Corynebacterium glutamicum or Lactobacillus acidophilus ATCC4356; The polyphosphate kinase gene is a polyphosphate kinase gene derived from endogenous Corynebacterium glutamicum, Escherichia coli K12 or Rhodobacter sphaeroides KD131.

3. A genetically engineered bacterium for high heparosan production according to claim 2, characterized in that: The nucleotide sequence of the antisense RNA of fructose-1, 6-bisphosphate aldolase derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.19; The nucleotide sequence of the glutamine-6-phosphofructotransaminase gene derived from Bacillus subtilis 168 is shown in SEQ ID NO.28; The nucleotide sequence of the nucleoside diphosphate kinase gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.33; The nucleotide sequence of the exogenous NADH oxidase gene is shown in SEQ ID NO.47; The nucleotide sequence of the glutamine synthetase gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.38; The nucleotide sequence of the glutamine synthetase gene derived from Lactobacillus acidophilus ATCC4356 is shown in SEQ ID NO.43; The nucleotide sequence of the polyphosphate kinase gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.52; The nucleotide sequence of the polyphosphate kinase gene derived from Escherichia coli K12 is shown in SEQ ID NO.59; The nucleotide sequence of the polyphosphate kinase gene derived from other exogenous sources is shown in SEQ ID NO.

63.

4. Use of the genetically engineered bacteria according to any one of claims 1 to 3 in the production of heparosan.

5. Use of the genetically engineered bacteria according to any one of claims 1 to 3 in increasing the yield of heparosan.

6. A method for producing heparosan, characterized in that: Fermentation is carried out using the genetically engineered bacteria described in any one of claims 1 to 3.

Images