Method for synthesizing optically pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid through biological catalysis

Abstract

The invention discloses a method for synthesizing optically pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid through biological catalysis, and belongs to the technical field of biological engineering. The method comprises the following steps: by taking alpha-fluorine acid and / or an alpha-fluorine acid derivative as a substrate and fluoroacetic acid dehalogenase mutants K181M, K181S, W185G, K181M-W185Y, K181S-W185A, K181S-W185C, K181S-W185G and K181S-W185 V as biocatalysts, hydrolyzing and defluorinating to obtain chiral pure 2R-fluorocarboxylic acid and 2R-hydroxy carboxylic acid and derivatives thereof. The method has the advantages of strong stereoselectivity and simple steps, and solves the problems of low optical purity, low yield, environmental pollution and the like widely existing in the existing chiral compound synthesis. Besides, the whole cell is used as a catalyst to amplify a reaction system to a gram-level experiment, a product with high yield and ee value is obtained, the cost is low, the energy consumption is low, and the method is suitable for industrial production.

Description

Technical Field

[0001] The invention relates to a method for biocatalytically synthesizing optically pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid, belonging to the technical field of bioengineering. Background Art

[0002] Chiral compounds have special stereostructures, and their enantiomers often exhibit different physical and chemical properties and physiological activities. In recent years, they have played an important role in the development of new materials, design of new drugs, and synthesis of fine chemicals. Enzyme catalysis is because the active center of the enzyme is an asymmetric structure, which is conducive to the identification of racemates. Under certain conditions, the enzyme can only catalyze one enantiomer of the racemate to react and become a different compound, thereby separating the two enantiomers. Fluoroacetate dehalogenase is an enzyme isolated from microorganisms such as Pseudomonas, Moraxella, Fusarium, and Burkholderia, and is mainly used to degrade fluorinated organic compounds.

[0003] 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids are important intermediates for medicines, pesticides and optical materials. Due to their unique optical activity and as chiral synthons, they are often used to synthesize more complex compounds. Chirally pure α-hydroxycarboxylic acids can cause keratin exfoliation and have a significant improvement effect on dry skin, fine wrinkles and spots. Therefore, they are widely used in the cosmetics industry; in addition, chirally pure hydroxycarboxylic acids are also intermediates for the synthesis of chiral drugs and pesticides.

[0004] At present, the use of chemical methods to prepare chiral compounds, that is, using chiral ligands and chemical catalysts (usually transition metals) to obtain chirally pure compounds through asymmetric synthesis, has the disadvantages of lack of raw materials, low optical purity and low reaction efficiency. In addition, this type of method also has problems such as expensive reagents, harsh reaction conditions (high temperature and high pressure and strong acid and strong base), and environmental pollution, which is a major challenge for the operation and demand of actual industrial production.

[0005] Although previous studies have reported that fluoroacetate dehalogenase can efficiently catalyze the chiral resolution of α-fluorocarboxylic acids, the reported substrates are mostly substrates with benzene rings, and the highest conversion number is 1.4 million, and the efficiency for α-fluorophenylpropionic acid is not high. Mutants that can improve the efficiency of fluoroacetate dehalogenase in catalyzing the chiral resolution of α-fluorocarboxylic acids are urgently needed. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the above-mentioned defects of the prior art and provide a fluoroacetic acid dehalogenase mutant, which effectively improves its activity against various α-fluorocarboxylic acids (including aliphatic chain carboxylic acid substrates without a benzene ring) by single or combined mutation of sites W185 and K181, and further promotes its expansion in application. The fluoroacetic acid dehalogenase mutant of the present invention is used for efficient biocatalytic synthesis of optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids, has the advantages of strong selectivity, mild reaction conditions, and environmental friendliness, and is particularly suitable for the manufacture of chemicals such as high optical purity 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids.

[0007] The present invention provides a fluoroacetic acid dehalogenase mutant, which has any of the following mutations based on the fluoroacetic acid dehalogenase shown in SEQ ID NO.2:

[0008] (1) mutating lysine 181 to methionine to obtain mutant K181M;

[0009] (2) mutating lysine at position 181 to serine to obtain mutant K181S;

[0010] (3) mutating the lysine at position 181 to methionine and the tryptophan at position 185 to tyrosine to obtain the mutant K181M-W185Y;

[0011] (4) mutating the lysine at position 181 to serine and the tryptophan at position 185 to alanine to obtain the mutant K181S-W185A;

[0012] (5) mutating the lysine at position 181 to serine and the tryptophan at position 185 to cysteine ​​to obtain the mutant K181S-W185C;

[0013] (6) mutating the lysine at position 181 to serine and the tryptophan at position 185 to glycine to obtain the mutant K181S-W185G;

[0014] (7) The lysine at position 181 was mutated to serine, and the tryptophan at position 185 was mutated to valine to obtain the mutant K181S-W185V.

[0015] The present invention also provides a gene encoding the fluoroacetic acid dehalogenase mutant.

[0016] The invention also provides an expression vector containing the gene.

[0017] In one embodiment, the expression vector of the fluoroacetate dehalogenase includes but is not limited to pET28a, pET30a or pBAD containing a sumo tag.

[0018] The present invention also provides a recombinant microbial cell expressing the fluoroacetic acid dehalogenase mutant.

[0019] The present invention also provides a recombinant Escherichia coli expressing the fluoroacetic acid dehalogenase mutant, wherein the host of the recombinant Escherichia coli includes but is not limited to BL21 (DE3), Top10 or Rosetta.

[0020] The present invention also provides a method for biocatalytically synthesizing optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids, comprising the following steps: (1) transferring a gene containing a target fluoroacetic acid dehalogenase mutant into an expression strain and culturing the strain for expression; (2) collecting the expressed whole cells or cell-free extracts or pure enzymes (which can be directly in the form of wet cells or freeze-dried powder) as biocatalysts; (3) using α-fluorocarboxylic acids or α-fluorocarboxylic acid derivatives as substrates, directly adding the biocatalyst, and reacting in a tris(hydroxymethyl)aminomethane-sulfuric acid buffer or other buffers with a similar pH value to obtain a reaction solution; (4) acidifying the reaction solution, adding an extractant to extract the reaction solution, and obtaining an extract solution; and (5) subjecting the extract solution to chromatographic separation to obtain chirally pure 2R-hydroxycarboxylic acids and 2R-fluorocarboxylic acids.

[0021] In one embodiment, when α-fluorocarboxylic acid is used as a substrate, the reaction formula is as shown in formula (I).

[0022]

[0023] Furthermore, the biocatalyst in step (1) is a double mutant of the two sites K181 and W185 in the defluorinase RPA1163 or a similar protease having the amino acid sequence of fluoroacetate dehalogenase.

[0024] Furthermore, the biocatalytic synthesis reaction system in step (3) is: pH = 6.5-8.7, 30-100° C., in a 30-100 mM tris(hydroxymethyl)aminomethane-sulfuric acid buffer system, the mass ratio of substrate to biocatalyst is 50-10000:1, the stirring speed is controlled at 100-1200 rpm, and the reaction time is 1-24 h.

[0025] Furthermore, when the RPA1163 mutant is used as a biocatalyst, the amount of the biocatalyst used per liter of reaction solution is 10 to 50 g.

[0026] Furthermore, the extract in step (5) is separated by column chromatography to obtain chirally pure 2R-hydroxycarboxylic acid and 2R-fluorocarboxylic acid.

[0027] Furthermore, the α-fluorocarboxylic acid derivatives in step (3) include benzene rings, naphthalene rings and fatty chain compounds.

[0028] The biocatalyst fluoroacetic acid dehalogenase used in the present invention is an enzyme separated from Pseudomonas, Moraxella, Fusarium, Burkholderia and the like. The fluoroacetic acid dehalogenase is responsible for cleaving the carbon-fluorine bond during the reaction, and can stereoselectively convert the (S)-α-fluorocarboxylic acid, remove the fluorine atom to form 2R-hydroxycarboxylic acid, thereby realizing the chiral separation of α-fluorocarboxylic acid, and obtaining chirally pure 2R-hydroxycarboxylic acid and 2R-fluorocarboxylic acid.

[0029] The present invention also provides the use of the fluoroacetic acid dehalogenase mutant, or the recombinant microbial cell, or the recombinant Escherichia coli in catalyzing α-fluorocarboxylic acid and its derivatives.

[0030] Beneficial effects:

[0031] The invention provides a fluoroacetic acid dehalogenase mutant, wherein the activity of the mutant is more than 50 times that of the wild type.

[0032] The present invention also provides a method for biocatalytically synthesizing optically pure 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids using the mutant. The method uses α-fluoroacetic acid or its derivatives as substrates, has a simple process route, mild reaction conditions, and no pollution. Within a certain range, high-concentration accumulation of optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids can be achieved by continuously controlling the addition of fluoroacetic acid dehalogenase, and the substrate conversion rate can be as high as 50%, and the ee value is greater than 99%. The method has low cost and low energy consumption. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a protein gel comparison of fluoroacetate dehalogenase (lane 1: protein marker, lane 2: RPA1163-WT, lane 3: K181M-W185Y; lane 4: K181S-W185A; lane 5: K181S-W185C; lane 6: K181S-W185G; lane 7: K181S-W185V;

[0034] Figure 2 This is the gas chromatogram after the esterification of substrate 1a and enzyme reaction solution (from bottom to top, they are pure enzyme, reaction solution, pure substrate, pure S-configuration product, and pure product chromatogram);

[0035] Figure 3 This is the gas chromatogram after the esterification of substrate 1b and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0036] Figure 4 This is the gas chromatogram after the esterification of substrate 1c and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0037] Figure 5 This is the gas chromatogram after the esterification of substrate 1d and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0038] Figure 6 This is the gas chromatogram after the esterification of substrate 1e and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0039] Figure 7 This is the gas chromatogram after the substrate 1f is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0040] Figure 8 This is the gas chromatogram after esterification of 1g of substrate with enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0041] Fig. 9 This is the gas chromatogram after the substrate is esterified with the enzyme reaction solution for 1 hour (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0042] Fig.10 This is the gas chromatogram after the esterification of substrate 1i and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0043] Fig.11 It is the gas chromatogram after the esterification of substrate 1j and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0044] Fig.12 This is the gas chromatogram after the esterification of substrate 1k and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0045] Fig.13 This is the gas chromatogram after the substrate 1l is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0046] Fig.14 It is the gas chromatogram after the esterification of substrate 1m and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0047] Fig.15It is the gas chromatogram after the substrate 1n is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0048] Fig.16 This is the gas chromatogram after the substrate 1o is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0049] Fig.17 It is the gas chromatogram after the substrate 1p is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0050] Fig.18 This is the gas chromatogram after the substrate 1q is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure product, and pure S-configuration product);

[0051] Fig.19 This is the gas chromatogram after the esterification of substrate 1r and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, and pure R-configuration product);

[0052] Fig. 20 It is the gas chromatogram after the substrate 1s is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0053] Fig.21 It is the gas chromatogram after the esterification of substrate 1t and enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, pure product, and pure R-configuration product);

[0054] Fig. 22 This is the gas chromatogram after the substrate 1u is esterified with the enzyme reaction solution (from bottom to top, they are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0055] Fig.23 is the H NMR spectrum of substrate 1a;

[0056] Fig.24 is the NMR carbon spectrum of substrate 1a;

[0057] Fig.25 is the NMR fluorine spectrum of substrate 1a;

[0058] Fig.26 is the H NMR spectrum of substrate 1q;

[0059] Fig. 27 is the NMR carbon spectrum of substrate 1q;

[0060] Fig.28is the NMR fluorine spectrum of substrate 1q;

[0061] Fig.29 is the H NMR spectrum of substrate 4q;

[0062] Fig.30 is the NMR carbon spectrum of substrate 4q;

[0063] Fig.31 is the H NMR spectrum of substrate 1r;

[0064] Fig.32 is the NMR carbon spectrum of substrate 1r;

[0065] Fig.33 is the NMR fluorine spectrum of substrate 1r;

[0066] Fig.34 is the substrate spectrum of the fluoroacetate dehalogenase mutants. DETAILED DESCRIPTION

[0067] The present invention will be further described below in conjunction with the embodiments and drawings.

[0068] Unless otherwise specified, the chemical reagents used in the embodiments of the present invention were obtained through conventional commercial channels.

[0069] The culture medium and buffer solution formula used in the embodiment are:

[0070] LB broth solid culture medium formula (1L): yeast powder (Sangon Biotechnology Co., Ltd.) 5g, peptone (Sangon Biotechnology Co., Ltd.) 10g, sodium chloride (Shanghai Zhanyun Chemical Co., Ltd.) 10g, agar (Sangon Biotechnology Co., Ltd.) 15g.

[0071] Super broth medium formula (1L): yeast powder (Sangon Biotechnology Co., Ltd.) 24g, peptone (Sangon Biotechnology Co., Ltd.) 12g, glycerol (Sangon Biotechnology Co., Ltd.) 4mL.

[0072] Example 1 Construction and expression of fluoroacetate dehalogenase recombinant Escherichia coli

[0073] (1) Construction of expression plasmid of fluoroacetic acid dehalogenase gene

[0074] The nucleotide sequence encoding fluoroacetic acid dehalogenase (as shown in SEQ ID No. 1) is cloned or directly synthesized from the plasmid and microorganism containing the gene, and the obtained gene is inserted into the NheⅠ restriction site of the pBAD plasmid containing the sumo tag (the expression vector can also be replaced by a pET series vector, such as pET28a, pET30a, etc.), to obtain a recombinant plasmid expressing the wild-type fluoroacetic acid dehalogenase. The mutation site is introduced by polymerase chain reaction (primers are shown in Table 1) to obtain a recombinant plasmid expressing the mutant.

[0075] Table 1

[0076] Primer name Primer sequences K181S-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCTGGACCCGTGCCGG K181S-R CGGGTCCAGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181M-F GATTTTTATGTTAAAGCAATGCTGGCAAGCTGGACCCGTG K181M-R GTCCAGCTTGCCAGCATTGCTTTAACATAAAAATCCG K181M-W185Y-F GATTTTTATGTTAAAGCAATGCTGGCAAGCTATACCCGTGCCGGTGATCTGAG K181M-W185Y-R CACCGGCACGGGTATAGCTTGCCAGCATTGCTTTAACATAAAAATCCGGATC K181S-W185A-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCGCGACCCGTGCCGGTGATCTGAG K181S-W185A-R CACCGGCACGGGTCGCGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181S-W185C-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCTGCACCCGTGCCGGTGATCTGAG K181S-W185C-R CACCGGCACGGGTGCAGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181S-W185G-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCGGCACCCGTGCCGGTGATCTGAG K181S-W185G-G CACCGGCACGGGTGCCGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181S-W185V-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCGTGACCCGTGCCGGTGATCTGAG K181S-W185V-G CACCGGCACGGGTCACGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC

[0077] (2) Construction and expression of recombinant Escherichia coli of fluoroacetate dehalogenase

[0078] The above recombinant plasmids were transformed into E. coli expression strain Top10, and the bacterial solution was spread on LB broth solid medium containing ampicillin, cultured overnight, and single colonies were selected into super broth medium, and a final concentration of 100 μg mL -1 Ampicillin was added to a final concentration of 100 μg mL -1 The protein expression was induced by L-arabinose, and the cells were collected by centrifuge 18 hours later, washed twice with 50 mM tris(hydroxymethyl)aminomethane-sulfuric acid (pH=7.0) buffer solution, and then freeze-dried.

[0079] The above method was used to construct recombinant Escherichia coli expressing wild-type fluoroacetate dehalogenase WT and recombinant Escherichia coli expressing mutants K181S, K181M, K181M-W185Y, K181S-W185A, K181S-W185C, K181S-W185G, and K181S-W185V.

[0080] Example 2 Purification and characterization of enzymatic properties of fluoroacetate dehalogenase

[0081] The corresponding enzyme was purified by nucleophilic chromatography. The protein gel comparison of fluoroacetate dehalogenase is shown in the figure below. Figure 1 shown.

[0082] The enzyme conversion number TON is the ratio of the product concentration to the enzyme concentration after the reaction is completed. In this patent, it is obtained by measuring the concentration of the converted S-configuration substrate and comparing it with the concentration of the enzyme used. The determination method is to fix the concentration of the enzyme and adjust the substrate concentration. When the conversion rate of the S-configuration substrate is about 80%, it can be used for measurement. More than three groups of parallel experiments are carried out, and the data are averaged. The wild type and the mutant are carried out simultaneously. In some substrates, the wild type is inhibited in the presence of high concentrations of substrates, so the corresponding substrate concentrations are slightly different. The reaction is carried out in 50mM tris-H2 SO 4 (pH = 7.0), the reaction temperature was 60 ° C, and the reaction time was 7 hours. After the reaction was completed, 100 μL of the reaction solution was taken, 10 μL of concentrated hydrochloric acid was added, 300 μL of ethyl acetate was added, 150 μL of the organic phase was taken after mixing, 30 μL of (trimethylsilyl) diazomethane and 240 μL of methanol were added, and the reaction was detected by gas chromatography after derivatization at 30 ° C for 30 minutes.

[0083] The reaction liquid derivative reaction formula is shown in formula (II):

[0084]

[0085] The substrates involved in this embodiment include 1a-1u ( Fig.34 ), and using the above method, the activity of the corresponding α-fluorocarboxylic acid was detected.

[0086] The results are shown in Table 2. The TON of the single mutant K181S for 1n reached more than 110,000, which is 21.9 times higher than that of the wild type. The TON of the single mutant K181M for 1a reached more than 150,000, which is 2 times higher than that of the wild type. Compared with the wild type, the double mutants involved have increased their activity by 4-100 times for the same substrate, and the substrates involved have increased fatty chain substrates. The TON of the mutant K181M-W185Y for 1a has reached more than 210,000, the TON for 1q has reached more than 2.8 million, and the TON for 1r has also reached more than 70,000, which is significantly higher than the reported mutants W185N and W185T. Other substrates have not been involved in existing reports.

[0087] Table 2

[0088]

[0089]

[0090] Note: Bold fonts represent mutants with the highest TON number for the same substrate, “nd” represents no activity detected, and “—” represents not detected.

[0091] Example 3 Whole-cell catalysis of α-fluorocarboxylic acid to synthesize optically active 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid

[0092] Using 1a-1u as a substrate and recombinant Escherichia coli whole cells expressing a fluoroacetic acid dehalogenase mutant as a biocatalyst, chiral separation is performed to obtain chirally pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid, comprising the following steps:

[0093] (1) The whole cells expressing the fluoroacetate dehalogenase mutant in Example 1 were collected and freeze-dried using a freeze dryer.

[0094] (2) Using α-fluorocarboxylic acid as the substrate and the collected whole-cell lyophilized powder as the biocatalyst, the substrate was added to a tris(hydroxymethyl)aminomethane-sulfuric acid buffer at a final concentration of 30 g / L, the pH was adjusted to 7.0, and then lyophilized powder of fluoroacetate dehalogenase mutant cells was added at a final concentration of 10 g / L-20 g / L, and the reaction was carried out at 60°C and 220 rpm for 2 h.

[0095] When 1a, 1b, 1g, 1h, 1k, 1p, 1q, 1r or 1t is used as a substrate, the biocatalyst used is a fluoroacetate dehalogenase mutant K181M-W185Y; when 1d is used as a substrate, the biocatalyst used is a fluoroacetate dehalogenase mutant K181S-W185A; when 1d, 1h, 1i, 1j, 1l, 1s or 1u is used as a substrate, the biocatalyst used is a fluoroacetate dehalogenase mutant K181S-W185C; when 1c, 1e, 1l, 1m, 1n or 1o is used as a substrate, the biocatalyst used is a fluoroacetate dehalogenase mutant K181S-W185G; when 1f or 1s is used as a substrate, the biocatalyst used is a fluoroacetate dehalogenase mutant K181S-W185V.

[0096] (3) After the reaction, hydrochloric acid was added to the system for acidification, and then extracted with ethyl acetate. The extracts of 1a-1r and 1t-1u were derivatized and then subjected to gas phase detection. The GC spectrum is shown in the attached Figure 2-19 and Figure 21-22 , 1s for liquid phase detection, LC spectrum see attached Fig. 20 , the substrate conversion rate is 50% and the ee value is greater than 99%.

[0097] The gas phase detection conditions in the embodiment are:

[0098] 1a-1n / 1t-1u: 100℃~120℃, 5℃ / min, 120℃: 3min, 120℃~220℃, 10℃ / min, 220℃: 5min. Column used: CYCLOSIL-B, 30m×0.25mm ID;

[0099] 1o / 1p / 1r: 100℃: 2min, 100℃~150℃, 3℃ / min, 150℃: 2min, 150℃~200℃, 20℃ / min, 200℃: 2min. Column used: E, 25m×0.25mm ID;

[0100] 1q: 100°C: 2 min, 100°C-160°C, 2°C / min, 160°C: 3 min, 160°C-220°C, 20°C / min, 220°C: 2 min. Column used: CP-Chirasil Dex CB, 25 m × 0.25 mm ID;

[0101] Liquid phase detection conditions in the embodiment:

[0102] 1s: 0-40min, 1mL / min, 14% ethanol / 76% isopropanol (containing 0.1% acetic acid), 254nm. Column used: OJ-H, 4.6Φmm×250m mL.

[0103] (4) 1 / 10 hydrochloric acid was added to the reaction solution of 1b-1p and 1s, and the mixture was extracted with ethyl acetate three times. After being dried by rotation, the mixture was dissolved in methanol, 0.1% sulfuric acid was added, and the mixture was stirred in an oil bath at 80°C until the reaction was complete. After removing the solvent, the mixture was separated by silica gel column chromatography (PE:EA=10:1) to obtain chirally pure 2R-fluorocarboxylic acid methyl ester and 2R-hydroxycarboxylic acid methyl ester, both of which had a separation yield of more than 80% and an enantioselectivity of more than 99%. 1 / 10 hydrochloric acid was added to the reaction solution of 1t-1u, and the mixture was extracted with ethyl acetate three times. After being dried by rotation, the mixture was separated by silica gel column chromatography (PE:EA=3:1) to obtain chirally pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid, both of which had a separation yield of more than 80% and an enantioselectivity of more than 99%.

[0104] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A fluoroacetate dehalogenase mutant, characterized in that: The mutant has any of the following mutations based on the fluoroacetic acid dehalogenase shown in SEQ ID NO.2: (1) mutating lysine 181 to methionine; (2) mutating lysine 181 to serine; (3) mutating the lysine at position 181 to methionine and the tryptophan at position 185 to tyrosine; (4) mutating the lysine at position 181 to serine and the tryptophan at position 185 to alanine; (5) mutating lysine at position 181 to serine and mutating tryptophan at position 185 to cysteine; (6) mutating the lysine at position 181 to serine and the tryptophan at position 185 to glycine; (7) The lysine at position 181 was mutated to serine, and the tryptophan at position 185 was mutated to valine.

2. A gene encoding the fluoroacetate dehalogenase mutant according to claim 1.

3. An expression vector containing the gene according to claim 2.

4. The expression vector according to claim 3, characterized in that The expression vector includes but is not limited to pET28a, pET30a or pBAD containing a sumo tag.

5. A recombinant microbial cell expressing the fluoroacetate dehalogenase mutant according to claim 1.

6. A recombinant Escherichia coli expressing the fluoroacetate dehalogenase mutant according to claim 1, characterized in that: The host of the recombinant Escherichia coli includes but is not limited to Escherichia coli BL21 (DE3), Top10 or Rosetta.

7. A method for biocatalytic synthesis of optically pure 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids, characterized in that: The reaction is carried out using α-fluorocarboxylic acid and / or α-fluorocarboxylic acid derivatives as substrates and the fluoroacetic acid dehalogenase mutant according to claim 1 or the recombinant microbial cell according to claim 5 or the recombinant Escherichia coli according to claim 6 as a biocatalyst.

8. The method according to claim 7, characterized in that React at pH=6.5-8.7, 30-100°C, 100-1200 rpm.

9. The method according to claim 7 or 8, characterized in that: The α-fluorocarboxylic acid derivatives include benzene rings, naphthalene rings and fatty chain compounds.

10. Use of the fluoroacetic acid dehalogenase mutant according to claim 1, or the recombinant microbial cell according to claim 5, or the recombinant Escherichia coli according to claim 6 in catalyzing α-fluorocarboxylic acids and their derivatives.

Images