Nucleic acid aptamer targeting MOTS-c and application of nucleic acid aptamer

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a targeted MOTS-c nucleic acid aptamer and application thereof. The target sequence of the aptamer is SEQ ID NO: 1, the sequence of the nucleic acid aptamer is SEQ ID NO: 2, the aptamer has good affinity with MOTS-c, the stemness characteristic of cancer cells can be remarkably inhibited when the aptamer treats the cancer cells, the lung metastasis condition of tumor-bearing mice is remarkably improved, and the aptamer has a good blocking effect on MOTS-c in vivo and in vitro. And the aptamer has a certain treatment effect of resisting tumor metastasis.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and in particular relates to a nucleic acid aptamer targeting MOTS-c and an application thereof. Background Art

[0002] Breast cancer is a highly prevalent malignant tumor in women. Metastasis is the main cause of breast cancer treatment failure, recurrence, and patient death, and cancer cell stemness is closely related to tumor metastasis. Reducing cancer cell stemness is of great significance in inhibiting tumor metastasis, improving patient treatment efficiency, reducing recurrence, and improving patient survival rate.

[0003] In a study, the applicant's research group found that mast cells in metastatic lymph nodes increase cancer cell stemness and promote distant tumor metastasis by secreting LCN2. Further studies have found that LCN2 mediates the above effects by upregulating a mitochondrial peptide MOTS-c in cancer cells. MOTS-c is encoded by the mitochondrial 12s rRNA sORF. It is reported that MOTS-c can act as a retrograde signal, regulate nuclear transcription through nuclear translocation, respond to glucose deprivation, regulate glycolysis, and play an important role in diseases such as diabetes, obesity, neuromuscular degenerative diseases, and aging. In lymph node metastases, we found that MOTS-c promotes the stem-like characteristics and distant metastasis of tumor cells. Targeting MOTS-c may be an effective primary method for inhibiting distant organ metastasis of tumors, but there is currently a lack of blockers for MOTS-c. Aptamers are oligonucleotide sequences artificially synthesized in vitro using the systematic evolution of ligands by exponential enrichment (SELEX) technology. They can interact with target molecules with high affinity through hydrogen bonds, electrostatic interactions, hydrophobic interactions and van der Waals forces, thereby achieving specific recognition or blocking of target molecules. In this project, we designed and constructed MOTS-c aptamers to specifically block the function of MOTS-c, thereby playing an anti-tumor metastasis role. Summary of the invention

[0004] In view of the above problems existing in the prior art, in order to inhibit distant tumor metastasis and improve the survival rate of patients, the present invention provides a nucleic acid aptamer targeting MOTS-c and its application.

[0005] The present invention adopts the following technical solutions A nucleic acid aptamer targeting MOTS-c, wherein the target sequence of the nucleic acid aptamer is SEQ ID NO: 1: MKWEEMGYIFL.

[0006] Furthermore, the sequence of the nucleic acid aptamer is: TGACACCGTACCTGCTCTGCCAAGCACGCCAAGGGACTAT, SEQ ID NO: 2.

[0007] A pharmaceutical composition comprises the above-mentioned nucleic acid aptamer and a pharmaceutically acceptable carrier.

[0008] The application of the above-mentioned nucleic acid aptamer includes any one or more of the following: A) Application in anti-tumor metastasis drugs; B) for preparing MOTS-c detection or diagnostic reagents, kits or sensors; C) Used for preparing MOTS-c capture, separation and purification preparations; D) used in the preparation or construction of MOTS-c targeted drug delivery system; E) used to detect or evaluate tumor metastasis; The tumor includes breast cancer.

[0009] Compared with the prior art, the present invention has the following beneficial effects: The inventors found in the study of tumor metastasis that MOTS-c is highly expressed in cancer cells with lymph node metastasis. In in vitro experiments, MOTS-c was found to promote the stem-like characteristics of cancer cells by detecting the activity of stem cell marker ALDH1 through cell spheroid experiments and flow cytometry. Tumor stem cells are considered to be a cell subpopulation with strong metastatic ability. Therefore, after in vivo experiments, it was further verified that MOTS-c can promote distant organ metastasis of tumors. Studies have shown that MOTS-c is an important target for inhibiting distant metastasis of tumors, but there is currently a lack of specific inhibitors of MOTS-c. For this reason, the inventors designed and constructed the inhibitory aptamer of MOTS-c of the present invention, which has good affinity for MOTS-c. Treating cancer cells with the aptamer can significantly inhibit the stem characteristics of cancer cells, and giving MOTS-c aptamer treatment to tumor-bearing mice significantly improves the lung metastasis of tumor-bearing mice. The experimental results show that the constructed aptamer has a good blocking effect on MOTS-c both in vivo and in vitro, and the aptamer has a certain therapeutic effect against tumor metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 The LC-MS results of the cancer cells in situ and lymph node metastasis in Example 1; Figure 2 The expression results of MOTS-c in EO771 treated with LCN2 in Example 1; Figure 3 The experimental results of EO771 mammary gland sphere formation after MOTS-c treatment in Example 2; Figure 4 The expression results of ALDH1, a stemness marker of EO771 cells treated with MOTS-c in Example 2 Figure 5 This is a schematic diagram of the construction process of the MOTS-c aptamer in Example 3; Figure 6 The results of the affinity test between the MOTS-c aptamer ML11-1 and the target molecule in Example 3; Figure 7 The effect of aptamer therapy on cancer cell stemness in Example 4; Figure 8 The effect of aptamer therapy on cancer cells invading lymph node blood vessels in Example 4; Fig. 9 This is the effect of aptamer therapy in Example 4 on lung metastasis of breast cancer and oral squamous cell carcinoma in mice. DETAILED DESCRIPTION

[0011] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings and embodiments. Preferred embodiments of the present invention are given in the embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0012] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0013] The reagents used in the following examples, unless otherwise specified, are all commercially available; the methods used in the following examples, unless otherwise specified, are all conventional methods that can be achieved. Example 1 MOTS-c is highly expressed in metastatic cancer cells colonized in lymph nodes 1. Detection of MOTS-c expression in cancer cells with lymph node metastasis 1.1 Liquid chromatography-mass spectrometry (LC-MS): Breast cancer cells were isolated from orthotopic tumors and metastatic lymph nodes of tumor-bearing mice, washed with PBS and centrifuged at 1000rpm for 5min. The cell pellet was lysed with RIPA lysis buffer (Cat# p0013b, Beyotime) containing mixed phosphatase and protease inhibitors (Cat# 78441, Thermo Fisher Scientific), centrifuged at 12000 rpm for 20 minutes at 4℃, and the supernatant was collected for protein concentration determination by BCA method. 200-300μg of protein was diluted to 100uL with 50mM NH4CO3, and 4 times the volume of pre-cooled acetone was added. Precipitation was allowed to proceed overnight at -20℃. Centrifuged at 15,000×g, 4℃ for 30min, and the supernatant was discarded; the pellet was washed with 500μL cold acetone, 500μL cold 70% ethanol, and 500μL cold acetone in sequence, and centrifuged at 4℃. The pellet was freeze-dried and resuspended with 50μLUA buffer. DTT reduction: Add 2μL 50mM DTT to 50mM ABC (final DTT concentration 2mM) and incubate at 30℃ for 1.5h. IAA alkylation: Add 13μL 50mM IAA to 50mM ABC (final IAA concentration 10mM) and incubate at room temperature in the dark for 45min. Dilute to 600μL with 50mM ABC (final urea concentration is about 0.7M). Add Trypsin in 50mM ABC at 1:40 or 1:50 (W:W, enzyme:protein) and incubate at 37℃ for 12-18h. The reaction was terminated by acidification with 10% TFA to a final concentration of 0.4%. The filtrates were combined, desalted by SPE column, vacuum dried, re-dissolved with 0.1% FA, vortexed for 5 min, centrifuged at 15000 rpm, 4°C for 30 min, and the supernatant was taken to determine the concentration. The sample was prepared to 500 ng / μl, the peptide concentration was determined, and the sample was stored at -80°C. Data processing: Peptidomics data were processed using Proteome Discoverer (v2.4) against an internally constructed database based on uniport mouse + musculus-17440, with differential screening criteria: ratio > 1.5 or < 0.67, p value < 0.05. For further analysis, the precursor MS was set to 10 ppm and the EthcD MS / MS tolerance was set to 0.6 Da. Data were calculated using label free quantification (LFQ) in Proteome Discoverer.

[0014] 1.2 Western blotting EO771 cells were treated with 1640 medium with or without recombinant LCN2 (2 μg / ml, Cat# HY-P70658A, MedChemExpress). After 48 h, the medium was discarded and cells were rinsed twice with pre-cooled PBS. RIPA lysis buffer (Cat# p0013b, Beyotime) mixed with protease inhibitors and phosphatase inhibitors (Cat# 78441, Thermo Fisher Scientific) was added to lyse the cells. The cells were scraped with a pre-cooled cell scraper and the cell suspension was transferred to a 1.5 ml EP tube. The cells were centrifuged at 12000 rpm for 20 min at 4°C. The supernatant was aspirated and transferred to a new EP tube. The protein concentration was determined by BCA protein assay kit (Cat# 23235, Thermo Fisher Scientific). The proteins were denatured by boiling with 1X loading buffer for 5 min. Equal amounts of protein samples and molecular weight markers were loaded into SDS-PAGE gel wells for electrophoresis separation, and the proteins were transferred to PVDF membranes. The PVDF membrane was blocked with 5% BSA for 1 hour and incubated with MOTS-c primary antibody (Cat# PAX132Mu01, Cloud-Clone Corp) overnight. The membrane was washed three times with TBST, incubated with HRP-conjugated secondary antibody for 1 hour, and detected by chemiluminescence (Cat# 32106, Thermo Fisher Scientific), and grayscale values ​​were analyzed using Image J.

[0015] 1.3 Results 1.3.1 LC-MS analysis showed that compared with cancer cells in the original tumor, the expression of MOTS-c in cancer cells with lymph node metastasis was significantly increased ( Figure 1 ).

[0016] 1.3.2 Western blot analysis showed that after LCN2 stimulation, the expression of MOTS-c in EO771 cells was significantly upregulated, P < 0.0001 ( Figure 2 ).

[0017] The above results showed that MOTS-c was highly expressed in breast cancer cells with lymph node metastasis.

[0018] Example 2: Study on the effect of MOTS-c on promoting stem-like characteristics of cancer cells 2.1 Cell sphere formation assay Stem cell culture medium preparation: DMEM / F12, plus 2% B27 containing 20 ng / ml mEGF and 20 ng / ml mFGF. EO771 cells were cultured in stem cell culture medium with or without 10 μM MOTS-c at a concentration of 1000 / well in ultra-low attachment cell culture plates (Corning). After 10 days, dead cells were excluded by staining with 2.5 μM CFSE (Cat# C34554, Invitrogen) and photographed under a laser scanning confocal microscope (LSM880, Zeiss).

[0019] 2.2 Flow cytometry detection of changes in the expression level of tumor stem cell marker ALDH1 after exogenous MOTS-c treatment EO771 cells were treated with medium containing or without exogenous 10 μM MOTS-c for 48 h; the cells were digested with 0.25% trypsin and then resuspended into a single cell suspension.

[0020] ALDH1 activity detection: ALDH1 activity was detected using ALDEFLUOR™ Kit (Cat# 01700, Stem cell technologies). Cells were resuspended in 100 μl buffer, 1 μl ALDH1 substrate was added to each sample, 1 μl ALDH1 substrate and 2 μl DEAB were added to the negative control group, incubated at 37 °C for 1 h, washed twice with PBS, and then detected on a CytoFLEX flow cytometer.

[0021] 2.3 Results 2.3.1 Cell sphere formation experiments showed that compared with the control group, EO771 treated with MOTS-c was more likely to form cell spheres ( Figure 3 ).

[0022] 2.3.2 Flow cytometry results showed that the ALDH1 activity of EO771 treated with MOTS-c was significantly higher than that of the control group. P <0.0001( Figure 4 ).

[0023] The above results indicate that MOTS-c can increase the stem-like characteristics of cancer cells.

[0024] Example 3 Construction of MOTS-c aptamer MOTS-c aptamer construction process (such as Figure 5 ), specifically including: 3.1 Screening experiment using magnetic beads-SELEX method The target protein (Kamed Biotech (Tianjin) Co., Ltd.) was incubated with NHS-activated magnetic bead-coupled protein (Yisheng Biotech, Cat. No. 20563ES03) and the oligonucleotide library Random Library Bank 40 (Kamed Biotech (Tianjin) Co., Ltd.). After multiple rounds of screening and enrichment, high-affinity nucleic acid aptamers binding to MOTS-c were obtained. The specific process is as follows: 3.1.1. First round of binding and elution (1) 10-50 μg oligonucleotide library, 50 μl [10×] SELEX buffer, add nuclease-free water to a final volume of 500 μl.

[0025] (2) Add the oligonucleotide library from step (1) to 1000 μg of protein-coupled magnetic beads.

[0026] (3) Incubate at 37°C with gentle shaking for 30 min-1 h.

[0027] (4) Wash the magnetic beads with 1 ml of SELEX Buffer.

[0028] Note: For in vitro aptamer screening, the oligonucleotide library was incubated and washed at room temperature (25°C). For in vivo aptamer screening, the biological environment temperature (e.g., 37°C) was used.

[0029] (5) The beads are incubated in 1×TE buffer at 94°C. The supernatant without beads is quickly transferred to a new reaction tube. The heated eluted DNA is directly used for PCR.

[0030] 3.1.2. First round of ePCR Synthesize at least 0.5 μg of template DNA as starting material for the next round, plus an equal amount for backup and quality control, for a total of 1-3 μg of DNA.

[0031] The PCR amplification system was prepared according to the water phase: oil phase = 1:6 (volume ratio), wherein the specific composition of the water phase is shown in Table 1, and the primer sequences used are shown in Table 2.

[0032] Table 1 PCR aqueous phase components

[0033] Table 2 Primer sequences

[0034] The PCR program was: 95°C for 2 min, 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, 72°C for 5 min; 15-20 cycles.

[0035] (1) Add 300 μl of pre-cooled oil phase to 50 μl of pre-cooled PCR water phase. Spin at maximum speed for 5 min without centrifugation. Dispense the mixture into 3 tubes, 100 μl per tube.

[0036] (2) Take the three tubes of duplicate ePCR products corresponding to each round and add them to a 2 ml reaction tube. Add 1.0 ml of 2-butanol (or butanol). Vortex to mix.

[0037] (3) Add 5 times the volume of the aqueous phase (250 μl) of Orange-SFX buffer to the system. Gently shake on a shaker for 2 minutes. Centrifuge at 16000g (14000 rpm) for 2 minutes to separate the phases.

[0038] (4) Remove most of the yellow organic phase. Add 1.2 volumes of 96-100% [v / v] ethanol to the aqueous phase. Mix thoroughly with a pipette (do not centrifuge).

[0039] DNA purification (1) Place the purification column in a receiving tube, add 30 μl of Buffer SF onto the membrane in the center of the bottom of the purification column, and place at room temperature.

[0040] (2) Transfer the mixture from 3.1.2(7) to the purification column, with a maximum transfer volume of 600 μl; (3) Centrifugation at 11000 x g (12000 rpm) for 1 min; (4) Pour away the waste liquid and reinstall the purification column onto the receiving tube; (5) If the total volume of aqueous phase + interphase + ethanol exceeds 600 μl, repeat steps (1)-(3) using the same column; (6) Add 600 μl Wash-SFX buffer, centrifuge at 11000 x g (12000 rpm) for 1 min, discard the waste liquid, and reload the column onto the tube; (7) Add 350 μl Wash-SFX buffer, centrifuge at 11000 x g (12000 rpm) for 1 min, discard the waste liquid, and reload the purification column into the receiving tube; (8) Centrifuge at 11000xg (12000 rpm) for 2 min, discard the waste liquid, and place the column in a new receiving tube (1.5-2 ml). Add 50 ~ 100 μl of elution buffer-SFX buffer to elute the DNA (heating the buffer to 80°C during elution will help improve DNA recovery).

[0041] Note: The elution volume can be reduced to 50 μl, but never below 20 μl.

[0042] (9) Incubate at room temperature for 2 minutes. Centrifuge at 11000xg (12000rpm) for 1 minute; (10) Discard the column and cap the collection tube; (11) Quantitative PCR yield by spectrophotometry and verification of amplification product size by 3% agarose gel; (12) The purified DNA was stored at -20°C for subsequent analysis / manipulation.

[0043] NOTE: For long-term storage of DNA, use a buffer such as 1xTE or phosphate buffered saline without pure water to prevent autohydrolysis of the DNA.

[0044] 3.1.4. Binding and purification (1) Mix 1-3 μg dsDNA with 50-100 μl [10x] SELEX buffer and add nuclease-free water to a final volume of 500-1000 μl.

[0045] Note 1): After dsDNA is denatured at 94° for 3 minutes, immediate ice bathing is beneficial to the formation of ssDNA secondary structure.

[0046] Note 2): Approximately 50 to 130 pmol (1 to 3 μg) of purified dsDNA was used for the second and all subsequent screening cycles.

[0047] (2) Add 500 μg of protein-coupled magnetic beads and 500 μl of 1x SELEX buffer.

[0048] Note: Non-specific binding can be removed by incubating with magnetic beads without coupled protein.

[0049] (3) Incubate at 37°C with gentle shaking for 30 min.

[0050] (4) Wash twice with 500 μl-1 ml SELEX buffer.

[0051] Note: For each additional round of screening, an additional washing step is required.

[0052] (5) The beads were incubated in 1×TE buffer at 94°C. The supernatant without magnetic beads was quickly transferred to a new reaction tube.

[0053] 3.1.5. Subsequent ePCR Refer to 3.1.2 and the examples in Table 3 below for screening Table 3 Aptamer screening process

[0054] 3.1.6 Subsequent DNA purification Refer to 3.1.3 After 10 rounds of SELEX screening, a ssDNA library with high affinity for MOTS-c was obtained, which was prepared as a sequencing sample and subjected to high-throughput double-end sequencing by KMD Biotech (Tianjin) Co., Ltd.

[0055] After sequencing quality control, all non-repetitive sequences that passed quality control were screened by Lenth, and sequences with a length of 40 bp were selected as target sequences. The sequence with the highest occurrence frequency, ML11-1, was selected for rapid affinity identification. The sequences are shown in Table 4 below.

[0056] Table 4 Screened aptamer sequences

[0057] 3.2 Evaluation of the affinity of MOTS-c aptamer to MOTS-c using biofilm interferometry (BLI) 3.2.1 Biotin-ML11 (target molecule, sequence is SEQ ID NO: 1) was specifically captured by SA chip, and after the signal reached 0.2 nm, it bound to ML11-1.

[0058] 3.2.2 Dissolve Biotin-ML11 in 0.1 mL of DMSO, dilute the dissolved peptide solution 20,000 times with 1×SD to a concentration of 0.5 μg / mL, solidify for 120 s, and the solidification height is 0.2 nm.

[0059] 3.2.3 Dissolve ML11-1 in PBS buffer to a concentration of Dissolve the solution in 200 μl of 1×SD to a concentration of about 25 μM.

[0060] 3.2.4 Add samples and to a 96-well plate in the following order.

[0061] in: A3-A5 and B3-B5 added 1× SD buffer for sensor equilibration and dissociation steps; A6-A10 added ML11 DNA sample at a concentration of 25 μM; B6-B10 added 1× SD buffer for blank subtraction; A11 and B11 added 10 mM Glycine pH 1.8 for sensor regeneration; A12, B12 Add 1×SD buffer to neutralize the acidic environment of the regenerated sensor 3.2.5 Run the program 3.2.6 Use the software ForteBio Data Analysis 12.0 to align the data 3.2.7 Affinity test results The interaction fitting data of the screened aptamer ML11-1 and the target molecule ML11 (such as Figure 6 ). The results showed that the aptamer we constructed had a high affinity for MOTS-c.

[0062] Example 4 Application of MOTS-c aptamer in tumors 4.1 MOTS-c aptamer inhibits cancer cell stem-like characteristics Mast cells were isolated from metastatic lymph nodes of tumor-bearing mice and cultured in serum-free basal medium (DMEM / F12 (Gibco) for 48 h, and the conditioned medium was collected. EO771 cells were cultured in conditioned medium supplemented with MOTS-c aptamer ML11-1, and ALDH1 activity was detected by flow cytometry after 48 h (same steps as before).

[0063] 4.2 MOTS-c aptamer inhibits distant tumor metastasis EO771 cells and MOC2 cells were pre-transfected with lentivirus carrying luciferase plasmid. EO771 cells (5× 10 5 ) were injected into the fat pad of C57BL / 6 female wild-type mice, MOC2 (5× 10 5 ) were injected subcutaneously into another batch of C57BL / 6 female wild-type mice. After tumor formation in mice, 5 mg / kg of MOTS-c aptamer ML11-1, scramble or an equal amount of saline was given to each mouse by intravenous injection every week for 3 consecutive weeks. Mice were euthanized within 5 weeks after tumor cell implantation, and tumor-draining lymph nodes and lungs were collected.

[0064] 4.2.1 Immunofluorescence staining of paraffin sections of tumor-draining lymph nodes Lymph node tissues were removed from tumor-bearing mice, fixed with 4% paraformaldehyde overnight, embedded in paraffin, and cut into 4-6 μm serial sections. After gradient dewaxing and hydration, antigen retrieval was performed using EDTA buffer (pH 8.0). Sections were blocked in 5% BSA for 30 minutes. Primary antibodies CD31 (1:100, Cat# sc-18916, Santa Cruz Biotechnology), Cytokeratin (1:100, Cat# c2562, Sigma; Cat# ab9377, Abcam) were diluted with 1% BSA and covered with tissue slices and incubated overnight at 4 °C. The next day, the sections were washed three times with PBS. Alexa Fluor-conjugated secondary antibodies (1:300 dilution) and DAPI (Cat #422081, BioLegend) were mixed and covered with tissue slices and incubated at room temperature for 2 hours. Washed three times with PBS, and covered with coverslips after adding anti-fluorescence quencher. Images were acquired using a laser scanning confocal microscope (LSM880, Zeiss).

[0065] 4.2.2 IVIS fluorescence imaging Tumor-draining lymph nodes and lungs were removed from tumor-bearing mice and immersed in d-luciferin (Cat # L2916, ThermoFisher Scientific) for 10 min. Tissues were then imaged using IVIS Lumina imaging (Xenogen IVISLumina System, Caliper Life Sciences) or Maestro 2 Living Imaging System (Cri Inc.). Bioluminescent flux analysis was performed using Living Image Software 3.0 (Caliper Life Sciences).

[0066] 4.2.3 HE staining of paraffin sections of lung tissue Lung tissue was removed from tumor-bearing mice, fixed with 4% paraformaldehyde overnight, embedded in paraffin, and cut into 4-6μm continuous sections. After gradient dewaxing and hydration, antigen repair was performed using EDTA buffer (pH8.0). HE staining was performed using hematoxylin and eosin staining reagent (Cat# C0105S, Beyotime). Appropriate amount of hematoxylin was added to cover the tissue slices, the nucleus was stained for 5 minutes, and the residual stain was rinsed with tap water. Rapidly differentiated with 1% hydrochloric acid alcohol, rinsed with tap water, and appropriate amount of eosin stain was added. After 30 seconds, the slices were rinsed with tap water, dehydrated and transparent, and sealed with neutral gum.

[0067] 4.3 Results 4.3.1 Flow cytometry results showed that the EO771 ALDH1 activity of the experimental group of mice treated with MOTS-c aptamer ML11-1 was significantly lower than that of the control group, P < 0.005 ( Figure 7 ). The above results indicate that the aptamers of the present invention can inhibit the stem-like characteristics of cancer cells.

[0068] 4.3.2. Immunofluorescence staining of CD31 and CK in metastatic lymph nodes showed that compared with the control group, the number of tumor cells invading lymph node blood vessels in the metastatic lymph nodes of the experimental group treated with MOTS-captamer ML11-1 was significantly reduced, P < 0.0001 ( Figure 8 ).

[0069] 4.3.3. Lung IVIS imaging and lung tissue HE staining showed that compared with the control group, the lung metastasis of mice in the MOTS-c aptamer group was significantly reduced, P<0.0001 ( Fig. 9 AB shows lung metastasis in breast cancer mice, and CD shows lung metastasis in oral squamous cell carcinoma mice).

[0070] The above results indicate that MOTS-c aptamer ML11-1 can significantly inhibit distant tumor metastasis in vivo.

[0071] From the above, it can be seen that the inventors found in the study of tumor metastasis that MOTS-c is highly expressed in cancer cells with lymph node metastasis. In in vitro experiments, MOTS-c was found to promote the stem-like characteristics of cancer cells by cell spheroid experiments and flow cytometry detection of the activity of stem cell marker ALDH1. Tumor stem cells are considered to be a cell subpopulation with strong metastatic ability. Therefore, after in vivo experiments, it was further verified that MOTS-c can promote distant organ metastasis of tumors. Studies have shown that MOTS-c is an important target for inhibiting distant metastasis of tumors, but there is currently a lack of specific inhibitors of MOTS-c. For this reason, the inhibitory aptamer of MOTS-c of the present invention is designed and constructed. The treatment of cancer cells with the aptamer can significantly inhibit the stemness characteristics of cancer cells, and the treatment of tumor-bearing mice with MOTS-c aptamers significantly improves the lung metastasis of tumor-bearing mice. The experimental results show that the aptamer constructed by the present invention has a good blocking effect on MOTS-c both in vivo and in vitro, and the aptamer has a certain therapeutic effect against tumor metastasis.

[0072] MOTS-c is a newly discovered mitochondrial peptide in recent years. It is not only widely present in a variety of tissue cells and plasma, but also shows important regulatory effects in metabolism, inflammation, oxidative stress, aging, etc. Therefore, it has become a research hotspot in recent years, especially in diabetes, obesity, neurodegenerative diseases, muscle degenerative diseases, aging and cardiovascular diseases. Our research group also found that MOTS-c has the effect of regulating cancer cell stemness and promoting distant tumor metastasis. At present, there are still many unknown effects and mechanisms of MOTS-c that need further study. The MOTS-c aptamer designed and constructed by the present invention can be used as an important scientific research tool to help the majority of relevant scientific researchers to carry out theoretical research and clarify the role and mechanism of MOTS-c. On the other hand, as a product of in vitro chemical synthesis, the aptamer has lower cost, smaller batch effect, more stable chemical properties, and is conducive to transportation and storage compared with polypeptide antibodies, and the aptamer structure is smaller and more flexible, and has better binding to some small molecules or hidden targets. Therefore, it has great potential in practical applications such as clinical treatment and diagnosis. The MOTS-c aptamer constructed by the present invention may also become a cheap and efficient drug for anti-tumor metastasis and other disease treatments in the future.

[0073] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0074] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nucleic acid aptamer targeting MOTS-c, characterized in that: The target sequence of the nucleic acid aptamer is SEQ ID NO: 1: MKWEEMGYIFL.

2. The nucleic acid aptamer according to claim 1, characterized in that The sequence of the nucleic acid aptamer is TGACACCGTACCTGCTCTGCCAAGCACGCCAAGGGACTAT, SEQ ID NO:

2.

3. A pharmaceutical composition comprising the nucleic acid aptamer according to any one of claims 1 to 2 and a pharmaceutically acceptable carrier.

4. The use of the nucleic acid aptamer according to any one of claims 1 to 2, comprising any one or more of the following: A) Application in anti-tumor metastasis drugs; B) for preparing MOTS-c detection or diagnostic reagents, kits or sensors; C) Used for preparing MOTS-c capture, separation and purification preparations; D) used in the preparation or construction of MOTS-c targeted drug delivery system; E) used to detect or evaluate tumor metastasis; The tumor includes breast cancer.

Images