Application of ELF3 gene in regulating growth of poplar terminal buds

Abstract

The application belongs to the field of genetic engineering, and particularly relates to application of an ELF3 gene in regulating growth of a poplar top bud. Through screening and testing, it is found that knocking out the ELF3 gene can achieve the technical effect of delaying growth stop and dormancy time of a tree top bud under short-day conditions and promoting tree growth.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering, and particularly relates to application of an ELF3 gene in regulating growth of a poplar apical bud. BACKGROUND

[0002] Poplar is a perennial woody plant growing in temperate zones, and dormancy is an important physiological phenomenon for poplar to cope with winter growth adversity. Studies have shown that short-day conditions in autumn can induce the apical bud of poplar to stop growing, thereby establishing dormancy. Inhibiting seasonal dormancy of poplar can help promote growth of poplar in an artificially controlled environment, thereby facilitating improvement of photosynthetic carbon fixation and biomass accumulation of trees.

[0003] Seasonal growth of the apical bud of poplar is comprehensively regulated by numerous genes, including a miR156-SPL module (PNAS, 2023, 120 (48): e2311226120), a CO / FT module (Science, 2006, 312 (5776): 1040-3), and the like. Due to the complexity of the trait, more genes regulating seasonal growth of the apical bud need to be identified, thereby providing more effective technical means for regulating growth of the apical bud.

[0004] To solve the above problems, the application provides a new method for regulating growth of the apical bud of poplar. SUMMARY

[0005] The application aims to provide a method for regulating growth of the apical bud of poplar.

[0006] To achieve the above object, the application adopts the following technical scheme:

[0007] The application provides application of an ELF3 gene in regulating growth of the apical bud and / or height and / or number of leaves of poplar under short-day conditions, characterized in that the gene comprises any one of the following:

[0008] (1) a gene represented by SEQ ID NO. 1 or SEQ ID NO. 2;

[0009] (2) a gene encoding a sequence represented by SEQ ID NO. 3;

[0010] (3) a gene numbered as Potri.006G233800 in a poplar gene database.

[0011] The application further provides a method for promoting growth of the apical bud and / or height growth and / or increase in the number of leaves of poplar under short-day conditions, characterized in that the method comprises the following steps:

[0012] (1) knocking out the above gene in poplar;

[0013] (2) selecting a plant with increased apical bud growth and / or plant height growth and / or leaf number under short-day conditions.

[0014] In some embodiments, the method for knocking out a gene described above is a gene editing method.

[0015] In some embodiments, the method for knocking out a gene described above is a CRISPR / Cas gene editing method, and the selected target sequence is AGGCTTCATGTGAATGATAC and

[0016] ACTAGCGACTTAGCTCCTAC or AGTAGCGACTTAGCTCCTAC.

[0017] The present application also provides a kit, characterized in that it comprises any one of the following:

[0018] (1) an RNA molecule capable of simultaneously recognizing the target sequences shown in AGGCTTCATGTGAATGATAC and

[0019] ACTAGCGACTTAGCTCCTAC or AGTAGCGACTTAGCTCCTAC;

[0020] (2) a DNA molecule encoding the RNA of (1);

[0021] (3) a vector expressing the RNA of (1).

[0022] In some embodiments, the kit described above further comprises a Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein.

[0023] In some embodiments, the RNA molecule described above is

[0024] GUAUCAUUCACAUGAAGCCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and

[0025] ACUAGCGACUUAGCUCCUACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.

[0026] The present application also provides the use of the kit described above in promoting apical bud growth and / or plant height growth and / or leaf number increase of poplar under short-day conditions.

[0027] The innovation and benefits of the present application are as follows: through screening tests, it is found that knocking out the ELF3 gene can achieve the technical effects of delaying the growth stop and dormancy time of tree top buds under short-day conditions and promoting tree growth. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Structure diagram of 4 photoperiod genes and gene editing target position.

[0029] Figure 2 gRNA expression cassette structure for 4 photoperiod genes.

[0030] Figure 3 PKSE401-ELF4 vector map.

[0031] Figure 4 Genotype of ELF3 edited plants.

[0032] Figure 5 Genotype of ELF4 edited plants.

[0033] Figure 6 Genotype of LUX edited plants.

[0034] Figure 7 Genotype of SPL9 edited plants.

[0035] Figure 8 Phenotype of ELF3 edited plants. 717-4: receptor control; ID70-NR9, ID70-NR11, ID70-NR12, ID70-NR15: respectively represent four edited plants elf3-9, elf3-11, elf3-12, elf3-15. SD0W, SD2W, SD4W, SD6W: respectively represent 0 weeks, 2 weeks, 4 weeks, 6 weeks after short-day treatment.

[0036] Figure 9 Phenotype of ELF4 edited plants. 717-3: receptor control; ID168-NR1, ID168-NR2, ID168-NR7: respectively represent three edited plants elf4-1, elf4-2, elf4-7. SD0W, SD2W, SD4W: respectively represent 0 weeks, 2 weeks, 4 weeks after short-day treatment.

[0037] Figure 10 Phenotype of LUX edited plants. 717-3: receptor control; ID169-NR3, ID169-NR17, ID169-NR19: respectively represent three edited plants lux1-3, lux1-17, lux1-19. SD0W, SD2W, SD4W, SD6W: respectively represent 0 weeks, 2 weeks, 4 weeks, 6 weeks after short-day treatment.

[0038] Figure 11 Phenotypes of edited plants. 717: recipient control; ID145-NR1, ID145-NR4, ID145-NR5, ID145-NR9: represent four edited plants spl9-1, spl9-4, spl9-5, spl9-9, respectively. SD0W, SD4W: represent 0 week, 4 weeks after short-day treatment, respectively. DETAILED DESCRIPTION

[0039] The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise defined, terms are to be understood according to their common use by those of ordinary skill in the appropriate field in accordance with principles of etymology, the context, and ordinary skill in the art. All patents, publications, scientific articles, and other public publications identified herein are incorporated by reference in their entirety.

[0040] In this application, the word "comprise," and variations such as "comprising," or "comprises," will be understood to mean the inclusion of whatever the described element or step might be but not excluding the inclusion of other elements or steps.

[0041] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, as customary. Amino acids can be referred to herein by either the common three letter code or by the one-letter code. Similarly, nucleotides can be referred to herein by either the common three letter code or by the one-letter code. Numeric ranges are inclusive of the numbers defining the range. As used herein, "nucleic acid" includes polynucleotides of either deoxyribonucleotides or ribonucleotides, in either single- or double-stranded form, and unless otherwise indicated, includes known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are hybridizable with nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" with respect to a specified nucleic acid sequence is intended to mean that the nucleotide sequence includes a gene sequence that, upon translation, gives rise to the specified protein. The genetic code specifies the sequences of nucleotides that, when translated in a process involving mRNA and ribosomes, result in the specified protein. As used herein, "full-length sequence" with respect to a specified polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having the natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes a full-length, catalytically active form of the specified protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used to refer to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acid. The term is also used to refer to naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise indicated, can include known analogues of natural amino acids that can function in a similar manner as the naturally occurring amino acid.

[0042] In some embodiments, the nucleotide sequences of the application can be altered to make conservative amino acid substitutions. Principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the application can be altered without changing the amino acid sequence, e.g., codons preferred by monocots can be substituted for codons encoding the same amino acid sequence without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, portions of the nucleotide sequences in the application are replaced with different codons that encode the same amino acid sequence, thereby altering the nucleotide sequence while not changing the amino acid sequence it encodes. Conservative variants include those sequences that encode the same amino acid sequence of a protein of the embodiments due to the degeneracy of the genetic code. In some embodiments, portions of the nucleotide sequences in the application are replaced according to monocot-preferred codons. Those of skill in the art will recognize that amino acid additions and / or substitutions generally are based on the relative similarity of the amino acid side chains, for example, as is shown by the hydrophilicity, charge, size, and the like. Exemplary amino acid substitution groups that take various of the foregoing considerations into account are well-known in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance in appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), incorporated herein by reference. Conservative substitutions can be made, such as replacing one amino acid with another amino acid of similar properties. Identification of sequence identity includes hybridization techniques. For example, all or a portion of a known nucleotide sequence is used as a hybridization probe to selectably hybridize to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments from a selected organism (i.e., a genomic or cDNA library). The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment, or other oligonucleotide, and can be labeled with a detectable group, such as32P, or other detectable marker. Thus, for example, a hybridization probe can be prepared by labeling a synthetic oligonucleotide based on an embodiment sequence. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. The hybridization of the sequences can be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold, 5-fold, or 10-fold background).Stringency conditions are sequence dependent, and are different under different circumstances. By controlling hybridization stringency and / or controlling wash conditions, one can identify target sequences that are 100% complementary to the probe (homologous probe method). Alternatively, one can adjust stringency conditions to allow some sequence mismatch, in order to detect lower degrees of similarity (heterologous probe method). Typically, the probe is less than about 1000 or 500 nucleotides in length. Typically, stringency conditions are conditions under which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is that at which DNA is normally melted (about 50°C for a 1 kb DNA fragment; about 60°C for a 0.1 kb DNA fragment; and about 65°C for a 0.05 kb DNA fragment). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization in 30 to 35% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 37°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 55°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 60 to 65°C. Optionally, the wash buffer can include about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, often about 4 to about 12 hours. Specificity is typically dependent on the length of the probe and the degree of mismatching, with longer probes and less mismatching being more specific. The degree of mismatching can be controlled by the length of the probe and the temperature of hybridization. The Tm (temperature of melting) of a DNA-DNA hybrid can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6(log M) + 0.41(%GC) - 0.61(%formamide) - 500 / L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "%formamide" is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is the temperature at which 50% of the complementary target sequence will hybridize with a perfectly matched probe, at the specified ionic strength and pH. Washes are typically carried out at least to the point of equilibrium, and to a low background level of hybridization, such as for 2 hours, 1 hour, or 30 minutes. Each 1% of mismatch corresponds to a decrease in Tm of about 1°C; thus, one can adjust the Tm, hybridization, and / or wash conditions to hybridize with sequences of the desired degree of identity. For example, if sequences of >90% identity are desired, one can decrease the Tm by 10°C.Generally, stringency conditions are chosen to be about 5°C lower than the Tm of specific sequence and its complement for the specified ionic strength and pH. However, under very high stringency conditions, the hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately high stringency conditions, the hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, the hybridization and / or washing can be performed at 11°C lower than the Tm.

[0043] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." As used herein, the term "about," when used in reference to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations that can occur due to reasonable expected deviations in measurement, such as variations that would occur in making such a measurement through the use of different testing equipment, or variations that occur due to differences in the manufacture and properties of the composition, nucleic acid, polypeptide, etc. being used, as such variations are known to occur in the art. Therefore, unless otherwise indicated, the numerical parameters listed in the specification and claims are approximations. Variations can occur when the compositions, nucleic acids, polypeptides, etc. are subjected to different environmental or operational conditions or are formulated with different ingredients or by different methodologies. As used herein, the term "about" is used to indicate that a value contains a reasonable amount of deviation, typically within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the stated value, as such variations are known to occur in the art.

[0044] The following examples are intended to illustrate the present application and are not intended to limit its scope. Modifications or substitutions of the methods, steps or conditions of the present application, which are apparent to those skilled in the art, are intended to fall within the scope of the present application. Unless otherwise specified, the examples are performed according to conventional experimental conditions, such as those described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2001) or according to the conditions suggested by the manufacturer. Unless otherwise specified, the chemical reagents used in the examples are conventional commercial reagents and the technical means used in the examples are conventional means known to those skilled in the art.

[0045] Example

[0046] Example 1 Knocking out Poplar photoperiod genes using gene editing technology

[0047] Since the seasonal growth of poplar apical bud is affected by photoperiod, the inventors screened genes from plant rhythm and photoperiod regulation genes that have an effect on the seasonal growth of apical bud. The genes ELF3, ELF4, LUX and SPL9 were selected for testing the seasonal growth of poplar apical bud. The homologous genes of the above genes in plants such as Arabidopsis and rice can affect flowering time and photoperiod response.

[0048] The inventors plan to use the CRISPR / Cas9 gene editing method to knock out the genes ELF3, ELF4, LUX and SPL9 respectively, and investigate the growth state of poplar apical bud after gene knockout, in order to determine the effect of the genes on the growth of apical bud.

[0049] The sequences of the genes were queried from the Phytozome database. There is one allele (Potri.006G233800) of ELF3 gene in poplar, and the inventors designed two knockout sites at the first exon. There are three alleles (Potri.008G068200, Potri.001G251600 and Potri.009G046400) of ELF4 gene in poplar, and the inventors designed four knockout sites, of which gRNA1 and gRNA2 are on Potri.008G068200; gRNA3 is on Potri.001G251600, and gRNA4 is on Potri.001G251600 and Potri.009G046400. There are two alleles (Potri.001G243600 and Potri.009G035000) of LUX gene in poplar, and the inventors designed two knockout sites at the conserved sequence of the two genes. There are three alleles (Potri.016G048500, Potri.002G142400 and Potri.014G057800) of SPL9 gene in poplar, and the inventors designed two knockout sites, of which gRNA1 is on Potri.016G048500; gRNA2 is on Potri.002G142400 and Potri.014G057800. According to the above designed knockout sites, the inventors constructed one or a plurality of gRNA expression cassettes (see the basic structure of Figure 2 ) for ELF3, ELF4, LUX and SPL9, and these gRNA expression cassettes were constructed into gene editing vectors together with Cas9 expression cassettes respectively. Among them, the vector also contains a streptomycin selection marker gene for antibiotic selection during genetic transformation, as well as a basic vector backbone (such as LB, RB, vector backbone region, etc.).

[0050] The inventors transformed the above vectors into poplar respectively, wherein the vector construction utilizes GoldenGate cloning method to construct the targeting vector (BMC Plant Biol. 2014, 14: 327), and the specific construction method is as follows:

[0051] (1) Homologous recombination targeting vector fragment PCR amplification: after the effective knockout gRNA is determined, two pairs of primers corresponding to the selected gRNA site are designed, and the homologous recombination targeting vector fragment is amplified from the intermediate vector pCBC-DT1T2 as a template by phanta enzyme, and the amplification program is 98°C for 3 min pre-denaturation, followed by 98°C for 15 s, 60°C for 30 s, 72°C for 1 min for 30 cycles, and finally 72°C for 10 min.

[0052] (2) Connect the homologous recombination targeting vector fragment to the final vector: use ECO31I endonuclease and T7 ligase for enzyme cutting and enzyme ligation reaction, 37°C reaction for 5 min (ECO31I enzyme cutting reaction) in the PCR instrument, followed by 25°C reaction for 10 min (T7 ligase ligation reaction), repeat the process for 30 cycles, and connect the amplified homologous recombination targeting vector fragment to the final vector PKSE401 (the structure of the final vector is shown by taking the ELF4 editing vector as an example). Figure 3

[0053] (3) Transform the constructed final vector into E. coli, pick several single colonies from the screening medium for colony PCR detection of positive strains, and sequence the correct band to ensure that the sequence of the target fragment is correct and has no frame shift mutation.

[0054] (4) Amplify and culture the E. coli positive strain, and extract the vector plasmid connected with the target fragment.

[0055] (5) Transform the constructed vector into GV3101 Agrobacterium and perform colony PCR detection to obtain positive strains, and transform the poplar receptor hybrid poplar Populus alba x Populus tremula (717).

[0056] The genetic transformation system of poplar mainly refers to Science. 2006, 312 (5776): 1040-3, and the main process is as follows: prepare OD 600 ​About 0.6 of Agrobacterium, dip the willow petiole explants for 30-60 min. After washing, place in the dark for about 2 days, then transfer to the differentiation medium, and change the medium every 14 days. After about 2 months, transfer to the proliferation medium, and after about a month, transfer to the rooting medium. The inoculation medium, suspension, and regeneration medium required for genetic transformation are referred to Science. 2006, 312(5776): 1040-3. Each vector infects 60 explants, and the transformed positive plants are selected to analyze the editing of the target gene.

[0057] Target gene editing detection: For each gRNA, design primers at positions 200 bp upstream and downstream, and perform amplification. First, determine whether there is a large fragment deletion. Second, design primers with adaptors to amplify the sequence around the gRNA, and then use Hi-Tom sequencing http: / / www.hi-tom.net / hi-tom / index-CH.php. Sequence 1000 reads of the PCR product amplified for each gRNA, and then organize the result file after returning the sequence, and analyze the genotype before and after editing.

[0058] ELF3 obtained 4 plants with successful target gene editing, namely elf3-9, elf3-11, elf3-12, and elf3-15( Figure 4 ); ELF4 obtained 3 plants with successful target gene editing, namely elf4-1, elf4-2, and elf4-7( Figure 5 ); LUX obtained 3 plants with successful target gene editing, namely lux1-3, lux1-17, and lux1-19( Figure 6 ); and SPL9 obtained 4 plants with successful target gene editing, namely spl9-1, spl9-4, spl9-5, and spl9-9( Figure 7 ).

[0059] Example 2: Trait investigation of gene-edited poplar

[0060] Select the plants with successful editing of the above target genes, and investigate the flower bud development after short-day treatment.

[0061] After the gene-edited and control materials were cultured under long-day conditions (16-18 h light) for 2 months, they were transferred to short-day conditions (8 h light and 16 h darkness) for treatment. The temperature of the growth environment was 22°C under light and 20°C without light. Every 5 days, the initial plant height, leaf number, and other growth indicators of the poplar seedlings under different treatments were investigated, and the change in the growth state of the terminal bud was investigated according to the scoring standard of the terminal bud growth state to obtain the bud set score data.

[0062] The bud formation score includes: 3 points (Score value is 3): vigorous growth, characterized by active growth of apical meristem, constantly producing new stipules and leaves, and the stipules are vertically upward. 2 points: stop growing, characterized by apical tissue no longer producing new stipules and leaves, and stem nodes no longer elongating, and the top end showing a reverse triangular shape. 1 point: bud formation, characterized by complete wrapping of stipules and cotyledons, and the bud scale showing green, at which time the leaves are fully expanded. 0 points: the terminal bud becomes hard and red and enters a deep dormancy state.

[0063] The results show that after knocking out the ELF3 and LUX genes, the growth of the terminal bud of the poplar is delayed, and the number of leaves and the height of the plant are increased Figure 8 and Figure 10 , indicating that knocking out the ELF3 and LUX genes can achieve the technical effect of delaying the growth stop and dormancy time of the terminal bud of the tree and promoting the growth of the tree under short-day conditions. Knocking out ELF4 and SPL9 cannot achieve the above technical effects Figure 9 and Figure 11 .

[0064] Among them, the genomic sequence of ELF3 is shown in SEQ ID NO. 1, the coding region sequence is shown in SEQ ID NO. 2, and the amino acid sequence is shown in SEQ ID NO. 3.

[0065] Although the present application has been described in detail above with general description and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.

Claims

1. The use of knocking out the ELF3 gene in regulating the growth of terminal bud and / or plant height and / or leaf number of poplar under short-day conditions, characterized in that, The gene encodes the sequence shown in SEQ ID NO.

3.

2. Use according to claim 1, characterized in that, The gene is a gene with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2, or a gene numbered as Potri.006G233800 in the Populus gene database.

3. A method of promoting apical bud growth and / or shoot height growth and / or increased leaf number in a poplar under short day conditions, characterized in that, The method comprises the following steps: (1) knocking out the gene in any one of claims 1-2 in Populus; (2) selecting a plant with increased apical bud growth and / or plant height growth and / or leaf number under short-day conditions.

4. The method of claim 3, wherein, The method for knocking out the gene is a gene editing method.

5. The method of claim 4, wherein, The method for knocking out the gene is a CRISPR / Cas gene editing method, and the selected target sequences are AGGCTTCATGTGAATGATAC and ACTAGCGACTTAGCTCCTAC.

6. Use of a kit for modulating the growth of terminal buds and / or the height and / or the number of leaves of a poplar under short-day conditions, characterized in that, The kit comprises any one of the following: (1) a combination of RNA molecules capable of simultaneously recognizing the target sequences shown in AGGCTTCATGTGAATGATAC and ACTAGCGACTTAGCTCCTAC; (2) a DNA molecule encoding the RNA of (1); (3) a vector expressing the RNA of (1).

7. Use according to claim 6, characterized in that, The kit further comprises a Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein.

8. Use according to claim 6, characterized in that, The combination of RNA molecules is a combination of sequences shown in GUAUCAUUCACAUGAAGCCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and ACUAGCGACUUAGCUCCUACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.

Images