Application of OsSCL28 gene in regulating phosphorus deficiency tolerance in rice
By knocking out the OsSCL28 gene in rice and using the CRISPR/Cas9 system to improve the phosphorus uptake capacity of rice, the problem of insufficient yield and stress resistance in rice under phosphorus-deficient environments was solved, and efficient growth and enhanced stress resistance under low phosphorus conditions were achieved.
Patent Information
- Application Number
- CN202510095775.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2045-01-22
AI Technical Summary
Rice has low phosphorus absorption efficiency during its growth process, resulting in insufficient yield and stress resistance. Existing technologies are insufficient to effectively improve its tolerance to phosphorus-deficient environments.
By knocking out the rice gene OsSCL28 or its coding sequence, gene editing vectors were constructed using the CRISPR/Cas9 system to improve rice's ability to absorb phosphorus, promote root development, and enhance stress resistance.
Under low phosphorus conditions, rice with the OsSCL28 gene knocked out showed greater tolerance to phosphorus deficiency stress, significantly increased root activity and total phosphorus content, and promoted plant height and root length, making it suitable for planting in phosphorus-poor soils.
Smart Images

Figure CN119753003B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically involving the application of the OsSCL28 gene in regulating phosphorus deficiency stress in rice. Background Technology
[0002] During rice growth, rice can absorb and utilize various nutrients, among which phosphorus is an indispensable and important nutrient. For plants, phosphate (Pi) is a major participant in many metabolic processes, including photosynthesis, respiration, energy transfer, signal transduction, and macromolecular biosynthesis. Therefore, phosphorus is one of the essential nutrients required by plants. Phosphorus mainly exists in the form of inorganic phosphate, distributed in the roots and leaves of rice, helping to promote root development, enhance resistance to pests and diseases, and improve the rice's tolerance to adverse conditions (such as drought and salinity). Phosphorus is easily fixed in the soil and relatively immobile, resulting in low availability. Therefore, phosphate fertilizers are needed in production to increase crop yield. Because plants have low access to available phosphorus from the soil, they have acquired absorbable phosphates through morphological, physiological, chemical, and molecular adaptations.
[0003] When phosphate is used as fertilizer, it readily forms insoluble complexes with oxides and hydroxides of calcium, aluminum, and iron, and is also subject to fixation by microbial activity. As a result, plant roots can only absorb 20%–30% of the applied phosphate fertilizer, with the remainder lost, ultimately leading to environmental problems such as eutrophication. Therefore, identifying genes in rice that promote phosphorus absorption and ensuring sufficient phosphorus absorption during rice growth is crucial for increasing rice yield and improving grain quality. Summary of the Invention
[0004] The purpose of this invention is to provide the application of the OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress. By knocking out the rice gene OsSCL28 from the target rice, the resulting transgenic rice exhibits higher tolerance under low phosphorus conditions, providing a guarantee for improving plant tolerance to phosphorus deficiency and cultivating new rice varieties suitable for phosphorus-poor soils.
[0005] This invention provides the application of the OsSCL28 gene in regulating phosphorus deficiency stress in rice, and the nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1.
[0006] As a preferred embodiment, the regulation involves knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome to improve the rice's tolerance to phosphorus deficiency stress.
[0007] As a preferred embodiment, the rice includes Nipponbare.
[0008] The present invention also provides a method for improving the tolerance of rice to phosphorus deficiency stress, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome;
[0009] The nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1; the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO.2.
[0010] As a preferred embodiment, the knockout method includes transforming a gene-editing vector into rice to obtain rice with improved tolerance to phosphorus deficiency stress;
[0011] The gene editing vector includes the OsSCL28 gene or the CDS sequence of the OsSCL28 gene.
[0012] The present invention also provides a gene editing vector that knocks out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene, wherein the basic backbone of the gene editing vector includes the Cas9Pubi-H vector.
[0013] As a preferred embodiment, the gene editing vector includes an sgRNA sequence;
[0014] The sgRNA sequence includes the sgRNA sequence of target 1 and the sgRNA sequence of target 2;
[0015] The nucleotide sequence of the sgRNA of target 1 is shown in SEQ ID NO.3;
[0016] The nucleotide sequence of the sgRNA of target 2 is shown in SEQ ID NO.4.
[0017] The present invention also provides a method for creating phosphorus-tolerant rice varieties, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.
[0018] This invention also provides the application of the OsSCL28 gene in regulating rice morphology, the nucleotide sequence of which is shown in SEQ ID NO.1;
[0019] The regulation involves knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome to promote the growth of rice plant height and root length.
[0020] The present invention also provides a method for promoting the growth of rice plant height and root length, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.
[0021] Beneficial Effects: This invention provides the application of the OsSCL28 gene in regulating phosphorus deficiency stress in rice. By knocking out the OsSCL28 gene from the target rice variety, the resulting transgenic rice exhibits higher tolerance under low phosphorus conditions, providing a guarantee for improving plant tolerance to phosphorus deficiency and cultivating new rice varieties suitable for phosphorus-poor soils. Simultaneously, knocking out the OsSCL28 gene can regulate the morphological characteristics of rice. The method for preparing phosphorus-deficient rice based on gene editing technology disclosed in this invention lays the foundation for the regulation of rice agronomic traits and for breeding rice under phosphorus absorption stress. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0023] Figure 1 This is a schematic diagram of the gene editing vector construction in Example 1;
[0024] Figure 2 This section shows the positive detection and knockout mutant sequence mutation information of the scl28 gene editing line in Example 1; where A represents the positive detection of the scl28 gene editing line, P represents the constructed vector bacterial solution as a positive control, N represents Nipponbare DNA as a negative control, scl28T0 represents the T0 plant of the scl28 gene editing line, and DL2000 represents a 2000bp DNA marker; B represents the mutation site information of gene editing lines scl28#1 and scl28#2, with solid inverted triangles indicating the relative position of ATG initiation, arrows indicating the insertion and deletion positions of bases, - indicating base deletion, + indicating base insertion, and the scale bar being 200bp;
[0025] Figure 3 This is a schematic diagram of the structure of the OsSCL28 gene isoforms and the detection of alternative splicing in Example 2; where A is a schematic diagram of the structure of different splice isoforms of the OsSCL28 gene, filled rectangles represent exons, thin lines represent introns, and unfilled rectangles represent 5'-UTR and 3'-UTR. Vertical arrows and "*" represent start and stop codons, respectively, with a scale bar of 200 bp. BC is the verification of OsSCL28 alternative splicing. Figure B shows spliceosome 1, with an amplification length of 732 bp. Figure C shows spliceosome 2, with an amplification length of 717 bp. Sampling sites and times include R, S, L, Inode, DBF, DF, DAF1, DAF3, DAF5, DAF7, DAF9, DAF15, and DAF25, which, from left to right, represent roots, stems, leaves, internodes, spikelets before flowering, spikelets at flowering, and spikelets on days 1, 3, 5, 7, 9, 15, and 25 after flowering. N is the negative control using ddH2O as a template, and DL5000 is a 5000 bp molecular marker.
[0026] Figure 4 Figure 2 shows the positive detection and expression level analysis of the OsSCL28 gene overexpression lines in Example 2. Figure A shows the positive detection of overexpression lines OE#1 and OE#2, where P is the constructed vector bacterial solution as a positive control, N is Nipponbare DNA as a negative control, OE#1 and OE#2 are OsSCL28 overexpression lines, and DL2000 is a 2000bp molecular marker. Figure B shows the relative expression level of the OsSCL28 gene overexpression lines, expressed as mean ± standard deviation. Each data set has three biological replicates. "*" indicates significant difference, "***" < 0.001; "**" < 0.01.
[0027] Figure 5 The figures show the morphological characteristics of plants under normal conditions and phosphorus deficiency treatment in Example 3. Figures AB show the morphological characteristics of plants under normal conditions and phosphorus deficiency treatment, with Nip being the wild type, gene editing lines being scl28#1 and scl28#2, and overexpression lines being OE#1 and OE#2. Figures A and B show the morphological characteristics of plants after 21 days of growth under normal phosphorus (200 μM) or phosphorus deficiency (0 μM) conditions, respectively, with a scale bar of 10 cm. Figures CD show root scans under normal conditions and phosphorus deficiency treatment, respectively, and Figures EF show the plant height and root length data under normal conditions and phosphorus deficiency treatment, respectively. The data are expressed as mean ± standard deviation, with three biological replicates for each group. Lowercase letters indicate the significance of expression differences between the experimental group and the control group, and different letters indicate significant differences in expression between the experimental group and the control group.
[0028] Figure 6 The physiological and biochemical indicators of plants under normal conditions and phosphorus deficiency treatment in Example 4 were measured. Figure A shows the root activity of plants under normal conditions and phosphorus deficiency treatment; Figure B shows the acid phosphatase activity of plants under normal conditions and phosphorus deficiency treatment; Figure C shows the total phosphorus content of roots of plants under normal conditions and phosphorus deficiency treatment; and Figure D shows the total phosphorus content of stems and leaves of plants under normal conditions and phosphorus deficiency treatment. Nip is wild type, the gene editing lines are scl28#1 and scl28#2, and the overexpression lines are OE#1 and OE#2. After growing for 21 days under normal phosphorus (200 μM) or phosphorus deficiency (0 μM) conditions, the physiological and biochemical indicators of the plants were measured. The data are expressed as mean ± standard deviation. Each group of data has three biological replicates. Lowercase letters indicate the significance of the expression difference between the experimental group and the control. Different letters indicate that there is a significant difference in expression between the experimental group and the control. Detailed Implementation
[0029] This invention provides the application of the OsSCL28 gene in regulating phosphorus deficiency stress tolerance in rice. The regulation involves knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome to improve the rice's phosphorus deficiency stress tolerance. The rice includes Nipponbare.
[0030]
[0031] As one specific embodiment, the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO.2: 5'-ATGGCCGGGTACCGGAGCCGGAGCCGGAGCTACAGCCCGCAGCCGCGCCGGAGGTA -3'.
[0032] The present invention also provides a method for improving the tolerance of rice to phosphorus deficiency stress, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome; the nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1; the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO.2.
[0033] As one specific embodiment, the method for improving phosphorus deficiency tolerance in rice according to the present invention includes: transferring a gene-editing vector containing the OsSCL28 gene or the CDS sequence of the OsSCL28 gene into Agrobacterium EHA105; and using an Agrobacterium-mediated transgenic method to transform the overexpression vector into the target rice genome, thereby obtaining rice with improved phosphorus deficiency tolerance. As another specific embodiment, the basic framework of the recombinant vector can be the Cas9Pubi-H vector.
[0034] In one specific embodiment, the gene editing vector includes an sgRNA sequence; the sgRNA sequence includes an sgRNA sequence of target 1 and an sgRNA sequence of target 2;
[0035] As one specific implementation, the sgRNA nucleotide sequence of target 1 is shown in SEQ ID NO.3: 5'-CGCGGTACAAGCGGTACGA-3';
[0036] As one specific implementation, the sgRNA nucleotide sequence of target 2 is shown in SEQ ID NO.4: 5'-GCTAGACGTGACTACAGGTA-3'.
[0037] As a specific implementation method, the root activity of the gene-edited lines scl28#1 and scl28#2 was higher than that of the wild-type Nip under both normal and phosphorus-deficient conditions. Under normal conditions, the root activity of the scl28#1 line was 47.13% higher than that of the wild-type, and that of the scl28#2 line was 22.26% higher. However, under phosphorus-deficient conditions, the root activity of the scl28#1 line was 161.96% higher than that of the wild-type, and that of the scl28#2 line was 38.39% higher. The measured values of the overexpression lines OE#1 and OE#2 were lower than those of the wild-type Nip.
[0038] As one specific implementation method, the acid phosphatase activity of the gene-edited lines scl28#1 and scl28#2 was significantly higher than that of the wild-type Nip, with an activity increase of approximately 3 times. The total phosphorus content in the roots of the gene-edited lines scl28#1 and scl28#2 was higher than that of the wild-type Nip under both normal and phosphorus-deficient conditions, while the total phosphorus content in the roots of the overexpression lines OE#1 and OE#2 was lower than that of the wild-type Nip under both culture conditions.
[0039] The present invention also provides a method for creating phosphorus-tolerant rice varieties, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.
[0040] This invention also provides the application of the OsSCL28 gene in regulating rice morphology, wherein the regulation involves knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome to promote the growth of rice plant height and root length; the nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1.
[0041] The present invention also provides a method for promoting the growth of rice plant height and root length, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.
[0042] As one specific implementation method, after 21 days of culture under normal conditions, the gene-edited lines scl28#1 and scl28#2 were both taller and had longer roots than the wild-type Nip. The overexpression lines OE#1 and OE#2 were shorter and had shorter roots than the wild-type Nip. After 21 days of culture under phosphorus-deficient conditions, the root lengths of the gene-edited lines scl28#1 and scl28#2 were significantly longer than those of the wild-type Nip.
[0043] To further illustrate the present invention, the application of the OsSCL28 gene provided by the present invention in regulating phosphorus deficiency stress in rice is described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0044] Unless otherwise specified, the present invention does not have special requirements for the raw materials used in the preparation, and commercially available products well known to those skilled in the art can be used.
[0045] Example 1: Construction, genetic transformation, and acquisition and identification of the OsSCL28 gene editing vector and edited line.
[0046] Gene knockout vectors were constructed using CRISPR / Cas9 technology to obtain the OsSCL28 gene editing vector, which was then transformed into the rice variety Nipponbare (rice variety "Nipponbare" [J]. Agricultural Science and Technology Communications, 1973, (02): 31.) to obtain gene-edited lines.
[0047] Includes the following steps:
[0048] 1. Construction of the OsSCL28 gene editing vector
[0049] Target design: Target design was performed using an online target design tool (http: / / skl.scau.edu.cn / targetdesign / ), selecting two target sites located in the exon regions of the target gene.
[0050] Sequence of target 1: 5'-CGCGGTACAAGCGGTACGA-3' (as shown in SEQ ID NO.3);
[0051] The sequence of target 2 is: 5'-GCTAGACGTGACTACAGGTA-3' (as shown in SEQ ID NO.4).
[0052] Vector construction: Cas9Pubi-H vector (Ma Convenient,High-EfficiencyMultiplex Genome Editing in Monocot and Dicot Plants.Mol Plant.2015Aug;8(8):1274-84.doi:10.1016 / j.molp.2015.04.007.Epub 2015Apr 24.PMID:25917172.). The vector was constructed according to the method reported by Academician Liu Yaoguang's team ([1] MaX, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants[J]. Mol Plant, 2015, 8(8): 1274-1284. [2] Lei Y, Lu L, Liu HY, et al. CRISPR-P: a web tool for synthetic single-guide RNA design of CRISPR-system in plants[J]. Mol Plant, 2014, 7(9): 1494-1496.). Figure 1 As shown, gRNA is ligated into a vector to obtain a gene editing vector.
[0053] 2. Gene editing vector genetic transformation
[0054] The constructed gene-editing vector was transformed into EHA105 competent cells. The competent cells were purchased from VediBio, catalog number: AC1010S.
[0055] The correctly constructed sequencing vector plasmid is transformed into Agrobacterium competent cells for subsequent infection and other experiments. The specific steps are as follows:
[0056] (1) Take 100 μL of Agrobacterium competent cells from the -80℃ freezer, place them on ice to melt into an ice-water mixture, add 10 μL of gene editing vector, mix well by pipetting, then freeze in liquid nitrogen for 5 min, in a water bath at 37℃ for 5 min, and then in an ice bath for 5 min.
[0057] (2) Transfer the product to a clean bench, add 600 μL of antibiotic-free LB liquid culture medium, and then revive it in a shaker at 28°C and 200 rpm for 2 h.
[0058] (3) Take 100 μL of the Agrobacterium tumefaciens bacterial suspension obtained from the above resuscitation and spread it on a solid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin resistance. Invert the plate and incubate at 28°C for 3 days.
[0059] (4) Single clones were picked from the plate and cultured in liquid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampin resistance. Positive clones were then screened by bacterial PCR. Agrobacterium containing the gene editing vector was obtained.
[0060] Genetic transformation of rice was performed using Agrobacterium containing a gene-editing vector. The rice genetic transformation reagent was prepared as follows:
[0061] 20×N6 macro-element mother liquor: 56.6g KNO3, 3.32g CaCl2·2H2O, 3.7g MgSO4·7H2O, 8g K2HPO4, 9.26g (NH4)2SO4, diluted to 1L with water.
[0062] 100×N6 trace element stock solution: 0.08g KI, 0.16g H3BO3, 0.44g MnSO4·4H2O, 0.15g ZnSO4·7H2O, diluted to 1L with water.
[0063] 100× Iron Salt Mother Liquor: 2.78g FeSO4·7H2O, 3.73g Na2·EDTA·2H2O, diluted to 1L with water.
[0064] 20×RFIII / HF macro-element mother liquor: 33g NH4NO3, 38g KNO3, 8.8g CaCl2·2H2O, 7.4g MgSO4·7H2O, 3.4g KH2PO4, diluted to 1L with water.
[0065] 100×RFIII / HF trace element stock solution: 2.23g MnSO4·4H2O, 0.86g ZnSO4·7H2O, 0.0025g CuSO4·5H2O, 0.0025g CoCl2·6H2O, 0.083g KI, 0.62g H3BO3, 0.025g NaMoO4·2H2O, diluted to 1L with water.
[0066] 20×AA macro-element mother liquor: 6g KCl, 0.3g CaCl2·2H2O, 0.5g MgSO4·7H2O, 0.3g NaH2PO4, diluted to 1L with water.
[0067] 100×B5 trace element stock solution: 0.075g KI, 0.3g H3BO3, 1g MnSO4·4H2O, 0.2g ZnSO4·7H2O, 0.025g NaMoO4·2H2O, 0.0025g CuSO4·5H2O, 0.0025g CoCl2·6H2O, diluted to 1L with water.
[0068] Organic stock solution: Inositol: 10 mg / mL, Glycine: 2 mg / mL, Nicotinic acid (VB3): 1 mg / mL, Pyridoxine hydrochloride (VB6): 1 mg / mL, Thiamine hydrochloride (VB1): 10 mg / mL.
[0069] 20×AB Buffer: 60g K2HPO4, 20g NaH2PO4, bring to a final volume of 1L with water, adjust pH to 7.2, autoclave, and store at room temperature.
[0070] 20×AB Salt: 20g NH4Cl, 6g MgSO4·7H2O, 3g KCl, 0.24g CaCl2·2H2O, 0.05g FeSO4·7H2O, bring the volume to 1L with water, autoclave, and store at room temperature.
[0071] Plant growth hormone stock solutions: 2,4-D: 5 mg / mL, KT: 1 mg / mL, 6-BA: 1 mg / mL, NAA: 1 mg / mL. Other stock solutions: Kanamycin sulfate (Kan): 50 mg / mL, Rifampin: 25 mg / mL, Acetylsyringone (AS): 100 mM, Timitin: 300 mg / mL, Hygromycin (Hyg): 50 mg / mL.
[0072] Preparation of rice genetic transformation culture medium:
[0073] AB medium: 5g glucose, 15g agar powder, bring to a final volume of 900mL, autoclave, then add 50mL AB buffer, 50mL AB salt, 1mL 50mg / mL Kan and 1mL 50mg / mL LRif, pour into plates for later use.
[0074] N6D solid culture medium: 50mL 20×N6 macro-element stock solution, 10mL 100×N6 micro-element stock solution, 10mL 100× iron salt stock solution, 10mL 10mg / mL inositol, 1mL 2mg / mL glycine, 0.5mL 1mg / mL VB3, 0.5mL 1mg / mL VB6, 0.1mL 10mg / mL VB1, 0.45mL 0.25mg / mL 2,4-D, 0.3g hydrolyzed casein, 2.878g proline, 30g sucrose, bring the volume to 1L with water, adjust the pH to 5.8, add 7g agar powder, autoclave, pour into plates for later use.
[0075] AAM liquid culture medium: 50mL 20×AA macro-element stock solution, 10mL 100×B5 micro-element stock solution, 10mL 100× iron salt stock solution, 10mL 10mg / mL inositol, 3.75mL 2mg / mL glycine, 1mL 1mg / mL VB3, 1mL 1mg / mL VB6, 1mL 10mg / mL VB1, 0.9g glutamine, 0.177g arginine, 0.3g aspartic acid, 0.5g hydrolyzed casein, 18g glucose, 20g sucrose. Bring the volume to 1L with water, adjust pH to 5.2, autoclave, and store at room temperature.
[0076] 2N6-AS solid medium: 50mL 20×N6 macro-element stock solution, 10mL 100×N6 micro-element stock solution, 10mL 100× iron salt stock solution, 10mL 10mg / mL inositol, 1mL 2mg / mL glycine, 0.5mL 1mg / mL VB3, 0.5mL 1mg / mL VB6, 0.1mL 10mg / mL VB1, 0.45mL 0.25mg / mL 2,4-D, 0.3g hydrolyzed casein, 10g glucose, 30g sucrose, bring the volume to 1L with water, adjust the pH to 5.2, add 7g agar powder, autoclave, cool, and under aseptic conditions add 1mL 100mMAS and pour into plates for later use.
[0077] N6DS solid medium: After autoclaving N6D solid medium, cool it and add 0.4 mL of 5 mg / mL 2,4-D, 1 mL of 300 mg / mL Timitin and 1 mL of 50 mg / mL Hyg under aseptic conditions, then pour into plates for later use.
[0078] REIII solid medium preparation: 50 mL 20×RFIII / HF macro-element stock solution, 10 mL 100×RFIII / HF micro-element stock solution, 10 mL 100× iron salt stock solution, 10 mL 10 mg / mL inositol, 1 mL 2 mg / mL glycine, 0.5 mL 1 mg / mL VB3, 0.5 mL 1 mg / mL VB6, 0.01 mL 10 mg / mL VB1, 30 g sucrose, bring water to a final volume of 1 L, adjust pH to 5.8, add 7 g agar powder, autoclave, cool, add 2 mL 1 mg / mL KT and 0.2 mL 1 mg / mL NAA, pour into plates for later use.
[0079] Preparation of HF solid culture medium: 50 mL of 20×RFIII / HF macro-element stock solution, 10 mL of 100×RFIII / HF micro-element stock solution, 10 mL of 100× iron salt stock solution, 10 mL of 10 mg / mL inositol, 1 mL of 2 mg / mL glycine, 0.5 mL of 1 mg / mL VB3, 0.5 mL of 1 mg / mL VB6, 0.01 mL of 10 mg / mL VB1, 30 g sucrose, bring the volume to 1 L with water, adjust the pH to 5.8, add 7 g agar powder, autoclave, pour into plates for later use.
[0080] Steps in rice genetic transformation:
[0081] (1) Callus induction: Remove the husks from rice grains, select clean and plump seeds, place them in Erlenmeyer flasks, disinfect with 70% ethanol for 1 min, discard the ethanol, and wash twice with ddH2O; add 50 mL of 25% NaClO for 20 min; discard the NaClO, and rinse 6 times with ddH2O; place the seeds on sterile filter paper to absorb surface moisture, and let stand for 20 min until the seed surface is slightly dry; place the rice seeds on N6D solid culture medium, 30 seeds per dish, and continuously irradiate at 28℃ for 9 days.
[0082] (2) Agrobacterium activation: Agrobacterium suspension containing gene editing vector was streaked onto LB solid medium (containing 50 mg / L Kan + 50 mg / L LRif) and cultured at 28°C for 3 days; 7 single colonies were picked, the suspension was resuspended in 500 μL LB, and 100 μL of the suspension was evenly spread onto AB solid medium (containing 50 mg / L Kan + 50 mg / L LRif) and cultured at 28°C for 72 h to obtain activated Agrobacterium.
[0083] (3) Callus infection: The activated Agrobacterium was washed off the AB solid medium with AAM medium, and after the bacterial suspension was fully resuspended, it was added to 20 mL of AAM liquid medium and the bacterial concentration was adjusted to OD. 680=0.10, add 20 μL of 100 mM acetylsyl syringone, 28℃, 60 rpm, 1 h. Pick out the callus tissue with good growth and place it in a sterile Erlenmeyer flask. Pour the activated Agrobacterium into the Erlenmeyer flask and gently shake the flask for 5 min. Remove the bacterial solution and place the callus tissue in a petri dish lined with sterile filter paper.
[0084] (4) Co-culture: Place one filter paper on 2N6-AS solid medium and wet the filter paper evenly with 1 mL ALAAM + 20 μL 100 mM AS solution; place the infected callus on the filter paper and co-culture for 3 days at 25°C in the dark.
[0085] (5) Screening: Collect the co-cultured callus into a sterile Erlenmeyer flask, rinse 7 times with ddH2O, rinse 3 times with ddH2O containing 300mg / L Timitin, and let stand for 5min each time; remove ddH2O, place the callus on sterile filter paper to fully absorb the moisture, and then place it on N6DS solid medium and irradiate at 28℃ for 2 weeks.
[0086] (6) Induction of differentiation: The resistant callus was transferred to REIII solid medium, and after 2 weeks of light exposure at 32°C, green seedlings differentiated.
[0087] (7) Inducing rooting: After the seedlings emerge, they are transferred to HF solid medium. When the seedlings grow to about the height of a bottle cap, ddH2O is added to harden them off, and positive tests and transplanting are carried out.
[0088] 3. Acquisition and Identification of Editing Department
[0089] Take the tender leaves of the plant obtained in step 2. Extract DNA (Lu Yaci. Research progress on plant DNA extraction methods [J]. Examination Weekly, 2011, (57): 176-177.). Detect positive results by PCR. Rice containing the Cas9 gene is positive. It is named the gene-edited line scl28T0.
[0090] The primers for PCR identification are:
[0091] Forward primer Cas9-F1: 5'-TATCCCTCACCAGATCCACC-3' (as shown in SEQ ID NO.5);
[0092] Reverse primer Cas9-R1: 5'-AGCACCCTTGTCAACAACCT-3' (as shown in SEQ ID NO.6).
[0093] The PCR reaction system was as follows: 2 μL of the plant DNA sample to be tested, 0.5 μL of primers Cas9-F1 and 0.5 μL of primers Cas9-R1, 10 μL of PCR Master Mix, and ddH2O to make up to 20 μL.
[0094] The amplification enzyme used in PCR was PCR Master Mix, purchased from Yisheng Biotechnology Co., Ltd., catalog number: 10102ES03.
[0095] The PCR reaction program was as follows: 98℃ pre-denaturation for 5 min; 98℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ final extension for 5 min; and storage at 4℃.
[0096] Screening of positive plants in transgenic rice with scl28T0 gene editing ( Figure 2 (A). Positive scl28T0 gene-edited transgenic rice was further propagated to obtain T1 transgenic rice. Sequencing analysis revealed the gene-edited lines scl28#1 and scl28#2. Figure 2 (See SEQ ID NO. 7). In gene editing line scl28#1, the 75th base G, starting with ATG, is deleted, and the interval between bases 2596 and 2597 is inserted with a T. In gene editing line scl28#2, the six bases between bases 71 and 76 (CGCGGT), starting with ATG, are deleted, and the 16 bases between bases 2594 and 2610 (CTAGACGTGACTACAG) are deleted (as shown in SEQ ID NO. 7). These insertions or deletions result in frameshift mutations in the open reading frame, preventing OsSCL28 from being translated into the normal protein sequence and thus from performing its original protein function.
[0097] Example 2: Construction of OsSCL28 gene overexpression vector, genetic transformation, and acquisition of edited lines
[0098] Analysis of the OsSCL28 gene, integrating data from the National Rice Data Center, RAP, and NCBI websites, revealed the potential existence of two splice isoforms: splice variant 1 (as shown in SEQ ID NO. 8) and splice variant 2 (as shown in SEQ ID NO. 9). The full-length coding region of these two isoforms... Figure 3 (A). To verify the authenticity of the two spliceosomes, cDNA from tissue samples at various growth stages of Nipponbare was amplified using primer sequences as templates.
[0099] CDS.1 / 2-F: 5'-ATGGCCGGGTACCGGA-3' (shown in SEQ ID NO.10);
[0100] CDS.1-R: 5'-TCAGCTTTTCCCATCAACTGG-3' (as shown in SEQ ID NO.11);
[0101] CDS.2-R: 5'-TCAACGGCGTATCAGGATATG-3' (as shown in SEQ ID NO.12).
[0102] The nucleotide sequence of spliceosome 1 is as shown in SEQ ID NO.8: 5'-ATGGCCGGGTACCGGAGCCGGAGC CGGAGCTACAGCCCGCAGCCGCGCCGGAGGTACAGCCGGAGCCCCCCGCGGTACAAGCGGTACGATGACCCGCGCGACCGCTATCCTCGCGGCGGAGGTGGAGGTGGAGGTGGAGGCGAAGGGCCCCGCCGCGGGTATGGCCGGCCGCCTGCGCCGACCGGGCTCCTCGTCCGCAACATCTCGCTCACCGCAAGGCCTGAAGATATTCGTATTCCGTTTGAGCAATTTGGCCCT GTAAAGGATGTCTACCTTCCAAGAAATTTCCATACAAGGGAATTACGTGGCTTTGGGTTTGTAAAATTCCGCTATCCAGAAGATGCTGCAGTGGCCAAGCAAGAATTGAATCATCAAGTTATTGGTGGACGAGAGATTTCAATAGTTTTTGCCGAGGAGAACAGAAAAACCCCACAAGAAATGCGGATGAGGACAAGAACAAGTGGAAGATACATGGATGGTAGCCACAGAAGGCGGTCAGTATCAAGATCTCCAAGGTCTCGTTACCATTCTTATTCACCTTCACCCTCTCCAGCTAGACGTGACTACAGGGATCACCGTGATGATTATTCACCTGGGGAATCACTCTCTCCACATGGTCAGGACAAGCGGCACCACAGATCAAATGGTCGATCTGCTAGCCCAGATGAGCTCGAGCGTCATGTATCTCCATCCAATAATGGACATGGTCCTCCAGTTGATGGGAAAAGCTGA-3';
[0103] The nucleotide sequence of spliceosome 2 is shown in SEQ ID NO.9: 5'-ATGGCCGGGTACCGGAGCCGGAGC-3'.
[0104] Successfully amplified spliceosome 1 ( Figure 3 (B), but spliceosome 2 could not be amplified in any tissue. Figure 3 (C). The above results indicate that only splice isomer 1 exists in real Nipponbare rice.
[0105] To investigate whether the expression level of OsSCL28 affects the morphological characteristics of rice, the spliceosome OsSCL28.1 (spongeotype 1 of the OsSCL28 gene) was overexpressed using the overexpression binary vector pUN1301. The spliceosome OsSCL28.1 fragment was inserted between the EcoRI restriction sites to obtain the plasmid pUN1301-OsSCL28. Overexpression lines of the OsSCL28.1 spliceosome with Nipponbare as the background were obtained through plant tissue culture (see Example 1 for specific steps). (OE#1 and OE#2 are shown in the figure). The plant tissue culture steps were the same as in Example 1. Positive T0 overexpression plants were identified by PCR, and their seeds were harvested and used for multiple generations to obtain T1 plants. Subsequently, qRT-PCR was used to screen plants with relatively high expression levels from the T1 lines. Figure 4 The amplification enzyme used in quantitative real-time PCR was SYBR Green qPCRMaster Mix, purchased from Yisheng Biotechnology Co., Ltd., catalog number: 11201ES08. The primer sequences used were:
[0106] qRT-PCR-OsSCL28-F: 5'-GAATCACTCTCTCCACATGGTCA-3' (as shown in SEQ ID NO.13); qRT-PCR-OsSCL28-R: 5'-GATGGAGATACATGACGCTCG-3' (as shown in SEQ ID NO.14).
[0107] The quantitative PCR reaction program was as follows: pre-denaturation at 95℃ for 5 min; amplification reaction stage: 95℃ for 15 s, 55℃ for 30 s, 72℃ for 45 s, with amplification cycle number of 40; melting curve: 95℃ for 15 s, 65℃ for 60 s, 95℃ for 15 s.
[0108] Example 3: OsSCL28 gene regulates rice morphological characteristics and morphological characteristics in response to phosphorus deficiency stress.
[0109] Wild-type (Nip), gene-edited lines (scl28#1 and scl28#2), and overexpression lines (OE#1 and OE#2) were cultured using complete rice culture medium.
[0110] The specific steps are as follows:
[0111] 1. Seed germination treatment:
[0112] Select plump rice seeds, immerse them in a 10% H2O2 solution for 30 minutes to disinfect them, rinse them repeatedly with deionized water, and then soak them in ddH2O in a glass bottle for 24 hours.
[0113] When the seeds begin to sprout, they are germinated in a 37°C constant temperature incubator for 48 hours, and then placed in an artificial climate chamber for growth.
[0114] Seeds with uniform germination potential were selected and placed in a 96-well hydroponic box, where they were cultured using the complete culture medium from the International Rice Research Institute.
[0115] 2. Cultivation Methods
[0116] The experiment used hydroponic culture.
[0117] The complete nutrient solution culture (using the complete culture solution formula of the International Rice Research Institute) consisted of: 1.43 mmol / L NH4NO3, 0.32 mmol / L NaH2PO4 (200 μM), 0.34 mmol / L K2SO4, 1.00 mmol / L CaCl2, 1.70 mmol / L MgSO4, 9.10 μmol / L MnCl2, 0.52 μmol / L (NH4)6MoO4, 18.00 μmol / L H3BO3, 0.15 μmol / L ZnSO4, 0.16 μmol / L CuSO4, 36.00 μmol / L FeCl3, and 70.00 μmol / L citric acid.
[0118] After culturing in 1 / 2 concentration nutrient solution for 3 days, culture was then carried out in complete nutrient solution.
[0119] After 7 days of continued cultivation, when the seedlings reached the 3-leaf stage, they were subjected to normal treatment (phosphorus concentration in nutrient solution 200 μM) and phosphorus deficiency (phosphorus concentration in nutrient solution 0 μM) stress treatment, and cultured in a 15L hydroponic incubator.
[0120] Fourteen seedlings were planted for each material, and rice seedlings were fixed with sponges, with three biological replicates.
[0121] Rice seedlings were placed in an artificial climate chamber with daytime / nighttime temperatures controlled at 28℃ / 23℃ and a photon flux density of 600 μmol / (m²). 2 •s), with a light cycle of 14h.
[0122] Change the nutrient solution every 7 days, with a pH of 5.50. Swap the positions of the pots each time the nutrient solution is changed to eliminate marginal effects.
[0123] 3. Morphological characteristics determination
[0124] Plant traits were assessed 21 days after stress treatment (normal treatment (200 μM phosphorus concentration in nutrient solution) as the control group, and phosphorus deficiency treatment (0 μM phosphorus concentration in nutrient solution) as the stress treatment group). The assessed indicators included aboveground plant height and underground root length. The plant root system was scanned using a scanner.
[0125] The results are as follows Figure 5As shown in Table 1, after 21 days of culture under normal conditions, the gene-edited lines scl28#1 and scl28#2 were both taller and had longer roots than the wild-type Nip. Conversely, the overexpression lines OE#1 and OE#2 were shorter and had shorter roots than the wild-type Nip. Particularly after 21 days of culture under phosphorus-deficient conditions, the root lengths of the gene-edited lines scl28#1 and scl28#2 were significantly longer than those of the wild-type Nip.
[0126] Table 1. Plant height and root length under normal conditions and phosphorus deficiency treatment.
[0127]
[0128]
[0129] Example 4: Determination of physiological and biochemical parameters of the OsSCL28 gene under phosphorus deficiency induction
[0130] Wild-type (Nip), gene-edited lines (scl28#1 and scl28#2), and overexpression lines (OE#1 and OE#2) were cultured according to the culture method used in Example 3 (normal treatment (phosphorus concentration in nutrient solution 200 μM) as the control group, and phosphorus-deficient treatment (phosphorus concentration in nutrient solution 0 μM) as the stress treatment group). Samples were taken 21 days after stress treatment for determination of plant physiological and biochemical indicators.
[0131] Root activity was determined using the TTC reduction method. (YAMAUCHIT.WATANABE K.FUKAZAWAA, et al. Ethylene and reactive oxygen species are involved in root aerenchyma formation and adaptation of wheat seedlings to oxygen-deficient conditions[J]. Journal of Experimental Botany, 2014, 65(1):261-273.)
[0132] Acid phosphatase activity was determined using the disodium p-nitrophenyl phosphate method. (Yan Kuan, Wang Changquan, Li Huanxiu, et al. Effects of phosphorus level on acid phosphatase activity in the roots of hybrid rice and its parents [J]. Chinese Journal of Rice Science, 2010, 24(1): 43-48)
[0133] The total phosphorus content of rice aboveground parts and roots was determined by the molybdenum antimony colorimetric method. (She Bingyu, Xing Ai, Wang Zegang, et al. Study on the role of OsGRF1 gene in the morphological and physiological response of rice to low phosphorus stress [J]. Journal of Yangzhou University (Agricultural and Life Sciences Edition). 2023, 44(01): 8-20, 28)
[0134] See results Figure 6 As shown in Table 2, after culturing for 21 days under normal (200 μM phosphorus concentration in nutrient solution) and phosphorus-deficient (0 μM phosphorus concentration in nutrient solution) conditions, the root activity of all lines was significantly lower under phosphorus-deficient conditions than under normal conditions, decreasing by approximately 50% overall. The root activity of the gene-edited lines scl28#1 and scl28#2 was higher than that of the wild-type Nip under both normal and phosphorus-deficient conditions. Under normal conditions, the root activity of scl28#1 was 47.13% higher than that of the wild-type, and that of scl28#2 was 22.26% higher. However, under phosphorus-deficient conditions, the root activity of scl28#1 was 161.96% higher than that of the wild-type, and that of scl28#2 was 38.39% higher. The measured values for the overexpression lines OE#1 and OE#2 were both lower than those of the wild-type Nip. After culturing for 21 days under both normal and phosphorus-deficient conditions, the acid phosphatase activity of all lines was significantly higher under phosphorus-deficient conditions than under normal conditions. Particularly after 21 days of culture under phosphorus-deficient conditions, the acid phosphatase activity of the gene-edited lines scl28#1 and scl28#2 was significantly higher than that of the wild-type Nip, with an activity increase of approximately three times. Furthermore, regarding total phosphorus content, after 21 days of culture under both normal and phosphorus-deficient conditions, the total phosphorus content of all lines was significantly lower under phosphorus-deficient conditions than under normal conditions, only around 1 g / kg. The total phosphorus content in the roots of the gene-edited lines scl28#1 and scl28#2 was higher than that of the wild-type Nip under both culture conditions, but there was no difference in the total phosphorus content in the stems and leaves under low phosphorus conditions. The total phosphorus content in the roots of the overexpression lines OE#1 and OE#2 was lower than that of the wild-type Nip under both culture conditions, but there was no difference in the total phosphorus content in the stems and leaves.
[0135] Table 2. Determination of physiological and biochemical indicators of plants under normal conditions and phosphorus deficiency treatment.
[0136]
[0137]
[0138] Therefore, this invention, by knocking out the OsSCL28 gene from the target rice variety, produces transgenic rice with higher tolerance to low phosphorus conditions, providing a guarantee for improving plant tolerance to phosphorus deficiency and cultivating new rice varieties suitable for phosphorus-poor soils. Simultaneously, knocking out the OsSCL28 gene can regulate the morphological characteristics of rice. The method for preparing phosphorus-deficient rice based on gene editing technology disclosed in this invention lays the foundation for the regulation of rice agronomic traits and for breeding rice under phosphorus uptake stress.
[0139] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Application of OsSCL28 gene in regulating phosphorus deficiency stress tolerance in rice, characterized in that, The nucleotide sequence of the OsSCL28 gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The regulation is to improve the phosphorus deficiency stress tolerance of the rice after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.
3. Use according to claim 1, characterized in that, The rice includes Nipponbare.
4. A method for improving the ability of rice to tolerate phosphorus deficiency stress, characterized in that, The method comprises the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome. The nucleotide sequence of the OsSCL28 gene is shown as SEQ ID NO. 1; and the nucleotide sequence of the CDS of the OsSCL28 gene is shown as SEQ ID NO.
2.
5. The method of claim 4, wherein, The knocking out method comprises transforming a gene editing vector into the rice to obtain the rice with improved phosphorus deficiency stress tolerance. The gene editing vector comprises the OsSCL28 gene or the CDS sequence of the OsSCL28 gene.
6. The method of claim 5, wherein, The basic skeleton of the gene editing vector comprises a Cas9Pubi-H vector.
7. The method of claim 6, wherein, The gene editing vector comprises an sgRNA sequence. The sgRNA sequence comprises an sgRNA sequence of target 1 and an sgRNA sequence of target 2. The nucleotide sequence of the sgRNA of the target 1 is shown as SEQ ID NO.
3. The nucleotide sequence of the sgRNA of the target 2 is shown as SEQ ID NO.
4.
8. A method for creating phosphorus-tolerant rice varieties, characterized in that, The method comprises the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome. The nucleotide sequence of the OsSCL28 gene is shown as SEQ ID NO. 1; and the nucleotide sequence of the CDS of the OsSCL28 gene is shown as SEQ ID NO.
2.
9. Use of OsSCL28 gene in regulating rice morphology, characterized in that, The nucleotide sequence of the OsSCL28 gene is shown as SEQ ID NO.
1. The regulation is to promote the growth of the plant height and root length of the rice after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.
10. A method of promoting growth of plant height and root length in rice plant, characterized by, The method comprises the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome. The nucleotide sequence of the OsSCL28 gene is shown as SEQ ID NO. 1; and the nucleotide sequence of the CDS of the OsSCL28 gene is shown as SEQ ID NO. 2.
Citation Information
Patent Citations
Rape BnaA09.SCL28 gene as well as promoter and application thereof
CN120350027A