A method for improving the content of tanshinone in salvia miltiorrhiza plants by editing a CPS5 gene of salvia miltiorrhiza

Abstract

The application provides a method for improving the content of tanshinone in salvia miltiorrhiza plants based on editing salvia miltiorrhiza CPS5 genes. The application is helpful to reduce the metabolic flow diversion of the tanshinone synthesis pathway to other secondary metabolites, positively regulate the expression of the key enzyme coding gene of tanshinone synthesis, improve the biosynthesis of tanshinone in salvia miltiorrhiza plants, and will not cause harm to the growth and development of plants by performing sequence analysis on the exons of salvia miltiorrhiza CPS5 genes and targeting knockout of the exons of salvia miltiorrhiza CPS5 genes based on a CRISPR / Cas9 system. The method provided by the application has important significance for the gene editing breeding and production of rare natural secondary metabolites of salvia miltiorrhiza, and provides a train of thought for the breeding and improvement of salvia miltiorrhiza.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant gene editing, and particularly relates to a method for improving tanshinone content in Salvia miltiorrhiza plants based on editing a Salvia miltiorrhiza CPS5 gene. BACKGROUND

[0002] To date, more than 40 tanshinones and structurally related compounds have been identified in the medicinal plant Salvia miltiorrhiza Bunge, such as cryptotanshinone (CPT), tanshinone IIA (Tan IIA), dihydrotanshinone I (DHT), and tanshinone I (Tan I), which have pharmacological activities, such as vasodilatory and antiarrhythmic effects. The biosynthesis of tanshinones begins with the cyclization of (E,E,E)-farnesyl diphosphate (GGPP) into caryophyllene diphosphate (CPP) by farnesyl diphosphate synthase (CPS1), followed by further cyclization and rearrangement into prototanshinone diene by KSL1 synthase.

[0003] The market demand for tanshinones is large, but the biosynthesis is difficult, so the extraction of tanshinones from natural Salvia miltiorrhiza is still the mainstream method. However, the available resources of Salvia miltiorrhiza are limited, and the content of tanshinones in natural wild Salvia miltiorrhiza is low. Therefore, how to obtain Salvia miltiorrhiza hairy roots or regenerated plants with sufficient tanshinone content has become one of the research hotspots in this field.

[0004] In recent years, researchers have been committed to exploring and studying key enzyme genes that regulate tanshinone biosynthesis using various analytical methods. There are fewer studies on the competitive pathway of tanshinone synthesis. Therefore, it is urgent to develop a method for knocking out the genes of the competitive branch of tanshinone synthesis based on gene editing means and obtaining Salvia miltiorrhiza plants with high tanshinone content, which is an effective attempt to further cultivate high-yield and high-quality Salvia miltiorrhiza varieties. SUMMARY

[0005] The present application provides a method for improving tanshinone content in Salvia miltiorrhiza plants by knocking out the Salvia miltiorrhiza CPS5 gene.

[0006] The present application provides a method for improving tanshinone content in Salvia miltiorrhiza plants by knocking out the Salvia miltiorrhiza CPS5 gene.

[0007] The nucleotide sequence provided by the application is a DNA fragment as shown in SEQ ID NO:1, which is an exon partial sequence of Salviamiltiorrhiza copalyl diphosphate synthase 5, and by targeting knockout of the above DNA fragment, the metabolic flow of tanshinone synthesis pathway is reduced to other secondary metabolites, the expression of tanshinone synthesis key enzyme coding gene is positively regulated, the biosynthesis of tanshinone in Salvia plants is improved, and the plant growth and development is not harmed.

[0008] The second aspect of the application provides application of the substance for targeting knockout of the above DNA fragment in improving tanshinone content in Salvia plants.

[0009] The third aspect of the application provides sgRNA for targeting knockout of the above DNA fragment, and the sgRNA includes sgRNA1 and sgRNA2, wherein the nucleotide sequence of the target sequence of the sgRNA1 is as shown in SEQ ID NO:2, and the nucleotide sequence of the target sequence of the sgRNA2 is as shown in SEQ ID NO:3.

[0010] The fourth aspect of the application provides a CRISPR / Cas9 system including the above sgRNA.

[0011] The fifth aspect of the application provides a DNA molecule encoding the above sgRNA or CRISPR / Cas9 system.

[0012] The sixth aspect of the application provides a recombinant expression vector including the above DNA molecule.

[0013] The seventh aspect of the application provides a recombinant transformant including the above recombinant expression vector.

[0014] The eighth aspect of the application provides application of the above sgRNA or CRISPR / Cas9 system in improving tanshinone content in Salvia plants.

[0015] The ninth aspect of the application provides a method for improving tanshinone content in Salvia plants, including:

[0016] constructing a CRISPR / Cas9 system, the CRISPR / Cas9 system including sgRNA for targeting the above DNA fragment, and the sgRNA includes sgRNA1 and sgRNA2, wherein the nucleotide sequence of the target sequence of the sgRNA1 is as shown in SEQ ID NO:2, and the nucleotide sequence of the target sequence of the sgRNA2 is as shown in SEQ ID NO:3;

[0017] The CRISPR / Cas9 system is used to knock out the above-mentioned DNA fragment in the genome of the recipient Danshen plant, and a positive Danshen plant with a tanshinone content higher than that of the recipient Danshen plant is screened to improve the tanshinone content in the Danshen plant.

[0018] The tenth aspect of the present application provides a method for cultivating a Danshen plant, comprising:

[0019] The CRISPR / Cas9 system is constructed, and the CRISPR / Cas9 system comprises sgRNA targeting the above-mentioned DNA fragment, and the sgRNA comprises sgRNA1 and sgRNA2, wherein the nucleotide sequence of the target sequence of the sgRNA1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence of the sgRNA2 is shown in SEQ ID NO: 3.

[0020] The CRISPR / Cas9 system is used to knock out the above-mentioned DNA fragment in the genome of the recipient Danshen plant, and a positive Danshen plant with a tanshinone content higher than that of the recipient Danshen plant is screened.

[0021] Further, the obtaining step of the above-mentioned positive Danshen plant comprises: step 1, cultivating to obtain Danshen aseptic seedlings; step 2, designing sgRNA molecules complementary to target genes to guide Cas9 proteins to reach specific gene sites; step 3, constructing a recombinant expression vector for expressing the CRISPR / Cas9 system; step 4, using an agrobacterium-mediated genetic transformation method, introducing the constructed recombinant expression vector into agrobacteria, and using the agrobacteria successfully introducing the recombinant expression vector to infect leaves derived from the Danshen aseptic seedlings, and using plant tissue culture technology to generate transgenic plants; and step 5, extracting genomic DNA in the T0 generation plant seedling stage, and screening successfully transformed plants through positive detection.

[0022] In the present application, tanshinone specifically refers to tanshinone compounds, and specifically includes at least one of cryptotanshinone (CPT), tanshinone I (Tan I), tanshinone IIA (Tan IIA) and dihydrotanshinone I (DHT).

[0023] In the present application, the CPS5 gene of Danshen is knocked out by using a gene editing technology, the edited Danshen plant phenotype has no obvious difference from the wild type, but the tanshinone content is obviously improved, and the function of the target gene is further verified and the breeding application of the metabolic product is realized. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The sequencing peak graph of the CPS5 gene editing positive seedling of Danshen is shown in the following figure;

[0025] Figure 2A is the content determination result of cryptotanshinone (CPT); B is the content determination result of dihydrotanshinone I (DHT); C is the content determination result of tanshinone I (Tan I); D is the content determination result of tanshinone IIA (Tan IIA). DETAILED DESCRIPTION

[0026] To make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the protection scope of the present application.

[0027] The Agrobacterium tumefaciens EHA105 used in the following embodiments was purchased from Shanghai Weidi Biotechnology Co., Ltd., with the item number AC1013; the plasmid pCAMBIA1300 was purchased from Addgene Co., Ltd., with the item number 44183.

[0028] Example 1, obtaining of tanshinone CPS5 gene knockout positive plants

[0029] Step 1, culturing of tanshinone sterile seedlings

[0030] The tanshinone seeds were soaked in 0.1% mercuric chloride solution for 10 min, washed with sterile water for 3-4 times, the surface water was absorbed, the seeds were evenly distributed on 1 / 2MS solid medium, and cultured at 22℃ with 16h / 8h (light / dark) light, and tanshinone sterile seedlings were obtained after 3 weeks;

[0031] Step 2, sgRNA design

[0032] The sgRNA was designed according to the partial sequence of the CDS region of the tanshinone CPS5 gene (the nucleotide sequence is shown as SEQ ID NO: 1), the sgRNA included sgRNA1 and sgRNA2, the nucleotide sequence of the editing target point corresponding to sgRNA1 was shown as SEQ ID NO: 2, and the nucleotide sequence of the editing target point corresponding to sgRNA2 was shown as SEQ ID NO: 3.

[0033] SEQ ID NO: 2 is specifically 5'-CCAAGGTGCGTTTATCAATT-3';

[0034] SEQ ID NO: 3 is specifically 5'-CGGTCGATGCTGCGCTCCAT-3'.

[0035] Step 3, gene editing vector construction

[0036] The sgRNA coding sequence and Cas9 protein coding sequence (the amino acid sequence of Cas9 protein is shown as SEQ ID NO: 4) expression unit was inserted into the Kpn I and BamH I enzyme cutting sites of pCAMBIA1300. Whether the sgRNA and Cas9 coding sequence was correctly inserted into the vector was verified by PCR and sequencing. The constructed vector was propagated in bacteria and plasmid DNA was extracted, which was used for subsequent stable genetic transformation of Salvia miltiorrhiza plants.

[0037] Step 4, stable genetic transformation and regeneration of Salvia miltiorrhiza plants

[0038] The constructed gene editing vector was introduced into the EHA105 Agrobacterium strain, and the strain was activated. The leaves of the Salvia miltiorrhiza sterile seedlings obtained in step 1 were subjected to micro-wound treatment, and then immersed with the Agrobacterium into which the gene editing vector was introduced, so as to introduce the exogenous gene into the plant cells. The immersed plant tissues were co-cultured, and then subjected to degerming treatment to remove the Agrobacterium. The callus containing the exogenous gene was screened using a culture medium containing a selection resistance, and then the differentiation and regeneration of these tissues into plants were promoted.

[0039] Step 5, genomic DNA was extracted from the regenerated Salvia miltiorrhiza plant seedlings, PCR amplification was performed using the PCR primers shown in Table 1 by KOD enzyme, the amplification reaction system is shown in Table 2, and whether the band size of the amplification product conforms to the observation was observed, and further selection of successfully transformed Salvia miltiorrhiza plants was performed.

[0040] Table 1 PCR primers

[0041] Primer name Primer sequence (5'-3') Forward Primer 1 atcggcctggacatcggcaccaac Reverse Primer 1 cgtagccgttcttgctctggtcgaagaaaatc

[0042] Table 2 KOD enzyme PCR amplification reaction system

[0043] dNTPs 5 μL 10 x buffer 5 μL Mg 2+ ]]> 2 μL Forward Primer 1 1 μL Reverse Primer 1 1 μL Salvia miltiorrhiza genomic DNA 1 μL KOD plus 1 μL ddH2O 34 μL

[0044] Step 6, identification of Salvia miltiorrhiza CPS5 gene editing knockout positive seedlings.

[0045] Specific primers shown in Table 3 were designed at 200-300 bp upstream and downstream of each target site, and a fragment with a target sequence was amplified using a high-fidelity polymerase. After gel recovery and purification of the PCR product, Sanger sequencing was performed, and the sequencing results were analyzed using software.

[0046] Table 3 PCR primer design

[0047] Primer name Primer sequence (5'-3') F2 GCCAGTGATAAAGTGGCACGAGATT R2 ATGTAGGTCCCAAGATGTCAAGGCTA

[0048] The sequencing results are as follows Figure 1As shown, 3 positive Salvia miltiorrhiza plants were screened, and numbered as smcps5-1#, smcps5-2# and smcps5-3# respectively, and the mutation sites are as shown in Figure 1 As shown.

[0049] Step 7, identification of target traits of Salvia miltiorrhiza CPS5 positive edited Salvia miltiorrhiza plants

[0050] The Salvia miltiorrhiza CPS5 positive edited Salvia miltiorrhiza plants were transplanted into culture flowerpots with a ratio of 1:1 of nutrient soil and vermiculite, and cultured at 22℃ with 16h / 8h (light / dark) light, and fertilizers were applied regularly, and after 8 months, the roots of wild type and Salvia miltiorrhiza CPS5 gene knockout positive Salvia miltiorrhiza plants were taken, and after vacuum freeze-drying and powdering, tanshinone was extracted with anhydrous methanol, and the content of tanshinone compounds was measured by liquid chromatography-high throughput triple quadrupole mass spectrometry (TQ-Absolute).

[0051] The determination results are as shown in Figure 2 As can be seen from the table, the content of tanshinone in the Salvia miltiorrhiza plants with the Salvia miltiorrhiza CPS5 gene knocked out is significantly improved, which indicates that knocking out the Salvia miltiorrhiza CPS5 gene reduces the metabolic flow of tanshinone to the plant gibberellin pathway, thereby improving the content of tanshinone in the Salvia miltiorrhiza plants. Therefore, the knockout of the Salvia miltiorrhiza CPS5 gene in the present application can be used to improve the content of tanshinone in the Salvia miltiorrhiza plants.

[0052] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement to part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A sgRNA targeting a DNA fragment or a CRISPR / Cas9 system comprising the sgRNA for use in increasing the content of tanshinones in Salvia miltiorrhiza plants, characterized in that, the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 1; the sgRNA comprises sgRNA1 and sgRNA2, wherein the nucleotide sequence of the target sequence of the sgRNA1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence of the sgRNA2 is shown in SEQ ID NO:

3.

2. A method for increasing the content of tanshinone in Salvia miltiorrhiza plants, characterized in that, comprising: constructing a CRISPR / Cas9 system comprising a sgRNA targeting the DNA fragment of claim 1, wherein the sgRNA comprises sgRNA1 and sgRNA2, and the nucleotide sequence of the target sequence of the sgRNA1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence of the sgRNA2 is shown in SEQ ID NO: 3; using the CRISPR / Cas9 system to knock out the DNA fragment of claim 1 in the genome of a recipient Salvia miltiorrhiza plant, and screening to obtain positive plants with a higher content of tanshinones than the recipient Salvia miltiorrhiza plant, thereby increasing the content of tanshinones in Salvia miltiorrhiza plants.

3. A method for breeding Salvia miltiorrhiza plant, characterized in that, comprising: constructing a CRISPR / Cas9 system comprising a sgRNA targeting the DNA fragment of claim 1, wherein the sgRNA comprises sgRNA1 and sgRNA2, and the nucleotide sequence of the target sequence of the sgRNA1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence of the sgRNA2 is shown in SEQ ID NO: 3; using the CRISPR / Cas9 system to knock out the DNA fragment of claim 1 in the genome of a recipient Salvia miltiorrhiza plant, and screening to obtain positive Salvia miltiorrhiza plants with a higher content of tanshinones than the recipient Salvia miltiorrhiza plant.

Images