Application of SNP genetic marker related to freezing tolerance of pig sperm in pig breeding

By screening for the SNP genetic marker g.119750378A>C in the PPP3CA gene, the problem of poor quality of frozen semen in boars was solved, resulting in improved quality and enhanced economic benefits.

CN119753155BActive Publication Date: 2025-12-05SHANGHAI ACAD OF AGRI SCI +1
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202411414545.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-11
Publication Date
2025-12-05
Estimated Expiration
2044-10-11

AI Technical Summary

Technical Problem

In current technologies, the quality of frozen semen from boars is poor, and existing SNP genetic markers mainly focus on fresh semen motility, lacking relevant research on improving frozen semen quality.

Method used

Genetic breeding was carried out using the SNP genetic marker g.119750378A>C in the PPP3CA gene to screen boars with higher sperm freeze resistance. The genotype was detected by PCR amplification and sequencing, and individuals with the AA genotype were preferentially selected.

Benefits of technology

Significantly improve the quality of frozen semen from boars, increase the utilization rate of high-quality boars, and maximize the economic benefits of pig farming enterprises.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119753155B_ABST
    Figure CN119753155B_ABST
Patent Text Reader

Abstract

The application provides application of a SNP genetic marker in a PPP3CA gene related to freezing tolerance of pig sperm in pig genetic breeding, and belongs to the technical field of pig genetic marker detection; the SNP genetic marker in the PPP3CA gene related to freezing tolerance of pig sperm is named g.119750378A>C, is located at a nucleotide site of 119750378bp of pig chromosome 8 in an international pig genome 11.1 version reference sequence, the base of the site is A or C, the g.119750378A>C is located in an intron region of the PPP3CA gene, and corresponds to the 174th bp in a nucleotide sequence shown in SEQ ID NO:1. A boar individual with an advantageous genotype AA has better frozen sperm quality, so that the g.119750378A>C is applied to genetic breeding of pigs, and freezing quality of a boar can be improved from a gene level.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pig genetic marker detection, and particularly relates to application of a SNP genetic marker related to sperm freezing tolerance in a PPP3CA gene in pig genetic breeding. BACKGROUND

[0002] Pig semen cryopreservation technology is of great significance in promoting the exchange of excellent boar across regions, coping with seasonal semen shortage, ensuring biosecurity and prevention and control, and improving the economic benefits of breeding enterprises, and also provides a guarantee for the long-term preservation of China's local pig genetic resources. For boars with excellent economic traits, using semen cryopreservation technology to preserve their semen can make artificial insemination no longer limited by time and space, improve the utilization efficiency of excellent boars, achieve greater genetic progress, and also reduce the risk of disease transmission. During the process of semen cryopreservation, temperature changes cause chemical and physical damage to sperm, resulting in poor semen quality after thawing, manifested as decreased sperm motility, fertilization ability and litter size of sows, which seriously affects the application of pig frozen semen and the sales of frozen semen products, and restricts the industrialization development of frozen semen and breeding progress of pig farms.

[0003] The quality of pig frozen semen is affected by many factors such as age, nutrition and freezing process. At present, most researches on improving the quality of frozen semen are focused on sperm freezing tolerance related proteins and metabolites. At the protein level, heat shock protein HSP90AA1, redox proteins (GSTM3, PRDX5 and ALB) and spermatogenesis proteins (HSPA5, MFGE8 and DNAH1) have been found to be related to sperm freezing tolerance. At the metabolite level, lipids such as phosphatidylcholine, linoleic acid and docosahexaenoic acid have been found to affect the quality of frozen semen. In addition, the addition of polysaccharides and nanomaterials in cryoprotectants has been confirmed to improve the quality of frozen semen to a certain extent. However, this method is only limited to maintaining the quality of frozen semen at the same level as fresh semen, and cannot essentially improve the quality of boar frozen semen. Therefore, from the perspective of individual genetics of boars, genes and markers affecting sperm freezing tolerance are excavated and identified at the molecular level, and SNP genetic markers are used to screen excellent boars with high sperm freezing tolerance, which will essentially improve the quality of boar frozen semen.

[0004] The prior art is basically directed to SNP genetic markers associated with the fresh semen activity of a boar, such as: (1) SNP of the third exon of CATSPER4 gene as a genetic marker of semen quality traits of pigs (application publication number: CN109837347 A), the invention relates to the association of the SNP of the third exon of CATSPER4 gene with the sperm density, sperm motility and sperm abnormality rate of pigs; (2) Molecular genetic marker related to the sperm abnormality rate of a boar and its application and acquisition method (application publication number: CN 110144414 A), the invention relates to the association of the T>C mutation at the position of 8647231bp on chromosome 3 of pigs with the sperm abnormality rate of pigs; (3) Molecular genetic marker related to the linear movement of sperm of a boar and its application and acquisition method (application publication number: CN 110195115 A), the invention relates to the molecular marker related to the linear movement of sperm of a boar, which is the T>C mutation at the position of 136112947bp on chromosome 15 of pigs, the A>G mutation at the position of 18505448bp on chromosome 3 of pigs and the C>T mutation at the position of 63272581bp on chromosome 11 of pigs; (4) SNP marker related to the effective sperm number of a boar and its acquisition method and application (application publication number: CN 110273007 A), the invention relates to five molecular markers related to the effective sperm number of a boar, including ASGA0105629, H3GA0010032, ALGA0024878, WU_10.2_8_31060162 and WU_10.2_9_11535520; (5) SNP genetic marker associated with semen quality traits of pigs and its application (application publication number: CN 113215277 A), the invention relates to the association of the SNP genetic marker of the 7th exon of SPAG6 gene with the semen volume, sperm density, sperm motility and sperm abnormality rate of pigs; (6) C7H15orf39 gene SNP molecular marker associated with semen quality traits of pigs and its application (application publication number: CN 113930521 A), the invention relates to the existence of a G>T base substitution at the position of 281 of the C7H15orf39 gene fragment, which causes Taq I-RFLP polymorphism, and the sperm motility trait of individuals with TT genotype is optimal; (7) Molecular marker method related to the sperm abnormality rate trait of a boar (application publication number: CN 115831220 A), the invention uses the molecular marker of A / G mutation at the position of 163993991bp on chromosome 6 of pigs for marker-assisted selection, which can greatly accelerate the genetic improvement of the sperm abnormality rate of Duroc pigs; (8) SNP molecular marker related to the semen quality traits of a boar in ATP11A gene, primer pair and its application (application publication number: CN 116790764 A), the invention discloses a SNP molecular marker related to the semen volume, sperm density and sperm motility traits of a boar in ATP11A gene, primer pair and its application.

[0005] At present, most of the inventions are all around the SNP genetic markers related to the fresh semen vigor of boars, including the density, the activity, the linear movement rate and the deformity rate of sperm in the fresh semen, and there are few inventions about the SNP related to the freezing tolerance of boar sperm and the improvement of the quality of frozen semen of boars. SUMMARY

[0006] In order to solve the problem of poor quality of frozen semen of boars, the application provides an application of a SNP genetic marker related to the freezing tolerance of pig sperm in a PPP3CA gene in pig genetic breeding, the SNP genetic marker related to the freezing tolerance of pig sperm in the PPP3CA gene is g.119750378A>C, which is located in an intron region of the PPP3CA gene, and a boar individual with an advantageous genotype AA of the g.119750378A>C has better quality of frozen semen, so that the g.119750378A>C is applied to the genetic breeding of pigs, and the quality of frozen semen of boars is improved from the gene level.

[0007] The application is achieved by the following technical solutions:

[0008] The application provides an application of a SNP genetic marker related to the freezing tolerance of pig sperm in a PPP3CA gene in pig genetic breeding, the SNP genetic marker related to the freezing tolerance of pig sperm in the PPP3CA gene is named g.119750378A>C, which is located at a 119750378bp nucleotide site of a pig chromosome 8 in an international pig genome 11.1 version reference sequence, the base of the site is A or C, and the g.119750378A>C is located in an intron region of the PPP3CA gene, and corresponds to the 174th bp in a nucleotide sequence shown in SEQ ID NO:1;

[0009] The pig genetic breeding is genetic breeding of pigs in relation to the freezing tolerance of sperm;

[0010] The freezing tolerance of sperm of an AA genotype individual of the g.119750378A>C is higher than that of an AC genotype individual, and the freezing tolerance of sperm of an AC genotype individual of the g.119750378A>C is higher than that of a CC genotype individual;

[0011] The breed of the pig includes at least one of a Duroc pig, a Landrace pig and a Large White pig.

[0012] Based on the same inventive concept, the application provides an early selection method for the freezing tolerance of pig sperm, the early selection method comprises early selection for the freezing tolerance of pig sperm based on a genotype of a SNP genetic marker g.119750378A>C;

[0013] The g.119750378A>C is located at the nucleotide site of 119750378bp on the chromosome 8 of the international pig genome 11.1 version reference sequence, the base at the site is A or C, the g.119750378A>C is located in the intron region of the PPP3CA gene, and corresponds to the 174th bp in the nucleotide sequence shown in SEQ ID NO: 1;

[0014] The sperm freezing tolerance of the AA genotype individual of the g.119750378A>C is higher than that of the AC genotype individual, and the sperm freezing tolerance of the AC genotype individual of the g.119750378A>C is higher than that of the CC genotype individual.

[0015] The pig breed includes at least one of Duroc, Landrace and Large White.

[0016] Further, the early selection method specifically includes:

[0017] Detecting the genotype of the SNP genetic marker g.119750378A>C in the genome of the pig to be tested;

[0018] Early selecting the sperm freezing tolerance trait of the pig to be tested based on the genotype of the g.119750378A>C.

[0019] Further, the detection of the genotype of the SNP genetic marker g.119750378A>C in the genome of the pig to be tested specifically includes:

[0020] PCR amplifying the genomic DNA of the pig to be tested by using the forward primer F1 and the reverse primer R1 as primers;

[0021] Sequencing the PCR amplification product to obtain the genotype of the nucleotide site of 119750378bp on the chromosome 8 of the pig to be tested;

[0022] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO. 3.

[0023] Based on the same inventive concept, the application provides the application of the primer for detecting the SNP genetic marker g.119750378A>C in pig genetic breeding, the g.119750378A>C is located at the nucleotide site of 119750378bp on the chromosome 8 of the international pig genome 11.1 version reference sequence, the base at the site is A or C, the g.119750378A>C is located in the intron region of the PPP3CA gene, and corresponds to the 174th bp in the nucleotide sequence shown in SEQ ID NO: 1;

[0024] The primers for detecting the SNP genetic marker g.119750378A>C include a forward primer F1 and a reverse primer R1, the nucleotide sequence of the forward primer F1 is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer R1 is shown as SEQ ID NO. 3;

[0025] The pig genetic breeding is genetic breeding of pigs on sperm freezing tolerance;

[0026] The sperm freezing tolerance of the AA genotype individual of g.119750378A>C is higher than that of the AC genotype individual, and the sperm freezing tolerance of the AC genotype individual of g.119750378A>C is higher than that of the CC genotype individual.

[0027] The breed of the pig includes at least one of Duroc pigs, Landrace pigs and Large White pigs.

[0028] The one or more technical solutions in the embodiment of the present application have at least the following technical effects or advantages:

[0029] The application of the SNP genetic marker related to the sperm freezing tolerance of pigs in the PPP3CA gene in pig genetic breeding, the SNP genetic marker related to the sperm freezing tolerance of pigs in the PPP3CA gene is g.119750378A>C, located in the intron region of the PPP3CA gene, and the boar individual with the superior genotype AA has better frozen sperm quality, therefore, the application of the SNP genetic marker g.119750378A>C in the genetic breeding of breeding boars can assist in screening breeding boar individuals with higher sperm freezing tolerance, essentially improving the frozen sperm quality of breeding boars, improving the utilization rate of high-quality breeding boars, and then realizing the maximization of economic benefits of pig breeding enterprises. BRIEF DESCRIPTION OF DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiment description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0031] Figure 1 It is an agarose gel electrophoresis detection diagram of the PCR amplification product in step S2 in embodiment 4 of the present application, wherein DL2000 is a Marker, lanes 1-3 are amplified fragments in pigs, and the fragment sizes are 492bp respectively.

[0032] Figure 2 It is a sequencing map of the g.119750378A>C site of the PPP3CA gene in step S3 in embodiment 4 of the present application. DETAILED DESCRIPTION

[0033] The advantages and various effects of the present application will be more clearly presented hereinafter in conjunction with specific embodiments and examples. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present application, rather than limit the present application.

[0034] Throughout the specification, unless otherwise specifically indicated, the terms used herein are to be understood as having the meanings commonly used in the art. Thus, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. If there is a conflict between the present specification and the definitions, the present specification takes precedence.

[0035] Unless otherwise specifically indicated, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0036] The overall idea of the present application is as follows:

[0037] The present application aims to solve the technical problem of poor boar frozen semen quality in the prior art, and provides a PPP3CA gene SNP genetic marker associated with boar sperm freezing tolerance and application, improves boar frozen semen quality, and provides a new marker resource for assisted selection of boar.

[0038] In the early stage, 25 boar individuals with high sperm freezing tolerance (frozen semen activity ≥ 0.6) and 25 boar individuals with low sperm freezing tolerance (frozen semen activity ≤ 0.4) were subjected to genome resequencing, and the fixation index (Fst) was calculated by using bioinformatics analysis method, and the A / C mutation at 119750378 bp of chromosome 8 located in the intron region of PPP3CA gene was obtained, and the genetic differentiation between the high and low sperm freezing tolerance groups was large, and the Fst was 0.40. Protein phosphatase 3 catalytic subunit alpha (PPP3CA) is a subtype of calcium-dependent phosphatase catalytic subunit A (CNA), which is involved in immune response, nervous system development, spermatogenesis and other important biological processes. In the process of spermatogenesis, PPP3CA affects the process of spermatogenesis by regulating the function of dynamin 2 (DNM2) in the sperm acrosome, and the abnormal function of the gene will cause testicular development delay, reduced sperm quantity and other symptoms, which suggests that the gene has an important role in livestock reproductive traits. At present, whether the above-mentioned PPP3CA gene g.119750378A>C site is related to sperm freezing tolerance and can improve the quality of boar frozen semen has not been reported.

[0039] The application is based on the analysis and mining of SNP genetic markers from the resequencing data of the genomes of 50 boars with high and low sperm freezing tolerance, and the accuracy and reliability of the PPP3CA gene g.119750378A>C genetic marker and application associated with the freezing tolerance of pig sperm in the application are increased by further verification in a population of nearly 400 boars, which can realize biological detection of the frozen semen quality of boars from a molecular level, provide a new genetic marker for assisted selection breeding of boars, screen boar individuals with high sperm freezing tolerance, essentially improve the frozen semen quality of boars, improve the utilization rate of high-quality boars, and thus maximize the economic benefits of pig breeding enterprises.

[0040] The application of the SNP genetic marker associated with the freezing tolerance of pig sperm in the PPP3CA gene in pig genetic breeding will be described in detail below in combination with examples and experimental data.

[0041] Example 1

[0042] Obtaining of the pig sperm freezing tolerance SNP genetic marker PPP3CA gene g.119750378A>C site.

[0043] 1. Collecting boar semen and extracting genomic DNA

[0044] The boars are 1-3 years old, robust in body, and good in reproductive performance. The semen collection tools such as the semen collection cup, gloves and semen collection bag are sterilized before semen collection, the penis is sterilized and cleaned with a low-concentration potassium permanganate solution, the hair around the penis is trimmed, and the semen is collected by artificial hand gripping. The initial gelatinous semen is discarded during semen collection, and when the semen appears milky white, it is filtered with sterile filter paper and collected into the semen collection cup with a semen collection bag. The boar genomic DNA is extracted using the animal tissue genomic DNA extraction kit (PureLinkTM Pro96 Genomic DNA Purification Kit, K182104A) produced by Invitrogen Company, and the extracted DNA is detected for concentration and quality and stored at -20℃ for standby. A total of 395 pig semen samples were collected and their genomic DNA was extracted.

[0045] 2. Collecting sperm freezing tolerance phenotype data

[0046] (1) Fresh semen motility detection and semen cryopreservation

[0047] The beaker and glass rod used for semen dilution were sterilized in advance, the glass slide and cover glass were preheated to 37°C on the heating table of CASA sperm auxiliary analyzer (Fuzhou Hong Vision), and the diluent was preheated to 37°C in a water bath. After collecting fresh semen, the temperature of the semen and frozen diluent was measured using an electronic thermometer. When the temperatures were consistent, 0.1 mL of fresh semen was added to 0.9 mL of preheated diluent to achieve a 1:9 dilution. After gently mixing, 5 μL of the diluted semen was dropped onto a glass slide, covered with a cover glass, and the sperm density and motility were detected using the CASA sperm analyzer. The data of sperm motility of fresh semen were recorded. If the microscopic examination was qualified, the remaining semen was added to the 37°C preheated frozen diluent at a ratio of 1:1, gently mixed, and then placed at room temperature for about 1 h.

[0048] After standing, the semen was gently shaken to prevent sperm from dying. Then, the semen was placed in a programmed cooling instrument (Beijing Tianyuan Auri), and the cooling program was set to slowly cool the temperature to 17°C within 1-2 h. After cooling, the supernatant was removed by centrifugation at 800 g / min for 10-15 min at 17°C. The sperm was resuspended in pre-cooled frozen base liquid I (Beijing Tianyuan Auri) to a density of 2 billion / mL. Then, the semen was placed in a programmed cooling instrument (Beijing Tianyuan Auri) for temperature equilibration, and the semen was slowly cooled to 4°C within 2.5-3.0 h and equilibrated at 4°C for 0.5-1.0 h. After equilibration, frozen base liquid II (Beijing Tianyuan Auri) was added, and the mixture was immediately loaded into a fine tube using a semen tank integrated machine (Germany Minitube) in a low-temperature operation cabinet (Germany Min itube). Then, according to the technical requirements of the programmed freezing instrument (Beijing Tianyuan Auri), the instrument was started to cool the chamber to 4-5°C, and the loaded semen fine tube was placed in the chamber. The reference program for freezing the semen fine tube was called, and the specific program was as follows: 4°C, constant temperature pre-cooling; 1°C, cooling for 1.5 min at a rate of -2°C / min; -26°C, cooling for 2.4 min at a rate of -30°C / min; -140°C, cooling for 6.2 min at a rate of -30°C / min; -140°C, constant temperature for 21.2 min; then, the tube was placed in a liquid nitrogen tank.

[0049] (2) Semen thawing and frozen semen motility detection

[0050] The frozen fine tube was thawed in a 50°C water bath for 16 s, the ends of the fine tube were cut off, and the semen was transferred to a 15 mL centrifuge tube. The thawing liquid was preheated to 37°C and added at a ratio of 1:8 for dilution. After 37°C recovery for 15-20 min, the sperm motility after thawing was detected under a CASA microscope. At least 3 fine tubes were thawed for each individual, and each fine tube was subjected to at least 3 motility detections.

[0051] (3) Screening of sperm freezing-tolerant extreme individuals

[0052] According to the above steps, the detection of fresh semen activity and frozen semen activity of boar is completed, and the frozen semen recovery rate is used to reflect the freezing tolerance phenotype of sperm, and the formula is as follows:

[0053]

[0054] Wherein, x i is the frozen semen recovery rate of the ith individual, Y i is the frozen semen activity of the ith individual, X i is the fresh semen activity of the ith individual.

[0055] In order to eliminate the influence of different test batches on the detection results of sperm activity, Z-score method is used to standardize the sperm activity, and the formula is as follows:

[0056]

[0057] Wherein, Z i represents the standardized score of the frozen semen recovery rate of the ith individual, x i represents the frozen semen recovery rate of the ith individual, μ represents the mean of the frozen semen recovery rate of all individuals in each batch, and σ represents the standard deviation of the frozen semen recovery rate of all individuals in each batch, and the formula of σ is as follows:

[0058]

[0059] Wherein, σ represents the standard deviation of the frozen semen recovery rate of all individuals, N is the number of individuals, x i is the frozen semen recovery rate of the ith individual, and μ represents the mean of the frozen semen recovery rate of all individuals in each batch.

[0060] According to the Z value, 395 individuals are sorted, and the top 25 individuals with high Z value are selected, which represent high frozen semen recovery rate, as the sperm freezing tolerance group, and the last 25 individuals with low Z value are selected, which represent low frozen semen recovery rate, as the sperm freezing intolerance group.

[0061] 3. Mining sperm freezing tolerance related molecular markers based on genome resequencing

[0062] (1) Genome resequencing

[0063] According to the standard library construction process of TruSeq DNA PCR-free prep kit reagent of Illumina company, the genomic DNA of 50 pigs in the sperm freezing tolerance group and the sperm freezing intolerance group is subjected to genome resequencing library construction, and 10× depth resequencing is carried out through Novaseq-PE150 platform to obtain raw sequencing data.

[0064] (2) Raw data processing

[0065] The raw data was filtered using the fastp (v0.20.0) program with the following conditions: removing 3' end adapter contamination; using a sliding window method for quality filtering, with a window size of 5 bp and a step size of 1 bp. Every time moving one base, taking the average Q value of the 5-base calculation window, if the Q value of the last base is ≤2, only the bases before that position are retained; if the average Q value of the window is ≤20, only the last second base and the previous bases of the window are retained; if the length of any one read in the double-end is ≤50 bp, the double-end read is removed. The results showed that a total of 3.2 billion high-quality reads were obtained from 20 individuals, which were aligned to the Sus Scrofa 11.1 reference genome using BWA software, with an average alignment rate of 99.31% and an average sequencing coverage depth of 7.13 (6.45-7.90).

[0066] (3) Genomic variation analysis and calculation of genetic differentiation index between sperm freeze-tolerant and non-tolerant groups

[0067] For the genomic resequencing data of 50 pigs, samtools software was used for SNP mining, and a total of 26,323,490 high-quality SNPs were obtained. In order to obtain sperm freeze-tolerance related molecular markers, population genetic differentiation degree Fst analysis was carried out based on SNP genotype information, Fst represents the genetic differentiation degree between subpopulations within a population, and Fst value is generally between 0 and 1. The smaller the Fst value, the smaller the genetic differentiation between subpopulations, and when the value is 0, it represents that all individuals within the two subpopulations can freely interbreed, and the genetic differentiation degree is the lowest; the larger the Fst, the greater the genetic differentiation between subpopulations, and when the value is 1, it represents that the two subpopulations do not share any genetic diversity.

[0068] The distribution of θπ (θπ, freeze-tolerant group / non-tolerant group) and Fst value was used to detect the regions in the genome that were significantly subjected to selective elimination. Regions with extremely low or high θπ ratio (1% left tail and 1% right tail) and significantly high Fst value (i.e. Fst in the top 1%) were selected as regions subjected to strong selective elimination.

[0069] (4) Screening of sperm freeze-tolerance PPP3CA gene g.119750378A>C genetic marker

[0070] Based on the above analysis, a total of 15,0217 SNPs were found, which were annotated to 5632 genes. For further screening of sperm freezing tolerance related molecular markers, the above genes were subjected to the following functional analysis and filtering: comparison with the International Mouse Phenotyping Consortium database (IMPC), 709 genes related to sperm function were screened, among which 209 genes were common genes of 2 or 3 breeds, and GO analysis results showed that these genes were mainly enriched in sperm generation, sperm development and other pathways; through literature indexing and gene haplotype analysis, it was finally determined that the PPP3CA gene g.119750378A>C genetic marker was related to sperm freezing tolerance.

[0071] Example 2

[0072] Detection of polymorphism distribution of PPP3CA gene g.119750378A>C genetic marker in pigs.

[0073] In this example, the polymorphism distribution of the PPP3CA gene g.119750378A>C genetic marker was detected in 395 boars, and the detection results are shown in Table 1.

[0074] Table 1 Genotype frequency and gene frequency of PPP3CA gene g.119750378A>C site

[0075]

[0076] As can be seen from the results in Table 1, the PPP3CA gene g.119750378A>C site in boars showed AA, AC and CC three genotypes, among which AA genotype individuals were more, and the A allele frequency was 87%.

[0077] Example 3

[0078] Association analysis of PPP3CA gene g.119750378A>C genetic marker and boar sperm freezing tolerance.

[0079] This example aims to determine the association of PPP3CA gene g.119750378A>C site with boar sperm freezing tolerance, and to analyze the correlation between different genotypes of this polymorphic site and the recovery rate of frozen-thawed sperm. SPSS statistical analysis software (IBM SPSS Statistics 26) GLM program was used for variance analysis of different SNP genotype combinations, and significance test was performed, and the model used was:

[0080] y = μ + G + B + T + e

[0081] ijkl i j k ijkl

[0082] wherein, yijkl For the recovery rate of the measured value, μ represents the population mean, G i represents the genotype effect, B j represents the variety effect, T k represents the batch effect, e ijkl represents the random effect.

[0083] The correlation analysis between different genotypes and boar frozen semen recovery rate was carried out in boar, and the statistical analysis results are shown in Table 2:

[0084] Table 2 Correlation analysis between PPP3CA gene g.119750378A>C site and boar frozen semen recovery rate

[0085]

[0086]

[0087] Among them: the average value of the traits in Table 2 is the average number ± standard error, and the different letters indicate significant difference (P<0.05)

[0088] As can be seen from the results in Table 2, the frozen semen recovery rate of AA genotype individuals of PPP3CA gene g.119750378A>C site in boar is significantly higher than that of CC genotype individuals (P<0.05).

[0089] Example 4

[0090] The application of PPP3CA gene g.119750378A>C genetic marker in screening of boar with sperm freezing tolerance includes the following steps:

[0091] Step S1: Collect ear tissue samples of boar individuals to be detected, and perform DNA extraction and quality detection;

[0092] Step S2: PCR amplification is carried out with forward primer F1 and reverse primer R1 to obtain PCR amplification product and purification; the PCR reaction system is 40 μL, and the components in the system are: genomic DNA 1 u l, PCR mix 20 μL, upstream primer, downstream primer each 2 μL, and ddH2O is added to a total volume of 40 μL; the running program of PCR is: 98 ℃ pre-denaturation for 2 min; 98 ℃ denaturation for 10 s, 60 ℃ annealing for 10 s, 72 ℃ extension for 15 s, 35 cycles; 72 ℃ extension for 2 min; 4 ℃ preservation. The agarose gel electrophoresis detection diagram of PCR amplification product is shown in Figure 1 .

[0093] Step S3: Part of the PCR purification product is sequenced, and the genotype at the 174th bp of the sequence, g.119750378A>C site is analyzed, and the sequencing map is shown in Figure 2As shown, the individuals with AA genotype are preferentially reserved, the individuals with CC genotype are preferentially eliminated, and the individuals with AC genotype are selected.

[0094] In summary, the genetic marker of g.119750378A>C of PPP3CA gene is significantly related to the boar reproductive traits, especially the boar frozen semen recovery rate, and the AA genotype is the dominant genotype. Therefore, in the process of breeding boars, the individuals with good reproductive performance of AA type can be selected by the SNP genetic marker assisted selection according to the operation of steps S1, S2 and S3 in embodiment 4, which is beneficial to improve the production performance of the population, improve the utilization rate of high-quality boars, and realize the maximization of economic benefits of pig breeding enterprises.

[0095] In the present application, the specific sequences of SEQ ID NO:1-3 are as follows:

[0096] The nucleotide sequence shown in SEQ ID NO:1 is:

[0097] GCCATTGTTCTCCCCGGATTTTGAATTTCTATGCTCCCACCCTATTGGCTTTTAAAATCTCAAACAACTTAAAAAAGAGATTCCTCTTTTACGATTTCGATTCATACAATGGCTTCATCAGTTATGATGCCAAACTTTTTATAGTCATTAACTTGTGACGAAATGATGGTCAC A GTAGTTTAGAAATCAATCGAGTACTACTTTCATCCCTCGAAAATCATGGAGTTAGTTTTTAGGGTGGGTGCTCCTTAGACAGGTCTATTATTTTGCGATTTATGACTGAATTAGAGAAGAATTAAGAAGCTTTGCTTTGGGCCTTGGTCTTTCCCCTTTCCCCATCTTCTTCCTCTCATAGTTGACTAATCACCATGATGCTAACCTTTAAA ATGCAGAGGGGGAACCAACTGTTTCTCGTCGTTTAATGAGTTTGGAATCAACTGTGTCTACCTTTGAAGAACCTCATCCATACTAATGAAAGGCACTGCGCATTTG;

[0098] The forward primer F1 shown in SEQ ID NO:2 is GCCATTGTTCTCCCCGGATT;

[0099] the reverse primer R1 set forth in SEQ ID NO: 3: CAAATGCGCAGTGCCTTTCA.

[0100] In SEQ ID NO: 1, the site in bold and underlined is the g.119750378A>C site of the present application.

[0101] Finally, it is to be understood that the term "including", "comprising", and variations thereof, are intended to be broad and encompass the terms "consisting of" and "consisting essentially of" unless otherwise noted. Stated another way, nothing in the specification is to be construed as requiring the inclusion of any element in the practice of the present application unless explicitly stated.

[0102] Although preferred embodiments of the application have been described, those skilled in the art will recognize that additional modifications and variations can be made thereto without departing from the spirit and scope of the application. It is therefore intended that the appended claims encompass all such modifications and variations as fall within the scope of the application.

[0103] It is apparent that those skilled in the art can, without departing from the spirit and scope of the application, make various changes and modifications of the application. It is therefore intended that the application embrace all such changes and modifications as fall within the scope of the claims and their equivalents.

Claims

1. The application of SNP genetic markers related to porcine sperm cryoprotection in the PPP3CA gene in porcine genetic breeding, characterized by: The SNP genetic marker in the PPP3CA gene associated with porcine sperm cryoprotection is named g.119750378A>C, located at nucleotide 119750378bp on chromosome 8 of the international pig genome version 11.1 reference sequence. The base at this site is either A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174th bp position in the nucleotide sequence shown in SEQ ID NO:

1. The pig genetic breeding mentioned is related to the genetic breeding of pig sperm freeze resistance; Among them, the sperm of individuals with the AA genotype g.119750378A>C showed higher cryoprotection than that of individuals with the AC genotype; and the sperm of individuals with the AC genotype g.119750378A>C showed higher cryoprotection than that of individuals with the CC genotype. The pig breed is at least one of Duroc, Landrace, and Large White.

2. A method for early selection of the cryoprotective trait of porcine semen, characterized in that, The early selection method includes early selection of porcine sperm cryoprotective traits based on the SNP genetic marker g.119750378A>C genotype; The g.119750378A>C is located at the nucleotide site 119750378bp on chromosome 8 of the international pig genome version 11.1 reference sequence. The base at this site is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174th bp position in the nucleotide sequence shown in SEQ ID NO:

1. Among them, the sperm of individuals with the AA genotype g.119750378A>C showed higher cryoprotection than that of individuals with the AC genotype; and the sperm of individuals with the AC genotype g.119750378A>C showed higher cryoprotection than that of individuals with the CC genotype. The pig breed is at least one of Duroc, Landrace, and Large White.

3. The method for early selection of the cryoprotective trait of porcine sperm according to claim 2, characterized in that, The early selection method specifically includes: The genotype of the SNP genetic marker g.119750378A>C in the genome of the pig to be tested was detected; Early selection of sperm freeze tolerance traits in pigs was carried out based on the g.119750378A>C genotype.

4. The method for early selection of the cryoprotective trait of porcine sperm according to claim 3, characterized in that, The detection of the genotype of the SNP genetic marker g.119750378A>C in the genome of the pig to be tested specifically includes: Using forward primer F1 and reverse primer R1 as primers, PCR amplification was performed on the genomic DNA of the pigs to be tested. The PCR amplification products were sequenced to obtain the genotype of the 119750378 bp nucleotide site on chromosome 8 of the pig to be tested. The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.

3.

5. The application of the SNP genetic marker g.119750378A>C in pig genetic breeding, characterized by, The g.119750378A>C is located at the nucleotide site 119750378bp on chromosome 8 of the international pig genome version 11.1 reference sequence. The base at this site is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174th bp position in the nucleotide sequence shown in SEQ ID NO:

1. The primers for detecting the SNP genetic marker g.119750378A>C are forward primer F1 and reverse primer R1. The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.

3. The pig genetic breeding mentioned is related to the genetic breeding of pig sperm freeze resistance; Among them, the sperm of individuals with the AA genotype g.119750378A>C showed higher cryoprotection than that of individuals with the AC genotype; and the sperm of individuals with the AC genotype g.119750378A>C showed higher cryoprotection than that of individuals with the CC genotype. The pig breed is at least one of Duroc, Landrace, and Large White.

Citation Information

Patent Citations

  • Genetic mark using SNP of third exon of CATSPER4 gene as sperm quality property of pigs

    CN109837347A

  • Molecular genetic marker associated with sperm malformation rate in boars, and application and acquisition method thereof

    CN110144414A

  • Molecular genetic marker related to linear movement of boar sperm and its application and acquisition method thereof

    CN110195115A

  • SNP markers relevant to effective sperm number of boars and obtaining method and application of SNP markers

    CN110273007A

  • SNP (Single Nucleotide Polymorphism) genetic marker associated with boar semen quality traits and application

    CN113215277A