Primer probe combination for detecting chicken mycoplasma synoviae based on RPA-CRISPR / Cas12 and application

Abstract

The invention discloses a primer probe combination for detecting mycoplasma synoviae based on RPA-CRISPR / Cas12 and application of the primer probe combination, and belongs to the technical field of gene detection. The primer probe combination is composed of an upstream primer sequence as shown in SEQ ID NO. 3, a downstream primer sequence as shown in SEQ ID NO. 4 and a crRNA probe sequence as shown in SEQ ID NO. 5. According to the primer probe combination designed by the invention, nucleic acid is amplified by utilizing an RPA amplification technology, a product is guided by a crRNA probe, a Cas12 enzyme digestion single-stranded DNA report sequence is utilized, and detection is carried out through a fluorescence signal, so that the chicken mycoplasma synoviae can be specifically and rapidly detected, the minimum detection limit can reach 1copy / mu L, a result can be rapidly obtained, and the detection sensitivity is high. And the defects of insensitivity, long time, high cost and the like of the current detection method are overcome.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a primer-probe combination and application for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12. Background Art

[0002] Mycoplasma synoviae (MS) is a common Gram-negative pathogen of joint infection in chickens. It can cause infectious synovitis and subclinical respiratory tract infection, and can also cause abnormal eggshell tip syndrome. Mycoplasma synoviae mainly infects the air sacs and joints of chickens and turkeys. MS infection can cause respiratory symptoms and synovitis in chickens, and the clinical symptoms and severity of the disease will also vary depending on the isolate. Bursitis is a typical symptom of avian synoviae disease, including swelling, effusion and pain in the synovial bursa, and a noticeable warmth when touched. Chickens show lameness, pacing, inability to stand normally, low foraging ability, loss of appetite, and weight loss. The main clinical manifestation of avian synoviae disease is arthritis. Sick chickens usually have symptoms such as joint swelling, fever, and pain in the hip, knee, and metatarsal joints, which restricts the movement of chickens.

[0003] Mycoplasma can be detected and identified by isolation and culture, serological methods and molecular biological methods. Serological methods can be subdivided into serum plate agglutination (SPA) test, hemagglutination inhibition (HI) test and enzyme-linked immunosorbent assay (ELISA). Molecular biological methods can be subdivided into PCR, fluorescent quantitative PCR, etc. However, traditional mycoplasma detection methods are time-consuming, have high requirements for equipment, and are difficult to obtain identification results in a short time, which is not conducive to grassroots promotion and detection. It may also delay the timing of treatment and increase the difficulty of treatment and prognosis. Therefore, the demand for rapid detection of mycoplasma has gradually increased. In recent years, many methods for rapid detection of pathogenic microorganisms have been developed. Isothermal amplification technologies such as loop-mediated isothermal amplification (LAMP), recombinase aided amplification (RAA) and recombinase polymerase amplification (RPA) have developed rapidly due to their advantages such as not requiring expensive equipment, rapid reaction and high sensitivity, and have gradually been used in clinical practice. RPA was first proposed in 2006. RPA technology is an amplification technology that imitates the replication mechanism of T4 bacteriophage DNA. It can quickly amplify target gene fragments under in vitro constant temperature conditions of 37℃-42℃. It does not rely on expensive instruments and has high sensitivity and specificity. It can realize portable rapid visual detection of pathogens.

[0004] The CRISPR system is an acquired immune defense system that bacteria and archaea use Cas effector proteins and under the guidance of crRNA to resist the invasion of exogenous nucleic acids. It can cut and eliminate the threat of viral invasion and other exogenous nucleic acids. The CRISPR-Cas system uses its own RNA to sequence with the target DNA to identify specific sequences. S.pyogenes Cas9 (SpCas9, generally referred to as Cas9) is the most widely used Cas protein because it has a simple PAM sequence and high gene editing efficiency in cells. Cas12a (also known as Cpf1) is a CRISPR system different from Cas9. Studies have shown that when the Cas12a protein binds to and cuts the target DNA, it can release non-specific single-stranded DNA cutting activity. This activity gives the Cas12a protein a new function, making it an effective gene detection tool, greatly improving the efficiency and accuracy of gene detection. Using this newly discovered ability, Cas12a can recognize the target DNA sequence and cut it, while also cutting and releasing the attached single-stranded DNA, thereby realizing an efficient, rapid and specific gene detection technology.

[0005] The Cas12a protein recognizes the T-rich PAM site and forms a 5-nucleotide sticky end at the 5' end of the target sequence, while it can process itself to form a mature crRNA. Cas12a is a prokaryotic deoxyribonuclease that is programmed to bind to a targeted complementary DNA sequence through crRNA guidance. After binding to the target DNA, Cas12a induces a nick in each target DNA strand, resulting in a double-stranded DNA break. CRISPR RNA (crRNA) is specifically designed to target double-stranded DNA (dsDNA) and is located downstream of a short T-rich protospacer adjacent motif (PAM). Using this property, the luminescent molecule can be linked to an inhibitory molecule that prevents the luminescent molecule from emitting light through single-stranded DNA (referred to as a reporter sequence). The target DNA can act as an activator to trigger both cis and trans cleavage of Cas12a. The reporter (FQreporter) labeled with a fluorophore quencher in the system is then cut off, the luminescence inhibitory molecule is removed, and the luminescent molecule is allowed to emit light, thereby detecting the light signal.

[0006] In the existing technology, the detection of Mycoplasma synoviae based on RPA and CRISPR / Cas technology has not yet been achieved. Summary of the invention

[0007] The purpose of the present invention is to provide a primer-probe combination and application for detecting chicken synoviae Mycoplasma based on RPA-CRISPR / Cas12 to solve the problems existing in the above-mentioned prior art. The primer-probe combination involved in the present invention has good specificity, which can not only quickly detect and obtain results, but also solve the shortcomings of current detection methods such as insensitivity, long time and high cost.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a primer-probe combination for detecting chicken synoviae Mycoplasma based on RPA-CRISPR / Cas12, which consists of an upstream primer sequence as shown in SEQ ID NO.3, a downstream primer sequence as shown in SEQ ID NO.4, and a crRNA probe sequence as shown in SEQ ID NO.5.

[0010] Furthermore, the upstream primer sequence and the downstream primer sequence are designed based on the 1782bp conserved region specific to the vlhA gene, and the 1782bp conserved region sequence is shown in SEQ ID NO.1; the crRNA probe sequence is an RNA form that can guide Cas12 to cleave the synoviae target gene and the single-stranded DNA reporter sequence.

[0011] The present invention also provides the use of the primer-probe combination in preparing a kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12.

[0012] The present invention also provides a kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, comprising the primer-probe combination.

[0013] Furthermore, it also includes recombinase polymerase, dNTP, single-stranded DNA reporter sequence, buffer, Cas protein and genomic DNA extraction reagent.

[0014] Furthermore, the single-stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA and AAA.

[0015] Furthermore, the 5' end of the single-stranded DNA reporter sequence is modified with Atto 425, BODIPYFL, FAM, OregonGreen488, TET, JOE, R6G, YakimaYellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670 or Cy5.5; the 3' end of the single-stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB or Dabcyl.

[0016] The present invention also provides the use of the primer-probe combination or the kit in detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12.

[0017] The present invention also provides a method for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, comprising using the genomic DNA of a sample to be tested as a template, performing an RPA-CRISPR / Cas12 reaction using the primer-probe combination, and irradiating with blue light after the reaction is completed. If fluorescence is observed, the sample to be tested contains Mycoplasma synoviae, and if no fluorescence is observed, the sample to be tested does not contain Mycoplasma synoviae.

[0018] The present invention utilizes Cas protein to cut the double-stranded DNA substrate of the target site of Mycoplasma synoviae under the guidance of crRNA probe, and then releases the PAM distal product, activates the non-specific cutting of single-stranded DNA reporter sequence, and determines the result by observing the fluorescence with the naked eye under the irradiation of a blue light flashlight.

[0019] Further, the reaction system of the RPA-CRISPR / Cas12 reaction is 2 μL of DNA template, 10 μM upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 1.25 μL of 10 nM crRNA probe, 0.5 μM single-stranded DNA reporter sequence, 140 μL of 1× concentration of buffer, 80 nM Cas12a and 220 μL of 1× concentration of buffer;

[0020] The components of the buffer 1 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / ml Bovine serum albumin and 280 mM Magnesium acetate; the components of the buffer 2 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, and 100 g / ml Bovine serum albumin.

[0021] Furthermore, the reaction conditions of the RPA-CRISPR / Cas12 reaction are a constant temperature of 37° C. and a reaction time of 50 min.

[0022] The present invention discloses the following technical effects:

[0023] The present invention selects the vlhA gene of MS as the detection target gene, designs a set of RPA primers and crRNA probe combinations for the conserved region of the gene, amplifies the nucleic acid using RPA amplification technology, and uses Cas12 to cut the single-stranded DNA reporter sequence of the product under the guidance of the crRNA probe, and detects it through fluorescent signals. It can specifically and rapidly detect chicken synoviae Mycoplasma, and the minimum detection limit can reach 1 copies / μL.

[0024] The present invention can not only quickly detect and obtain results, but also solve the shortcomings of current detection methods such as insensitivity, long time and high cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 It is the fluorescence reporting result of the crRNA probe based on the product amplified by the optimal RPA primer;

[0027] Figure 2 The fluorescence report results of the test kit for Mycoplasma synoviae.

[0028] Figure 3 It is the specific test result;

[0029] Figure 4 This is the sensitivity test result. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] MS2960 (M.synoviae 2960) CVCC2960, Mycoplasma gallisepticum (M.gallisepticum) CVCC350, Salmonella (S.typhimurium) ATCC21527, Escherichia coli (E.coli) ATCC25922, Campylobacter jejuni (C.jejuni) ATCC33291, Enterococcus (E.faecalis) ATCC29212, Streptococcus (S.suis) ATCC49619, Staphylococcus aureus (S.aureus) ATCC29213 used in the embodiments of the present invention are all purchased standard strains; MS11 (classification name Mycoplasma synoviae 11) was isolated by Zhou Zutao's research group of Huazhong Agricultural University and preserved in the China Center for Type Culture Collection, with a preservation address of Wuhan University, Wuhan, China, a preservation date of September 29, 2024, and a preservation number of CCTCC NO: M 20242127; Mycoplasma felis (classification name Mycoplasmafelis 5) was isolated by the Veterinary Drug Residue Reference Laboratory of Huazhong Agricultural University and preserved in the China Center for Type Culture Collection, with the preservation address at Wuhan University, Wuhan, China. The preservation date is September 29, 2024, and the preservation number is CCTCC NO: M 20242126.

[0036] Example 1

[0037] 1. Cas12a protein expression and purification

[0038] The DNA fragment encoding LbCas12a was cloned into the pET30c vector containing 6 histidine tags at the C-terminus to construct an expression plasmid. After BL21 (DE3) transformation, a single clone was selected and cultured overnight in 2×YT medium (10 g tryptone, 10 g yeast extract, 5 g NaCl) at 37°C. 600 When the concentration reached 0.6, 0.5 mM IPTG (isopropylthiogalactoside) was added to induce expression at 21°C for 16 h before harvesting the bacteria.

[0039] After the bacteria were collected, they were resuspended in a lysis buffer (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 5% (v / v) glycerol, 1 mM TCEP, 0.25 mg / mL lysozyme) and ultrasonically broken. The supernatant obtained after the disruption was filtered through a 0.22 μm filter membrane, purified by a HisTrap HP nickel column, eluted with 500 mM imidazole, concentrated to 500 μL by a 50 KDa ultrafiltration tube, and purified by dextran gel chromatography (Superdex Increase 200). The target protein was stored in a storage buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 5% (v / v) glycerol, 1 mM TCEP) and frozen in a -80°C refrigerator for use.

[0040] 2. Preparation of single-stranded DNA reporter sequence

[0041] LbCas12a non-specifically cuts single-stranded DNA with a preference for TT. The single-stranded DNA reporter sequence (5'-3') is: TTTTTT, 5'-end FAM modification, 3'-end BHQ1 modification, i.e. FAM-TTTTTT-BHQ1.

[0042] The single-stranded DNA reporter sequence is synthesized, purified and confirmed by a bioengineering synthesis-related company.

[0043] 3. Screening and preparation of RPA primers

[0044] (1) Determination of candidate target sequences

[0045] Based on the vlhA gene reference sequence of MS, the gene sequence of Mycoplasma synoviae sequenced in the laboratory and the gene sequence of Mycoplasma synoviae retrieved from the NCBI gene library of the National Center for Biotechnology Information were compared, and the above gene target sequence is shown in SEQ ID NO.1.

[0046] vlhA gene reference sequence (SEQ ID NO.1):

[0047]

[0048] The conserved regions of the above genes were selected for subsequent studies.

[0049] (2) Screening and preparation of candidate RPA primers

[0050] Based on the conserved region sequence, the primer length is limited to 25-36bp and the product length is 80-300bp. Use primer design related software or website for retrieval and select two pairs of primers with higher scores. The RPA primers are synthesized, purified and confirmed by bioengineering synthesis related companies. The optimal RPA primers are determined based on the amplification band size and product content through RPA amplification test. The optimal RPA primer sequences are shown in SEQ ID NO.3-4.

[0051] Upstream primer (SEQ ID NO. 3): TAACGGTGATAACCCTACAACCAAAACTGC;

[0052] Downstream primer (SEQ ID NO. 4): GCATAAACCCGTCTCAGTATAGTGTACGAG.

[0053] 4. Screening and preparation of crRNA probes

[0054] (1) Determination of candidate crRNA probe sequences

[0055] Since LbCas12a specifically cuts double-stranded DNA and needs to recognize the PAM sequence (TTTN or TTN), the 20 nucleotides downstream of the PAM sequence are the region where the crRNA probe complements and recognizes the double-stranded DNA of the target site. Look for the PAM site (5'-TTN-3' or 5'-NAA-3') in the conserved region of the gene to determine the crRNA targeting sequence. Select a crRNA probe with a higher score. The crRNA targeting sequence is shown in SEQ ID NO.2.

[0056] crRNA targeting sequence (SEQ ID NO.2):

[0057] TAACGGTGATAACCCTACAACCAAAACTGC TTACTATAAAGCTGATACTA CTCGTA CACTATACTGAGACGGGTTTATGC (The underlined part is the sequence that matches the RPA primer, and the bolded part is the sequence that matches the crRNA probe).

[0058] (2) Preparation of candidate crRNA probes

[0059] A T7 promoter sequence was added before the DNA sequence corresponding to the crRNA probe, followed by its complementary sequence, which was slowly annealed to form a double-stranded DNA sequence, which was used as a template for in vitro transcription. T7 RNA polymerase was added and incubated at 37°C for 4 hours. The DNA template was digested with DNaseⅠ and then recovered using an RNA purification kit to obtain the crRNA probe.

[0060] (3) Screening of optimal crRNA probe

[0061] 2 μL of double-stranded DNA of the target gene of the same concentration was used as the substrate, 1.25 μL of crRNA probe and 1 μL of single-stranded DNA reporter sequence were added, and the crRNA probe with strong specificity and high sensitivity was screened by comparing the strength of the fluorescent signal. The optimal crRNA probe sequence screened is shown in SEQ ID NO.5.

[0062] crRNA probe sequence (SEQ ID NO. 5): UAAUUUCUACUAAGUGUAGAUCUAUAAAGCUGAUACUACUC.

[0063] The results of the fluorescence reporter experiment of the crRNA probe based on the optimal RPA primer amplification product are as follows Figure 1 shown.

[0064] Example 2

[0065] 1. Preparation of a CRISPR / Cas12-based kit for detecting Mycoplasma synoviae:

[0066] 2.4 μL of 10 μM RPA upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 1.25 μL of 10 nM crRNA probe, and 1 μL of 0.5 μM single-stranded DNA reporter sequence were lyophilized at the bottom of the PCR tube to obtain lyophilized reagent 1, and then vacuum-sealed and stored in a tin foil bag. When used, add 40 μL of buffer 1 to the PCR tube and re-dissolve. 20 μL of 80 nM Cas12 protein was lyophilized in a vial, and 20 μL of buffer 2 was added when used to re-dissolve. The above reagents and blue light flashlight were packaged in a packaging box to form a kit. The components of buffer 1 and buffer 2 are shown in Table 1.

[0067] Table 1 Buffer 1 and Buffer 2 Composition

[0068]

[0069] 2. Use the test kit to detect Mycoplasma synoviae

[0070] Using MS2960 genomic DNA as sample, the sample concentration was diluted to 10 5copies / μL, 10 3 copies / μL and 10 1 copies / μL, using the kit for detection, the detection steps are as follows:

[0071] Add 40 μL of buffer 1 to the lyophilized centrifuge tube to reconstitute;

[0072] Take 2 μL of the genomic DNA to be tested, add it to the reconstituted PCR tube, and mix by pipetting;

[0073] Place 2 μL of Cas12a reconstituted solution on the cap of the PCR tube and slowly close the cap of the PCR tube;

[0074] Place at 37℃ for 20min.

[0075] Centrifuge to allow Cas12a protein to enter the reaction system and react at 37°C for 30 min;

[0076] Shine the blue light on the bottom of the PCR centrifuge tube and observe the fluorescence color. The fluorescence report result is as follows: Figure 2 .

[0077] Example 3

[0078] 1. Specificity detection

[0079] The genomic DNA of MS2960, MS11, Mycoplasma gallisepticum, Mycoplasma felis, Salmonella, Escherichia coli, Campylobacter jejuni, Enterococcus, Streptococcus, and Staphylococcus aureus were used as samples and the kit was used for detection to analyze the specificity of the detection method of the present invention. The detection steps are as follows:

[0080] Add 40 μL of buffer 1 to the lyophilized centrifuge tube to reconstitute;

[0081] Take 2 μL of the genomic DNA to be tested, add it to the reconstituted PCR tube, and mix by pipetting;

[0082] Place 2 μL of Cas12a reconstituted solution on the cap of the PCR tube and slowly close the cap of the PCR tube;

[0083] Place at 37℃ for 20min.

[0084] Centrifuge to allow Cas12a protein to enter the reaction system and react at 37°C for 30 min;

[0085] Shine a blue light flashlight on the bottom of the PCR centrifuge tube, observe the fluorescent color, and then read the result.

[0086] Specific test results such as Figure 3 As shown by Figure 3It can be seen that the kit prepared in Example 2 of the present invention can successfully detect MS2960 and MS11, while Mycoplasma gallisepticum, Mycoplasma felis, Salmonella, Escherichia coli, Campylobacter jejuni, Enterococcus, Streptococcus and Staphylococcus aureus have no fluorescent signals and cannot be detected, which proves that the detection method of the present invention has good specificity.

[0087] 2. Sensitivity detection

[0088] Take 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 The MS11 genomic DNA with the concentration of copies / μL and 1 copy / μL was used as the sample, and the negative control was made up with water, and the kit was used for detection to analyze the sensitivity of the detection method of the present invention. The detection steps were the same as "1. Specificity detection".

[0089] Sensitivity test results are as follows Figure 4 As shown by Figure 4 It can be seen that the test kit prepared in Example 2 of the present invention is used to detect Mycoplasma synoviae. 6 ~10 0 Fluorescence signals can be observed within the concentration range of copies / μL, and the minimum detection limit can reach 1 copy / μL, with high sensitivity.

[0090] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer-probe combination for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, characterized in that: It consists of an upstream primer sequence as shown in SEQ ID NO.3, a downstream primer sequence as shown in SEQ ID NO.4 and a crRNA probe sequence as shown in SEQ ID NO.

5.

2. Use of the primer-probe combination as claimed in claim 1 in the preparation of a kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12.

3. A kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, characterized in that: The invention comprises the primer-probe combination according to claim 1.

4. The kit according to claim 3, characterized in that Also included are recombinase polymerase, dNTPs, single-stranded DNA reporter sequences, buffers, Cas proteins, and genomic DNA extraction reagents.

5. The kit according to claim 4, characterized in that The single-stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA and AAA.

6. The kit according to claim 5, characterized in that The 5' end of the single-stranded DNA reporter sequence is modified with Atto425, BODIPYFL, FAM, Oregon Green 488, TET, JOE, R6G, YakimaYellow, VIC, HEX, Quasar570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670 or Cy5.5; the 3' end of the single-stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB or Dabcyl.

7. Use of the primer-probe combination according to claim 1 or the kit according to any one of claims 3 to 6 in detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12.

8. A method for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, characterized in that: The method comprises using the genomic DNA of the sample to be tested as a template, performing an RPA-CRISPR / Cas12 reaction using the primer-probe combination of claim 1, and irradiating with blue light after the reaction is completed. If fluorescence is observed, the sample to be tested contains Mycoplasma synoviae, and if no fluorescence is observed, the sample to be tested does not contain Mycoplasma synoviae.

9. The method according to claim 8, characterized in that The reaction system of the RPA-CRISPR / Cas12 reaction is 2 μL of DNA template, 2.4 μL of 10 μM upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 1.25 μL of 10 nM crRNA probe, 1 μL of 0.5 μM single-stranded DNA reporter sequence, 140 μL of 1× concentration of buffer, 80 nM Cas12a and 220 μL of 1× concentration of buffer; The components of the buffer 1 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / ml Bovine serum albumin and 280 mM Magnesium acetate; the components of the buffer 2 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, and 100 g / ml Bovine serum albumin.

10. The method according to claim 8, characterized in that The reaction conditions of the RPA-CRISPR / Cas12 reaction were a constant temperature of 37° C. and a reaction time of 50 min.

Images