A primer probe combination for detecting mycoplasma synoviae of chicken based on RPA-CRISPR / Cas12 and application thereof

Through RPA-CRISPR/Cas12 technology, a specific primer-probe combination was designed, and the Cas12a protein was used to cut the target site, achieving rapid, sensitive and specific detection of chicken synoviae Mycoplasma, solving the problems of traditional detection methods such as long time consumption and high equipment requirements. The detection limit can reach 1 copies/μL.

CN119753177BActive Publication Date: 2025-10-10HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411702229.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-26
Publication Date
2025-10-10
Estimated Expiration
2044-11-26

AI Technical Summary

Technical Problem

In the existing technology, the traditional method of detecting chicken synoviae Mycoplasma is time-consuming and requires high equipment, making it difficult to obtain results in a short period of time. It is also not sensitive enough, which affects the timing of grassroots promotion and treatment.

Method used

Using RPA-CRISPR/Cas12 technology, a specific primer-probe combination was designed. Cas12a protein was used to cut the target site of Mycoplasma synoviae under the guidance of crRNA, and rapid detection was performed through fluorescence signals, including a combination of upstream primers, downstream primers and crRNA probes.

Benefits of technology

The rapid, sensitive and specific detection of Mycoplasma synoviae is achieved, with a detection limit of 1 copy/μL, solving the problems of long detection time, high cost and insensitivity in existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119753177B_ABST
    Figure CN119753177B_ABST
Patent Text Reader

Abstract

The application discloses a primer probe combination for detecting chicken synovial mycoplasma based on RPA-CRISPR / Cas12 and application thereof, and belongs to the technical field of gene detection. The primer probe combination is composed of an upstream primer sequence shown as SEQ ID NO. 3, a downstream primer sequence shown as SEQ ID NO. 4 and a crRNA probe sequence shown as SEQ ID NO. 5. The primer probe combination designed in the application amplifies nucleic acids by using RPA amplification technology, and under the guidance of the crRNA probe, the product is cut by Cas12 enzyme to single-stranded DNA report sequence, and detection is carried out through a fluorescence signal, so that the chicken synovial mycoplasma can be rapidly detected in a specific manner, and the minimum detection limit can reach 1 copy / μL. The application not only can rapidly detect the result, but also solves the defects of current detection methods, such as low sensitivity, long time, high cost and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and in particular to a primer-probe combination and application for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12. Background Art

[0002] Mycoplasma synoviae (MS) is a common Gram-negative pathogen of joint infections in chickens, causing infectious synovitis and subclinical respiratory infections, as well as abnormal eggshell tip syndrome. M. synoviae primarily infects the air sacs and joints of chickens and turkeys. MS infection can cause respiratory symptoms and synovitis in chickens, with clinical symptoms and severity varying depending on the isolate. Bursitis, a hallmark symptom of avian M. synoviae, includes swelling, effusion, and pain in the synovial bursa, which is noticeably warm to the touch. Chickens may exhibit lameness, pacing, an inability to stand properly, poor foraging ability, decreased appetite, and weight loss. The primary clinical manifestation of M. synoviae is arthritis, with affected birds typically experiencing joint swelling, fever, and pain in the hip, knee, and metatarsal joints, resulting in limited mobility.

[0003] Mycoplasma can be detected and identified through isolation and culture, serological methods, and molecular biological methods. Serological methods can be further divided into the serum plate agglutination (SPA) test, the hemagglutination inhibition (HI) test, and the enzyme-linked immunosorbent assay (ELISA). Molecular biological methods can be further divided into PCR and fluorescent quantitative PCR. However, traditional mycoplasma detection methods are time-consuming and require high equipment, making it difficult to obtain identification results in a short period of time. This hinders grassroots promotion and detection, and may also delay treatment, increasing the difficulty of treatment and prognosis. Consequently, the demand for rapid mycoplasma detection has gradually increased. In recent years, a number of rapid methods for detecting pathogens have been developed. Isothermal amplification techniques such as loop-mediated isothermal amplification (LAMP), recombinase-assisted amplification (RAA), and recombinase polymerase amplification (RPA) have rapidly developed and are gradually being used in clinical practice due to their advantages such as low cost of equipment, rapid reaction times, and high sensitivity. RPA was first proposed in 2006. It is an amplification technology that mimics the replication mechanism of T4 bacteriophage DNA. It can rapidly amplify target gene fragments in vitro at a constant temperature of 37°C-42°C. It does not rely on expensive instruments and has high sensitivity and specificity, enabling rapid, portable, and visual detection of pathogens.

[0004] The CRISPR system is an acquired immune defense system used by bacteria and archaea to defend against foreign nucleic acid invasions, utilizing Cas effector proteins guided by crRNA. It can cleave and eliminate viral invasions and other foreign nucleic acid threats. The CRISPR-Cas system utilizes its own RNA to perform sequence pairing with target DNA, thereby recognizing specific sequences. S. pyogenes Cas9 (SpCas9, commonly referred to as Cas9) is the most widely used Cas protein due to its simple PAM sequence and high gene editing efficiency within cells. Cas12a (also known as Cpf1) is a CRISPR system distinct from Cas9. Research has shown that after the Cas12a protein binds to and cleaves the target DNA, it releases nonspecific single-stranded DNA cleavage activity. This activity confers a novel function to the Cas12a protein, making it an effective genetic testing tool and significantly improving its efficiency and accuracy. Leveraging this newly discovered ability, Cas12a can recognize and cleave the target DNA sequence while also releasing the attached single-stranded DNA, thereby achieving an efficient, rapid, and specific genetic testing technology.

[0005] The Cas12a protein recognizes T-rich PAM sites, forming a 5-nucleotide sticky end at the 5' end of the target sequence, and can also process itself to form mature crRNA. Cas12a is a prokaryotic deoxyribonuclease that is programmed to bind to a targeted complementary DNA sequence through crRNA guidance. After binding to the target DNA, Cas12a induces a nick in each target DNA strand, generating a double-stranded DNA break. CRISPR RNA (crRNA) is specifically designed to target double-stranded DNA (dsDNA) and is located downstream of a short T-rich protospacer adjacent motif (PAM). Utilizing this property, a luminescent molecule can be linked to an inhibitory molecule that prevents the luminescent molecule from emitting light (referred to as a reporter sequence) via single-stranded DNA. The target DNA can act as an activator, triggering both cis and trans cleavage by Cas12a. The fluorophore quencher-labeled reporter (FQreporter) in the system is then cut off, removing the luminescence inhibitory molecule, allowing the luminescent molecule to emit light, thereby detecting a light signal.

[0006] In the existing technology, the detection of Mycoplasma synoviae based on RPA and CRISPR / Cas technology has not yet been achieved. Summary of the Invention

[0007] The purpose of the present invention is to provide a primer-probe combination and application for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12 to solve the problems existing in the above-mentioned prior art. The primer-probe combination involved in the present invention has good specificity, which can not only quickly detect and obtain results, but also solve the shortcomings of current detection methods such as insensitivity, long time and high cost.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a primer-probe combination for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, which consists of an upstream primer sequence shown in SEQ ID NO.3, a downstream primer sequence shown in SEQ ID NO.4, and a crRNA probe sequence shown in SEQ ID NO.5.

[0010] Furthermore, the upstream primer sequence and the downstream primer sequence are designed based on the 1782bp conserved region specific to the vlhA gene, and the 1782bp conserved region sequence is shown in SEQ ID NO.1; the crRNA probe sequence is an RNA form that can guide Cas12 to cleave the Mycoplasma synoviae target gene and single-stranded DNA reporter sequence.

[0011] The present invention also provides the use of the primer-probe combination in preparing a kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12.

[0012] The present invention also provides a kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12, comprising the primer-probe combination.

[0013] Furthermore, it also includes recombinase polymerase, dNTP, single-stranded DNA reporter sequence, buffer, Cas protein and genomic DNA extraction reagent.

[0014] Furthermore, the single-stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA and AAA.

[0015] Further, the 5' end of the single-stranded DNA reporter sequence is modified with Atto 425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670 or Cy5.5; and the 3' end of the single-stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB or Dabcyl.

[0016] The application also provides an application of the primer probe combination or the kit in detecting Mycoplasma synoviae in chickens based on RPA-CRISPR / Cas12.

[0017] The application also provides a method for detecting Mycoplasma synoviae in chickens based on RPA-CRISPR / Cas12, which comprises using the primer probe combination to perform RPA-CRISPR / Cas12 reaction on the basis of the genomic DNA of a sample to be tested, and irradiating with blue light after the reaction is completed; if fluorescence is observed, the sample to be tested contains Mycoplasma synoviae; if no fluorescence is observed, the sample to be tested does not contain Mycoplasma synoviae.

[0018] The application releases the PAM distal product after the Cas protein cuts the double-stranded DNA substrate of the target site of Mycoplasma synoviae under the guidance of the crRNA probe, activates the non-specific cutting of the single-stranded DNA reporter sequence, and determines the result by observing the fluorescence with the naked eye under the irradiation of a blue flashlight.

[0019] Further, the reaction system of the RPA-CRISPR / Cas12 reaction is as follows: 2 μL of DNA template, 10 μM of upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 1.25 μL of 10 nM of crRNA probe, 0.5 μM of single-stranded DNA reporter sequence, 140 μL of 1× concentration of buffer, 80 nM of Cas12a and 220 μL of 1× concentration of buffer.

[0020] The components of the buffer 1 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / ml Bovine serum albumin and 280 mM Magnesium acetate; and the components of the buffer 2 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 and 100 g / ml Bovine serum albumin.

[0021] Furthermore, the reaction conditions of the RPA-CRISPR / Cas12 reaction are a constant temperature of 37° C. and a reaction time of 50 min.

[0022] The present invention discloses the following technical effects:

[0023] The present invention selects the vlhA gene of MS as the detection target gene, designs a set of RPA primers and crRNA probe combinations for the conserved region of the gene, uses RPA amplification technology to amplify the nucleic acid, and uses Cas12 enzyme to cut the single-stranded DNA reporter sequence under the guidance of the crRNA probe. The product is detected by fluorescence signal, which can specifically detect chicken synoviae Mycoplasma for rapid detection, with the lowest detection limit reaching 1 copies / μL.

[0024] The present invention can not only quickly detect and obtain results, but also solve the shortcomings of current detection methods such as insensitivity, long time and high cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 It is the fluorescence reporting result of the crRNA probe based on the amplification product of the optimal RPA primer;

[0027] Figure 2 This is the fluorescence report result of detecting Mycoplasma synoviae using the kit;

[0028] Figure 3 It is the specific test result;

[0029] Figure 4 This is the sensitivity test result. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an intermediate value of the parameter is understood to be specifically disclosed anywhere that the parameter is stated to have a range of values. Any smaller range of values of the parameter is understood to be specifically disclosed, even if the smaller range is not explicitly stated. The upper and lower limits of the smaller range of values are independently included in the disclosure. The smaller range is included in the disclosure independently of the larger range.

[0032] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present application, the preferred methods and materials are described herein. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In the case of conflict between the present specification and any document incorporated by reference, the present specification controls.

[0033] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0034] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional elements or steps.

[0035] The MS2960 (M.synoviae 2960) CVCC2960, Mycoplasma gallisepticum (M.gallisepticum) CVCC350, Salmonella (S.typhimurium) ATCC21527, Escherichia coli (E.coli) ATCC25922, Campylobacter jejuni (C.jejuni) ATCC33291, Enterococcus (E.faecalis) ATCC29212, Streptococcus (S.suis) ATCC49619, Staphylococcus aureus (S.aureus) ATCC29213 used in the examples of the present invention are all purchased standard strains; MS11 (classification name Mycoplasma synoviae 11) was isolated by Zhou Zutao's research group at Huazhong Agricultural University and deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, on September 29, 2024, and the deposit number being CCTCC NO: M 20242127; Mycoplasma felis (classification name Mycoplasmafelis 5) was isolated by the Veterinary Drug Residue Reference Laboratory of Huazhong Agricultural University and deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China. The deposit date is September 29, 2024, and the deposit number is CCTCC NO: M 20242126.

[0036] Example 1

[0037] 1. Cas12a protein expression and purification

[0038] The DNA fragment encoding LbCas12a was cloned into the pET30c vector containing a C-terminal 6-histidine tag to construct an expression plasmid. After BL21 (DE3) transformation, a single clone was selected and cultured overnight in 2×YT medium (10 g tryptone, 10 g yeast extract, 5 g NaCl) at 37°C. 600 When the concentration reached 0.6, 0.5 mM IPTG (isopropylthiogalactoside) was added to induce expression at 21°C for 16 h before harvesting the bacteria.

[0039] After harvesting the bacteria, the cells were resuspended and ultrasonically disrupted in lysis buffer (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 5% (v / v) glycerol, 1 mM TCEP, 0.25 mg / mL lysozyme). The supernatant obtained after disruption was filtered through a 0.22 μm filter membrane, purified using a HisTrap HP nickel column, eluted with 500 mM imidazole, concentrated to 500 μL using a 50 KDa ultrafiltration tube, and purified by dextran gel chromatography (Superdex Increase 200). The target protein was stored in storage buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 5% (v / v) glycerol, 1 mM TCEP) and frozen at -80°C until use.

[0040] 2. Preparation of single-stranded DNA reporter sequences

[0041] LbCas12a has a TT preference for non-specific cleavage of single-stranded DNA. The single-stranded DNA reporter sequence (5'-3') is: TTTTTT, 5'-end FAM modification, 3'-end BHQ1 modification, i.e. FAM-TTTTTT-BHQ1.

[0042] The single-stranded DNA reporter sequence is synthesized, purified and confirmed by bioengineering synthesis related companies.

[0043] 3. Screening and preparation of RPA primers

[0044] (1) Determination of candidate target sequences

[0045] Based on the MS vlhA gene reference sequence, the gene sequence of Mycoplasma synoviae sequenced in the laboratory and the gene sequence of Mycoplasma synoviae retrieved from the National Center for Biotechnology Information NCBI gene library were aligned, and the above gene target sequence is shown in SEQ ID NO.1.

[0046] vlhA gene reference sequence (SEQ ID NO.1):

[0047]

[0048] The conserved regions of the above genes were selected for subsequent studies.

[0049] (2) Screening and preparation of candidate RPA primers

[0050] Based on the conserved region sequence, primer lengths were limited to 25-36 bp and product lengths to 80-300 bp. Primer design software or websites were used for search, and two primer pairs with the highest scores were selected. RPA primers were synthesized, purified, and verified by a bioengineering synthesis company. The optimal RPA primers were determined through RPA amplification experiments based on amplified band size and product content. The optimal RPA primer sequences are shown in SEQ ID NOs. 3-4.

[0051] Upstream primer (SEQ ID NO. 3): TAACGGTGATAACCCTACAACCAAAACTGC;

[0052] Downstream primer (SEQ ID NO. 4): GCATAAACCCGTCTCAGTATAGTGTACGAG.

[0053] 4. Screening and preparation of crRNA probes

[0054] (1) Determination of candidate crRNA probe sequences

[0055] Because LbCas12a specifically cuts double-stranded DNA and needs to recognize PAM sequence (TTTN or TTN), the 20 nucleotides downstream of the PAM sequence are the region where the crRNA probe complements and recognizes the double-stranded DNA of the target site. Look for PAM sites (5'-TTN-3' or 5'-NAA-3') in the conserved region of the gene to determine the crRNA targeting sequence. Select the crRNA probe with a higher score. The crRNA targeting sequence is shown in SEQ ID NO.2.

[0056] crRNA targeting sequence (SEQ ID NO.2):

[0057] TAACGGTGATAACCCTACAACCAAAACTGC TTACTATAAAGCTGATACTA CTCGTA CACTATACTGAGACGGGTTTATGC (The underlined part is the sequence that matches the RPA primer, and the bold part is the sequence that matches the crRNA probe).

[0058] (2) Preparation of candidate crRNA probes

[0059] A T7 promoter sequence was added before the DNA sequence corresponding to the crRNA probe, and then its complementary sequence was slowly annealed to form a double-stranded DNA sequence, which was used as a template for in vitro transcription. T7 RNA polymerase was added and incubated at 37°C for 4 hours. The DNA template was digested with DNase I and then recovered using an RNA purification kit to obtain the crRNA probe.

[0060] (3) Screening of optimal crRNA probes

[0061] Using 2 μL of target gene double-stranded DNA at the same concentration as the substrate, 1.25 μL of crRNA probe and 1 μL of single-stranded DNA reporter sequence were added. The intensity of the fluorescent signal was compared to screen for crRNA probes with high specificity and sensitivity. The optimal crRNA probe sequence screened is shown in SEQ ID NO. 5.

[0062] crRNA probe sequence (SEQ ID NO. 5): UAAUUUCUACUAAGUGUAGAUCUAUAAAGCUGAUACUACUC.

[0063] The results of the fluorescence reporter experiment of the crRNA probe based on the optimal RPA primer amplification product are as follows Figure 1 shown.

[0064] Example 2

[0065] 1. Preparation of a CRISPR / Cas12-based kit for detecting Mycoplasma synoviae:

[0066] Lyophilize 2.4 μL each of 10 μM RPA upstream and downstream primers, 5 μL of 10× concentration recombinase polymerase, 5 μL of 1× concentration dNTPs, 1.25 μL of 10 nM crRNA probe, and 1 μL of 0.5 μM single-stranded DNA reporter sequence at the bottom of a PCR tube to obtain lyophilized reagent 1, and vacuum seal it in a tin foil bag for storage. When using, add 40 μL of buffer 1 to the PCR tube and reconstitute it. Lyophilize 20 μL of 80 nM Cas12 protein in a vial and add 20 μL of buffer 2 to reconstitute it. Enclose the above reagents and blue light flashlight in a packaging box to obtain the kit. The components of buffer 1 and buffer 2 are shown in Table 1.

[0067] Table 1 Buffer 1 and Buffer 2 Composition

[0068]

[0069] 2. Use the kit to detect Mycoplasma synoviae

[0070] Using MS2960 genomic DNA as sample, the sample concentration was diluted to 10 5copies / μL, 10 3 copies / μL and 10 1 copies / μL, using the kit for detection, the detection steps are as follows:

[0071] Add 40 μL of buffer 1 to the lyophilized centrifuge tube to reconstitute;

[0072] Take 2 μL of the genomic DNA to be tested, add it to the reconstituted PCR tube, and mix thoroughly by pipetting;

[0073] Place 2 μL of Cas12a complex solution on the cap of the PCR tube and slowly close the cap.

[0074] Place in a constant temperature of 37°C and react for 20 minutes;

[0075] Centrifuge to allow Cas12a protein to enter the reaction system and react at 37°C for 30 minutes;

[0076] Illuminate the bottom of the PCR centrifuge tube with a blue light flashlight and observe the fluorescence color. The fluorescence report result is as follows: Figure 2 .

[0077] Example 3

[0078] 1. Specificity detection

[0079] The specificity of the detection method of the present invention was analyzed using the kit for detection using genomic DNA from MS2960, MS11, Mycoplasma gallisepticum, Mycoplasma felis, Salmonella, Escherichia coli, Campylobacter jejuni, Enterococcus, Streptococcus, and Staphylococcus aureus as samples. The detection steps are as follows:

[0080] Add 40 μL of buffer 1 to the lyophilized centrifuge tube to reconstitute;

[0081] Take 2 μL of the genomic DNA to be tested, add it to the reconstituted PCR tube, and mix thoroughly by pipetting;

[0082] Place 2 μL of Cas12a complex solution on the cap of the PCR tube and slowly close the cap.

[0083] Place in a constant temperature of 37°C and react for 20 minutes;

[0084] Centrifuge to allow Cas12a protein to enter the reaction system and react at 37°C for 30 minutes;

[0085] Shine a blue light flashlight on the bottom of the PCR centrifuge tube, observe the fluorescent color, and then read the result.

[0086] Specific test results such as Figure 3 As shown by Figure 3It can be seen that the kit prepared in Example 2 of the present invention can successfully detect MS2960 and MS11, while Mycoplasma gallisepticum, Mycoplasma felis, Salmonella, Escherichia coli, Campylobacter jejuni, Enterococcus, Streptococcus, and Staphylococcus aureus have no fluorescent signals and cannot be detected, demonstrating that the detection method of the present invention has good specificity.

[0087] 2. Sensitivity detection

[0088] 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 The sensitivity of the detection method of the present invention was analyzed using the kit with 100 copies / μL and 1 copy / μL of MS11 genomic DNA as samples and a negative control supplemented with water. The detection steps were the same as those in "1. Specificity Detection".

[0089] Sensitivity test results are as follows Figure 4 As shown by Figure 4 It can be seen that the kit prepared in Example 2 of the present invention is used to detect Mycoplasma synoviae. 6 ~10 0 Fluorescence signals can be observed within the concentration range of copies / μL, and the minimum detection limit can reach 1 copy / μL, with high sensitivity.

[0090] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A primer-probe combination for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12a, characterized in that: It consists of an upstream primer sequence as shown in SEQ ID NO.3, a downstream primer sequence as shown in SEQ ID NO.4, and a crRNA probe sequence as shown in SEQ ID NO.

5.

2. Use of the primer-probe combination according to claim 1 in the preparation of a kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12a.

3. A kit for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12a, characterized in that: The method comprises the primer-probe combination according to claim 1.

4. The kit according to claim 3, wherein Also included are recombinase polymerase, dNTPs, single-stranded DNA reporter sequence, buffer, Cas12a protein, and genomic DNA extraction reagents.

5. The kit according to claim 4, characterized in that The single-stranded DNA reporter sequence is TTTTTT.

6. The kit according to claim 5, characterized in that The 5' end of the single-stranded DNA reporter sequence is modified with Atto425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670 or Cy5.5; the 3' end of the single-stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB or Dabcyl.

7. Use of the primer-probe combination according to claim 1 or the kit according to any one of claims 3 to 6 in detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12a for non-disease diagnosis purposes.

8. A method for detecting Mycoplasma synoviae based on RPA-CRISPR / Cas12a for non-disease diagnosis purposes, characterized in that: The method comprises using the genomic DNA of the sample to be tested as a template, performing an RPA-CRISPR / Cas12a reaction using the primer-probe combination of claim 1, and irradiating with blue light after the reaction. If fluorescence is observed, the sample to be tested contains Mycoplasma gallinarum; if no fluorescence is observed, the sample to be tested does not contain Mycoplasma gallinarum.

9. The method according to claim 8, characterized in that The reaction system of the RPA-CRISPR / Cas12a reaction is 2 μL of DNA template, 2.4 μL of 10 μM upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 1.25 μL of 10 nM crRNA probe, 1 μL of 0.5 μM single-stranded DNA reporter sequence, 40 μL of 1× concentration of buffer 1, 80 nM Cas12a and 20 μL of 1× concentration of buffer 2; The components of buffer 1 are 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100g / ml Bovine serum albumin and 280mM Magnesium acetate; the components of buffer 2 are 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, and 100g / ml Bovine serum albumin.

10. The method according to claim 8, characterized in that The reaction conditions of the RPA-CRISPR / Cas12a reaction were a constant temperature of 37° C. and a reaction time of 50 min.

Citation Information

Patent Citations

  • Mycoplasma synoviae indirect ELISA detection kit

    CN110221065A

  • RPA kit for rapidly detecting mycoplasma synoviae of chicken and its use

    CN110305975A