Mycoplasma gallisepticum and mycoplasma synoviae multi-epitope recombinant protein as well as preparation method and application thereof
By screening and constructing recombinant proteins with multiple epitopes from Mycoplasma cambogia and Mycoplasma synoviae, the problems of long immunization cycles, high costs, and the risk of virulence reversion associated with existing vaccines have been solved. This approach achieves safe and low-cost dual immunization and provides effective protection against variant strains.
Patent Information
- Application Number
- CN202511418403.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-01-16
AI Technical Summary
Existing vaccines for the prevention and treatment of Mycoplasma cambogia and Mycoplasma synoviae diseases have problems such as long immunization cycles, high costs, risk of virulence reversion, and lack of bivalent vaccines. Furthermore, the rapid evolution of drug-resistant strains weakens the clinical efficacy of traditional antibiotics.
A recombinant protein with multiple epitopes from Mycoplasma gallisepticum and Mycoplasma synoviae was prepared. Safe and stable B-cell and T-cell epitopes were screened, and a recombinant Escherichia coli expression system was constructed to prepare a bivalent multi-epitope vaccine, achieving simultaneous protection against both pathogens.
It achieves safe and low-cost dual immunization, is also effective against mutant strains, provides a new prevention and control strategy, and reduces the severity of disease and bacterial load in chickens.
Smart Images

Figure CN121343005A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a multi-epitope recombinant protein of Mycoplasma gallisepticum and Mycoplasma synoviae, its preparation method and application. Background Technology
[0002] Avian mycoplasma infection is one of the most important respiratory diseases in poultry farming. Infected poultry exhibit decreased egg production, slowed growth, reduced feed conversion ratio, and decreased carcass quality, causing significant economic losses to the poultry industry. Etiological studies have shown that *Mycoplasma gallisepticum* (MG) and *Mycoplasma synoviae* (MS) are the core pathogens causing avian mycoplasma infection, each with only one serotype. MG can cause chronic respiratory disease in chickens and infectious sinusitis in turkeys, while MS infection may affect the synovium of joints and tendon sheaths, accompanied by mild respiratory disease. Furthermore, poultry of all ages are susceptible to both MG and MS, and mixed infections are common in clinical practice, causing significant economic impacts on poultry farming.
[0003] Currently, the main control measures for avian mycoplasma diseases include biosafety measures, treatment, and vaccination. Due to the lack of a cell wall, mycoplasma are naturally resistant to β-lactam antibiotics such as penicillin and cephalosporins. Before the implementation of the "antibiotic restriction" policy, tetracyclines, macrolides, fluoroquinolones, and truncated pleurotins were widely used; however, the rapid evolution of resistant strains has severely weakened the clinical efficacy of these drugs. Vaccines, as a source control measure, have received considerable attention for their development and application. Commercial vaccines against MG mainly include inactivated vaccines and live attenuated vaccines: inactivated vaccines are safe and pose no risk of transmission, but have limitations such as long immunization cycles, high costs, and local side effects; live attenuated vaccines, while inducing stronger immune responses, carry the risk of virulence reversion. MS vaccines also face similar challenges; the safety and protective efficacy of existing commercially available live attenuated vaccines need to be optimized. Furthermore, there are currently no bivalent vaccines for MG and MS on the market. Therefore, developing highly effective and safe broad-spectrum vaccines has become an urgent need for the control of avian mycoplasma diseases.
[0004] With the development of novel technologies such as reverse vaccinology and bioinformatics, multiepitope vaccines have become one of the most promising vaccine technologies. Multiepitope vaccines, also known as cocktail vaccines, carry multiple target antigen-associated and helper epitopes simultaneously; they are a new type of subunit vaccine. Epitopes are the basic components of an antigen molecule that can elicit an effective immune response, i.e., antigenic determinants. Multiepitope vaccines, made by tandemly linking multiple short antigenic epitopes, offer advantages such as low cost, high safety, high specificity, and ease of production, storage, and use, effectively overcoming the limitations of traditional vaccine production and application. Currently, domestic and international scholars have conducted research on multiepitope vaccines targeting MG and MS. Among them, Mugunthan et al. designed a multi-epitope candidate vaccine for MG containing 9 CTL epitopes, 8 HTL epitopes, and 9 B-cell epitopes from 9 antigen proteins (GapA, PlpA, Hlp3, CrmA, VlhA.1.07, VlhA.4.01, VlhA.2.02, VlhA.3.03, and VlhA.5.13). However, their research is still at the stage of computer-based effect prediction and has not been validated through further animal experiments. Zhong Lemiao's team designed a tandem peptide vaccine (named mEA) containing multiple adhesin proteins (CrmA, GapA, Mgc2, and PvpA) B and T-cell epitopes from MG, which can effectively alleviate tracheal mucosal damage in chickens caused by Mycoplasma gallisepticum. Zhang et al. screened five candidate antigen proteins (BMP, GrpE, RS001790, RS00900, and RS00275) from the whole genome sequence of MS using reverse vaccinology. After identifying the immunogenicity of the proteins, they designed a multi-epitope vaccine (MSMV) containing 14 B-cell epitopes, 5 CTL epitopes, and 16 HTL epitopes using bioinformatics techniques. This vaccine significantly reduced air sac damage and tracheal mucosal thickness in immunized chickens, and the immunized chickens showed significantly lower MS colonization. Although some progress has been made in the research of single-pathogen multi-epitope vaccines against MG or MS, no multi-epitope candidate vaccines that can simultaneously cover both pathogens have been reported. Summary of the Invention
[0005] The purpose of this invention is to provide a recombinant protein containing multiple epitopes of Mycoplasma gallisepticum and Mycoplasma synoviae, along with its preparation method and applications, to address the problems existing in the prior art. This invention prepares a recombinant protein containing multiple epitopes of Mycoplasma gallisepticum and Mycoplasma synoviae, which is safe, stable, low-cost, non-toxic to the body, and capable of simultaneously inducing humoral and cellular immunity. This recombinant protein can recognize multiple antigenic epitopes of Mycoplasma gallisepticum and Mycoplasma synoviae, achieving the technical effect of preventing two diseases with a single vaccine. It also provides effective protection against some variant strains, offering a new strategy for the prevention and control of avian mycoplasma diseases.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides a recombinant protein with multiple epitopes from Mycoplasma gallisepticum and Mycoplasma synoviae, the amino acid sequence of which is shown in SEQ ID NO.2.
[0008] The present invention also provides a gene encoding the above-mentioned multi-epitope recombinant protein, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0009] The present invention also provides a recombinant vector expressing multi-epitope recombinant proteins of Mycoplasma gallisepticum and Mycoplasma synoviae, wherein the recombinant vector contains the above-mentioned genes.
[0010] The present invention also provides a recombinant bacterium, *Escherichia coli rMGMS*, expressing multi-epitope recombinant proteins of *Mycoplasma gallisepticum* and *Mycoplasma synoviae*. The recombinant *Escherichia coli rMGMS* is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on April 3, 2025, with accession number CCTCCNO: M2025703.
[0011] The present invention also provides a method for preparing the above-mentioned Mycoplasma gallisepticum and Mycoplasma synoviae multi-epitope recombinant protein, comprising the steps of ligating the sequence shown in SEQ ID NO.1 to an expression vector to construct a recombinant vector, then transforming it into a host bacterium, inducing expression, purifying, and obtaining the Mycoplasma gallisepticum and Mycoplasma synoviae multi-epitope recombinant protein.
[0012] Optionally, the method further includes the step of inducing expression and purification of the above-mentioned recombinant bacteria Escherichia coli rMGMS by IPTG to obtain the multi-epitope recombinant protein of Mycoplasma gallisepticum and Mycoplasma synoviae.
[0013] The present invention also provides the application of the above-mentioned recombinant protein of Mycoplasma gallisepticum and Mycoplasma synoviae multiepitope or the recombinant protein of Mycoplasma gallisepticum and Mycoplasma synoviae prepared by the above preparation method in the preparation of a bivalent multiepitope vaccine of Mycoplasma gallisepticum and Mycoplasma synoviae.
[0014] The present invention also provides a bivalent multi-epitope vaccine for Mycoplasma cambogia and Mycoplasma synoviae, wherein the bivalent multi-epitope vaccine is prepared from the above-mentioned recombinant multi-epitope proteins of Mycoplasma cambogia and Mycoplasma synoviae and a vaccine adjuvant.
[0015] The present invention discloses the following technical effects:
[0016] This invention screens and identifies antigenic proteins related to Mycoplasma gallisepticum and Mycoplasma synoviae, identifying dominant B-cell epitopes, CTL epitopes, and HTL epitopes that are antigenic, water-soluble, non-toxic, non-allergenic, and not located in transmembrane structures or signal peptide regions. Using bioinformatics techniques, genes encoding recombinant proteins with multiple epitopes from Mycoplasma gallisepticum and Mycoplasma synoviae were synthesized, and recombinant Escherichia coli expressing these recombinant proteins were successfully constructed.
[0017] The recombinant protein containing multiple epitopes of Mycoplasma gallisepticum and Mycoplasma synoviae prepared by this invention has advantages such as safety and stability, low cost, non-toxicity to the body, and the ability to induce both humoral and cellular immunity. Furthermore, this recombinant protein can recognize multiple antigenic epitopes of Mycoplasma gallisepticum and Mycoplasma synoviae, achieving the technical effect of preventing two diseases with a single vaccine. It does not require the cultivation of microorganisms and can also provide effective protection against some variant strains, providing a new strategy for the prevention and control of avian mycoplasma diseases. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is a schematic diagram of the technical route of the present invention;
[0020] Figure 2 A schematic diagram of the amino acid structure of the multi-epitope recombinant protein rMGMS;
[0021] Figure 3 The tertiary structure of the multi-epitope recombinant protein rMGMS;
[0022] Figure 4 The results show the tertiary structure validation of the multi-epitope recombinant protein rMGMS; where A is the evaluation result of rMGMS by the ProSA-web server (Z score: -3.93); B is the protein structure analyzed by the Ramachandran plot; and C is the overall quality of the 3D structure predicted by the ERRAT module.
[0023] Figure 5 The results show the molecular docking of the multi-epitope recombinant protein rMGMS; where A is the docking model of rMGMS protein with MHC-I molecules; B is the docking model of rMGMS protein with MHC-II molecules; and C is the docking model of rMGMS protein with TLR-4 receptor molecules.
[0024] Figure 6The recombinant plasmid pET28a(+)-rMGMS map;
[0025] Figure 7 This is a sequence alignment diagram of E. coli BL21(DE3) / pET-28a-rMGMS transformed by the recombinant plasmid.
[0026] Figure 8 The results of PCR identification of the recombinant plasmid transformed E. coli BL21(DE3) / pET-28a-rMGMS are shown. Lane M is the DL 2000 DNA Marker; lanes 1-2 are the recombinant plasmid transformed E. coli BL21(DE3) / / pET-28a-rMGMS; lane 3 is the recombinant plasmid pET-28a-rMGMS; lane 4 is the negative control (water).
[0027] Figure 9 SDS-PAGE was used to identify the expression and denaturation purification of multi-epitope proteins induced by rMGMS. Lane M was Protein Marker (8-195 kDa); lanes 1-2 were whole cells of E. coli BL21(DE3) / pET28a(+)-rMGMS-induced recombinant plasmid; lanes 3-4 were supernatants of E. coli BL21(DE3) / pET28a(+)-rMGMS-induced lysate; lanes 5-6 were supernatants of E. coli BL21(DE3) / pET28a(+)-rMGMS-induced lysate after denaturation and dissolution, followed by further lysate; lanes 7-8 were flow-through buffer; lanes 9-16 were washing buffer; and lanes 17-28 were 250 mmol / L imidazole elution buffer.
[0028] Figure 10 The results of Western Blot identification of the multi-epitope protein rMGMS after refolding are shown; lane M is Protein Marker (18-200kDa), and lane 1 is the refolded rMGMS protein.
[0029] Figure 11 The standard curve is shown for the BSA standard protein concentration versus A562 absorbance.
[0030] Figure 12 The changes in body weight of chickens in each group during the immunization period;
[0031] Figure 13 The changes in IgY antibody levels in the serum of chickens in each group;
[0032] Figure 14The changes in the levels of IFN-γ and IL-4 cytokines in the serum of chickens in each group are shown; where A represents the changes in the levels of IFN-γ cytokines and B represents the changes in the levels of IL-4 cytokines.
[0033] Figure 15 The air sac damage scores of chickens in each group after the viral challenge were calculated.
[0034] Figure 16 Standard curves for pTOPO-MG and pTOPO-MS recombinant plasmids at different dilutions are shown; where A is the standard curve for pTOPO-MG recombinant plasmids and B is the standard curve for pTOPO-MS recombinant plasmids.
[0035] Figure 17 The data show the DNA copy number of MG in the pharynx and MS in the footpads of chickens in each group after challenge; where A represents the DNA copy number of MG in the pharynx of chickens; and B represents the DNA copy number of MS in the footpads of chickens.
[0036] Figure 18 The changes in mucosal thickness in the upper, middle, and lower parts of the trachea of chickens in each group after challenge with the virus are shown. Among them, A represents the changes in mucosal thickness in the upper part of the trachea; B represents the changes in mucosal thickness in the middle part of the trachea; and C represents the changes in mucosal thickness in the lower part of the trachea. Detailed Implementation
[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0038] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0039] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0040] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0041] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0042] The technical route of the present invention is as follows Figure 1 As shown, the research involves the following content:
[0043] Step 1: Referring to previous characterization and identification of Mycoplasma gallisepticum and Mycoplasma synoviae-related antigen proteins, seven proteins targeting Mycoplasma gallisepticum (CrmA, PDHB, PlpA, Hlp3, Mgc2, and VlhA) and five proteins targeting Mycoplasma synoviae (BMP, GrpE, RS01790, RS00900, and NADH oxidase) were screened as candidate antigens.
[0044] Step 2: Download the FASTA sequences of Mycoplasma gallisepticum CrmA (ADC31130.1), PDHB (ADC30690.1), PlpA (SYV94409.1), Hlp3 (ULH68508.1), Mgc2 (Q595D9), VlhA (ANN85843.1) and Mycoplasma synoviae BMP (WP_191584256.1), GrpE (WP_154221391.1), RS01790 (WP154221545.1), RS00900 (WP154221442.1), and NADH oxidase (QLE14014.1) proteins from NCBI or Uniprot.
[0045] Step 3: Predict B-cell and T-cell epitopes for all candidate antigens, and screen out dominant B-cell epitopes, CTL epitopes, and HTL epitopes that are antigenic, water-soluble, non-toxic, non-sensitizing, and not located in transmembrane structures or signal peptide regions.
[0046] Step 4: The selected dominant B cell epitopes, CTL epitopes, and HTL epitopes are tandemly linked by the flexible peptides KK / AAY / GPGPG, and the molecular adjuvant β-defensin 8 is linked to the N-terminus of the construct using the EAAAK linker to form the multi-epitope recombinant protein rMGMS.
[0047] Step 5: Characterize various properties of the multi-epitope recombinant protein rMGMS, including antigenicity, water solubility, sensitization, toxicity, transmembrane helix number, signal peptide, and physicochemical properties.
[0048] Step 6: Perform structural prediction, molecular docking, and electronic immunoassay simulation on the multi-epitope recombinant protein rMGMS, and conduct a preliminary online assessment of the immunogenicity of rMGMS.
[0049] Step 7: Mix and emulsify the recombinant protein rMGMS with adjuvant at a certain concentration and in an equal proportion to obtain a multi-epitope recombinant protein vaccine of Mycoplasma cambogia and Mycoplasma synoviae.
[0050] Step 8: Immunization and challenge protection tests were conducted on 1-day-old SPF Leghorn chicks using the prepared rMGMS multi-epitope vaccine. The immunization and protective effects of the rMGMS vaccine were evaluated through a series of tests, including vaccine safety, specific IgG antibody levels, cytokine levels, air sac lesion scores, bacterial load in the pharynx and footpads, tracheal mucosal thickness, and pathological damage assessment.
[0051] The experimental materials used in the following examples are as follows:
[0052] Thirty-two SPF White Leghorn chicks were purchased from Boehringer Ingelheim Viton Biotechnology Co., Ltd. in Beijing for use in a multi-epitope vaccine immunogenicity study. All chicks were housed in stainless steel poultry isolators at the Department of Veterinary Medicine, Huazhong Agricultural University, with free access to water and SPF chick feed. The rearing temperature was maintained at 36-37°C for the first week, then decreased by 1°C daily until reaching 30°C, while the room temperature was maintained at 24°C. The experiment was conducted in accordance with the guidelines stipulated in the "Regulations on the Management of Laboratory Animals in China" (1988) and the "Regulations on the Management of Laboratory Animals in Hubei Province" (2005). In this invention, all work was carried out ethically, and animal suffering was minimized. Ethics Certificate No.: HZAUCH-2024-0030.
[0053] Inclusion body lysis buffer: Accurately weigh 480.5g urea, 6.057g Tris and 17.54g sodium chloride, dissolve in 900mL double-distilled water, add double-distilled water to make up to 1L, adjust pH to 7.4, filter using a 0.22μm aqueous phase filter membrane, and store at 4℃.
[0054] Inclusion body washing buffer: Accurately weigh 480.5g urea, 6.057g Tris, 17.54g sodium chloride and 1.36g imidazole, dissolve in 900mL double-distilled water, add double-distilled water to make up to 1L, adjust pH to 7.4, filter using a 0.22μm aqueous phase filter membrane, and store at 4℃.
[0055] Inclusion body elution buffer: Accurately weigh 480.5g urea, 6.057g Tris, 17.54g sodium chloride and 17g imidazole, dissolve in 900mL double-distilled water, add double-distilled water to make up to 1L, adjust pH to 7.4, filter using a 0.22μm aqueous phase filter membrane, and store at 4℃.
[0056] SEQ ID NO.1:
[0057]
[0058] SEQ ID NO.2:
[0059] .
[0060] Example 1: Design of a multi-epitope recombinant protein vaccine containing Mycoplasma gallisepticum and Mycoplasma synoviae
[0061] 1. Selection of candidate antigen proteins and gene sequence retrieval
[0062] Literature reviews were conducted on websites such as PubMed and CNKI, and seven immunogenic candidate proteins (CrmA, PvpA, PlpA, Mgc2, VlhA, Hlp3, and PHDB) and five immunogenic candidate proteins (BMP, NADH oxidase, GrpE, RS00900, and RS01790) were screened for MG and MS, respectively. After screening for candidate antigens of MG and MS, amino acid sequences of the candidate antigens were searched and downloaded using the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / ) or the Universal Protein Database (Uniprot) (https: / / www.uniprot.org / ). The results are shown in Table 1.
[0063] Table 1. FASTA sequence sources of candidate proteins
[0064]
[0065]
[0066] 2. Prediction and screening of linear B-cell epitopes
[0067] ABCpred (https: / / webs.iiitd.edu.in / raghava / abcpred / ABC_submission.html) was used to predict B-cell epitopes of antigenic proteins in MG and MS. All parameters were kept at default settings, and epitopes with scores greater than 0.8 were initially selected.
[0068] SignalP-5.0 Server (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ) was used to analyze the signal peptide for each protein, with the species grouping selected as "Gram-negative". Epitopes located in the signal peptide region were removed based on the prediction results. TMHMM v.2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) was used to analyze the transmembrane helix number for each protein, removing epitopes located in the transmembrane region. VaxiJen v2.0 (https: / / www.ddg-pharmfac.net / vaxijen / VaxiJen / VaxiJen.html) was used to analyze the antigenicity of epitopes. The default bacterial model antigen threshold was 0.4, removing epitopes with antigenicity scores less than 0.4. Innovagen (https: / / pepcalc.com / ) was used to analyze the water solubility of epitopes, removing epitopes with poor water solubility. AllerTOP v.2.0 (https: / / www.ddg-pharmfac.net / AllerTOP / ) online server was used to perform sensitization analysis on antigenic epitopes, filtering out epitopes that might be sensitizing. ToxinPred (https: / / webs.iiitd.edu.in / raghava / toxinpred / protein.php) was used to perform toxicity analysis on antigenic epitopes, removing epitopes containing toxic sequences. The final selected B-cell epitopes are shown in Table 2.
[0069] Table 2 Selection of candidate protein B-cell epitopes
[0070]
[0071] 3. Prediction and screening of T cell epitopes
[0072] The TepiTool of IEDB (http: / / tools.iedb.org / tepitool / ) was used to predict T-cell antigenic epitopes for all candidate proteins. Alleles HLA-B*41:03, HLA-B*41:04, and HLA-B*40:06 were selected to predict CTL (MHC-I) epitopes, and alleles HLA-DRB1*13:10, HLA-DRB1*13:66, HLA-DRB1*14:45, and HLA-DRB1*14:82 were selected to predict HTL (MHC-II) epitopes. Based on percentile ranking (less than 2), the top-ranking MHC-I and MHC-II binding peptides were selected, and these preferred epitopes were used for further analysis and screening. Epitopes were screened using signal peptide, transmembrane helix number, antigenicity, water solubility, allergenicity, and toxicity analysis results. The final selected CTL / HTL epitopes are shown in Tables 3 and 4.
[0073] Table 3 Selection of CTL epitopes for candidate proteins
[0074]
[0075] Table 4 Selection of HTL epitopes for candidate proteins
[0076]
[0077]
[0078] 4. Construction and physicochemical property analysis of the multi-epitope recombinant protein rMGMS
[0079] Based on the predicted scores from ABCpred and IEDB, and combined with the predicted analysis results of signal peptide, transmembrane helix number, antigenicity, water solubility, allergenicity, and toxicity, B and T cell dominant antigenic epitopes of MG and MS candidate proteins were comprehensively screened. The finally selected dominant antigenic epitopes were then linked using a flexible protein linker, with CTL epitopes linked using the "AAY" amino acid sequence, HTL epitopes using "GPGPG," and B cell epitopes using the "KK" amino acid sequence. Furthermore, because the B cell epitope (GGTNDQAYDPNQMQYD) selected from the PlpA protein had the highest software score among all selected dominant epitopes, this epitope sequence was repeated and tandemly. The amino acid sequences of the CTL, HTL, and B cell epitopes were ordered, and the amino acid sequence of the intramolecular adjuvant (β-defensin 8) was linked to the first CTL epitope using an EAAAK linker, forming the multi-epitope recombinant protein rMGMS, the structural diagram of which is shown below. Figure 2 As shown.
[0080] The amino acid sequence of the multi-epitope recombinant protein rMGMS was analyzed using ExPASy's ProtParam tool (https: / / web.expasy.org / protparam / ), including theoretical pI, molecular weight, half-life, instability index, and gravy. Combined with predictions of antigenicity, allergenicity, signal peptide, and transmembrane helix number, the rMGMS protein was analyzed, and the results are shown in Table 5. The results indicate that the rMGMS protein is physicochemically stable and has good hydrophilicity, which is beneficial for subsequent protein expression.
[0081] Table 5. Analysis of transmembrane helix number, signal peptide, antigenicity, sensitization and physicochemical properties of rMGMS.
[0082] parameter result logo amino acid count 533 suitable molecular weight 58463.14 medium Theoretical isoelectric point 9.56 Slightly alkaline Half-life (mammalian reticulocytes, in vitro) 30h suitable Half-life (yeast, in vivo) >20h suitable Half-life (E. coli, in vivo) >10h suitable Instability Index (II) 37.69 <40 is considered stable aliphatic index 53.53 Higher thermal stability is better Overall average hydrophilicity (GRAVY) -1.052 <0 is considered hydrophilic. antigenicity 1.0094 >0.4 is considered antigenic. Allergenicity Non-allergen Non-allergen transmembrane helical number 0 Non-transmembrane structure Signal peptide region none No signal peptide region
[0083] 5. Tertiary structure prediction, improvement, and validation of multi-epitope recombinant protein rMGMS
[0084] The tertiary structure of the multiepitope protein rMGMS was predicted using I-TASSER (https: / / seq2fun.dcmb.med.umich.edu / I-TASSER / ), generating a 3D structural model of rMGMS. GalaxyRefine (https: / / galaxy.seoklab.org / cgi-bin / submit.cgi?type=REFINE) was then used to improve and refine the 3D model predicted by the I-TASSER server, generating an improved 3D structural model of rMGMS. The improved 3D model was visualized using PyMOL software, and the results are shown below. Figure 3 As shown.
[0085] The improved 3D structural model was validated using ProSA-web (https: / / prosa.services.came.sbg.ac.at / prosa.php), which provides a Z-score for the predictive analysis model. A lower Z-score indicates higher relative stability and accuracy. The improved 3D structural model was also validated using the ERRAT and PROCHECK modules of SAVES v6.0 to evaluate the overall quality of the multi-epitope protein rMGMS model. The results are as follows: Figure 4 As shown in the figure. The results show that the improved model structure has good stability and local folding quality.
[0086] 6. Docking of the multi-epitope recombinant protein rMGMS with immune receptor molecules
[0087] The 3D structure of the multiepitope protein rMGMS was docked with the immune receptor molecules MHC-I (PDB ID: 1L1Y), MHC-II (PDB ID: 1KG0), and TLR-4 (PDB ID: 4G8A) using Cluspro 2.0 (https: / / cluspro.bu.edu / login.php). From the first 10 docking protocols generated by MHC-I, MHC-II, and TLR-4 with rMGMS, the docking complex with the lowest binding energy was selected and its 3D structure was visualized using PymoL software. The results are shown below. Figure 5 As shown in the figure. The results indicate that the rMGMS protein can effectively interact with these three immune receptor molecules.
[0088] Example 2: Induction and purification of recombinant protein rMGMS
[0089] 1. Transformation and identification of recombinant plasmids
[0090] The target gene (SEQ ID NO.1) was synthesized and constructed by Qingke Biotechnology Co., Ltd., using the recombinant plasmid pET-28a(+)-rMGMS. The plasmid map is shown below. Figure 6 As shown in the figure. The plasmid pET28a(+)-rMGMS was transformed into *E. coli* BL21(DE3) competent cells and plated on LB / Kan+ agar plates to obtain the recombinant plasmid transformed *E. coli* BL21(DE3) / pET28a(+)-rMGMS, named *Escherichia coli* rMGMS. Sequencing and PCR identification were performed. The primer sequences were: F: 5'-AATACTACTGCCGTGTTCGTG-3' (SEQ ID NO.3), R: 5'-TTGGTCGCTTTCTTACCCGG-3' (SEQ ID NO.4). The sequencing alignment results and PCR identification results are shown in the figure. Figure 7 and Figure 8 As shown.
[0091] The recombinant expression strain *Escherichia coli* rMGMS was deposited on April 3, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2025703.
[0092] 2. Induced expression of recombinant proteins with multiple epitopes
[0093] 100 μL of *E. coli* rMGMS culture was transferred to 3 mL of LB liquid medium (KAN resistant) and incubated overnight at 37 °C and 220 rpm for recovery. Then, 1 mL of the culture was transferred to 100 mL of LB liquid medium (KAN resistant) for expansion, and cultured for 4-5 h before OD analysis. 600 Determination of OD value. 600 When the pH value reaches approximately 0.6-0.8, add IPTG inducer to a final concentration of 0.1 mmol / L and induce for 5 h at 37℃ and 220 r / min. After induction, take 1 mL of bacterial culture from each group of samples, centrifuge, discard the supernatant, resuspend the precipitate in 80 μL of sterile water, add 20 μL of 5× protein loading buffer, mix well, and boil in a metal bath for 10 min. The treated samples are then identified by SDS-PAGE electrophoresis. The results are as follows: Figure 9 As shown in the figure. The results indicate that rMGMS can be expressed in small amounts in a soluble form, with the majority existing in inclusion body precipitates.
[0094] 3. Inclusion body denaturation and purification of multi-epitope recombinant proteins
[0095] After induction, the bacterial culture was centrifuged, and the bacterial pellet was resuspended in urea-free Lysis Buffer. The pellet was then lysed in a cell disruptor on ice for 2-3 cycles. After disruption, the pellet was centrifuged at 12000 rpm for 10 min at 4°C, and the inclusion bodies were collected. The inclusion bodies were resuspended in Lysis Buffer containing 8 mol / L urea, and the pellet was again lysed in a cell disruptor on ice for 2-3 cycles. After disruption, the pellet was centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected and filtered through a 0.45 μm filter for subsequent denaturation and purification. The results are shown below. Figure 9 As shown in the figure. The results showed that a clear single rMGMS band appeared under denaturing elution with 250 mmol / L imidazole, and its size matched that of the target protein, indicating that the multi-epitope recombinant protein rMGMS was successfully purified under denaturing conditions. The specific purification steps are as follows:
[0096] ① Equilibrate the packed Ni NTABeads 6FF gravity column with 5 column volumes of Lysis Buffer containing urea, so that the packing material is in the same buffer system as the target protein, and repeat 2-3 times.
[0097] ② Add the sample to the balanced gravity column and retain the sample for at least 2 minutes to ensure full contact between the sample and the medium. Collect the effluent.
[0098] ③ Use 10 times the volume of Wash Buffer to wash away non-specifically adsorbed proteins and collect the washing solution;
[0099] ④ Elute with 5 column volumes of Elution Buffer (50, 100, 200, 250, 300, and 500 mmol / L imidazole). Collect the remaining flow-through, washings, and elution buffer in fractions, one tube per column volume, and analyze them separately. This ensures that all bound target proteins are eluted, and yields high-purity and high-concentration proteins.
[0100] 4. Refolding and Western Blot Identification of Multi-Epitope Recombinant Proteins
[0101] The purified protein was placed into a prepared dialysis bag and then placed in refolding solutions containing 6, 4, 2, and 0 mol / L urea, respectively, according to a gradient. The mixture was magnetically stirred at 4°C, with the next gradient of refolding solution replaced every 6-8 hours. After refolding, the protein was collected and analyzed by Western blotting. The results are as follows: Figure 10 As shown in the figure. The results showed that the refolded rMGMS exhibited a relatively clear target band at approximately 63 kDa and could specifically bind to the Mouse anti-His tag mAb antibody.
[0102] 5. Determination of protein concentration after refolding
[0103] The total protein concentration was determined using a BCA protein concentration kit, following the instructions. First, a standard curve was established using BCA protein standards and the absorbance of the A562 absorbance. Figure 11 As shown. Then, the protein sample was analyzed in A... 562 The absorbance value at the absorbance point (1.129) yielded a protein concentration of 0.834 mg / mL. Sequencing revealed the amino acid sequence of the protein as shown in SEQ ID NO.2.
[0104] Example 3: Evaluation of the immunoprotective effect of recombinant protein vaccines containing Mycoplasma gallisepticum and Mycoplasma synoviae multi-epitope.
[0105] 1. Chicken immunization program and antigen emulsification
[0106] Thirty-two one-day-old SPF chicks were randomly divided into four groups of eight each: a blank control group (Control), an adjuvant control group (Adjuavnt), an rMGMS group, and a commercially available combined attenuated vaccine group (MG-F36+MS-H). The commercially available combined vaccine groups received MG-F36 strain (Zhaofenghua Biotechnology Co., Ltd.) and MS-H strain (Australian Bioresources Co., Ltd.), respectively, and were immunized according to the instructions. The remaining groups received three intramuscular immunizations as shown in Table 6. For each immunization, MONTANIDE ISA206 VG adjuvant was used to prepare the immunogen. An equal volume (1:1) of ISA206 VG adjuvant and rMGMS protein solution were mixed and emulsified in a homogenizer until thoroughly mixed. After emulsification, the mixture was centrifuged at 3000 rpm for 15 minutes; successful emulsification was indicated by the absence of stratification.
[0107] Table 6. Chick Grouping and Immunization Program
[0108]
[0109] 2. Immunogen safety assessment
[0110] Chicks in each group were immunized three times according to the immunization schedule shown in Table 6. The commercially available combination vaccine group was immunized according to the instructions. During the immunization process, the weight and living conditions (feed intake, feces, feathers, and mental state) of all chickens were monitored and recorded. After immunization, the weight changes of all groups were statistically analyzed to assess the safety of the multiepitope vaccine rMGMS. The results are shown below. Figure 12 As shown in the figure. The results showed that no adverse reactions occurred in any of the immunized chicken groups, and their feed intake, feces, feathers, and mental state were all normal. Moreover, there was no significant difference in weight change compared with the blank control group, indicating that both the rMGMS vaccine and the commercial vaccine have good safety.
[0111] 3. Monitoring of specific IgY antibody levels during immunization
[0112] The levels of specific IgY antibodies in collected chicken serum were determined using ELISA at 14, 21, and 28 days of gestation. Purified rMGMS protein was used as a coating material and coated overnight at a concentration of 1 μg / mL, 100 μL per well. The wells were blocked with 5% skim milk. Subsequently, the serum from each group was diluted 1:100 and incubated at 37°C for 2 h. Then, HRP-rabbit anti-chicken IgY antibody was used for incubation at 37°C for 1.5 h. Finally, the reaction was carried out using TMB chromogenic buffer at room temperature in the dark for 15 min, and the reaction was terminated using ELISA stop solution. The OD value was measured at 450 nm. The results are shown below. Figure 13As shown in the figure. The results showed that, starting from one week after the second immunization (21 days), the level of IgY antibody in the serum of chickens in the rMGMS group was significantly higher than that in the control group, and continued to rise until 28 days.
[0113] 4. Measurement of IFN-γ and IL-4 cytokine levels
[0114] One week after the chickens received their third vaccination, blood was collected from each group of chickens via cardiac output, and serum was separated. The levels of IFN-γ and IL-4 cytokines in the serum of each group of chickens were measured using a chicken interferon-γ and interleukin-4 enzyme-linked immunosorbent assay kit. The specific procedures were performed according to the instructions. The results are as follows: Figure 14 As shown in the figure. The results showed that the levels of IFN-γ and IL-4 in the serum of chickens in the rMGMS group were significantly increased after the third immunization.
[0115] 5. Virus challenge protection experiment in chickens
[0116] One week after the third immunization, chickens in the control group, rMGMS group, and commercial vaccine group (excluding the adjuvant group) were infected. Eight SPF chicks of the same age were selected as a challenge control. The air sacs and footpads of the chickens were challenged with the MS standard strain (CVCC2960), while the air sacs, nasal cavity, and eyes were infected with the MG standard strain (CVCC352). The infection dose for both MG and MS was 2 × 10⁻⁶. 8 CCU / animal. Continuous observation for 14 days after 3 days of continuous virus challenge.
[0117] 6. Calculation of air sac injury score and air sac protection rate in chickens
[0118] Fourteen days after challenge with MG and MS, chickens in each group underwent necropsy to observe and record the air sac lesions, taking photographs and assigning scores. The air sac lesion scoring was based on the standards of the *Veterinary Pharmacopoeia of the People's Republic of China (2020 Edition)*, classifying the severity of air sac lesions into four levels: 0 points: normal, clean, transparent, and thin air sacs; 1 point: slightly thickened and mildly cloudy air sacs with a few gray or yellow exudate spots; 2 points: visible gray and yellow exudate in some air sac areas, accompanied by moderate air sac turbidity; 3 points: large areas of air sacs covered with yellow, cheesy exudate; 4 points: the entire air sac covered with yellow, cheesy exudate, thickened resembling typical milky white plastic sheeting. Simultaneously, the air sac protection rate was calculated using the following formula: Average air sac protection rate (%) = (Average air sac lesion score in the challenged control group - Average air sac lesion score in the immunized group) / Average air sac lesion score in the challenged control group × 100%. Results are as follows... Figure 15As shown in the figure. The results showed that the average air sac damage score of chickens in the challenge control group was 3.00, while the average air sac damage scores of chickens in the rMGMS group and the commercial attenuated vaccine group were 0.83 and 0.67, respectively, which could provide 72.33% and 77.67% air sac protection for infected chickens, respectively.
[0119] 7. Detection of DNA copy number of MG in pharynx and MS in footpads of chickens
[0120] First, using MS (CVCC2960) and MG (CVCC352) strains as templates, their 16S rRNA gene fragments were amplified by PCR. The primer sequences were: MG (F:GAGCTAATCTGTAAAGTTGGTC, SEQ ID NO.5; R:GCTTCCTTGCGGTTAGCAAC, SEQ ID NO.6) and MS (F:GAGAAGCAAAATAGTGATATCA, SEQ ID NO.7; R:CAGTCGTCTCCGAAGTTAACAA, SEQ ID NO.8). After product recovery, ligation was performed using the Adley zero-background pTOPO-TA / Blunt universal cloning kit. The ligation product was then transformed into DH5α competent cells, following the manufacturer's instructions. After transformation, suspected single colonies were selected, expanded, and sequenced for identification. The successfully identified single colonies were then expanded again for plasmid extraction, yielding pTOPO-MG and pTOPO-MS plasmids.
[0121] pTOPO-MG and pTOPO-MS were serially diluted 10-fold to serve as standard plasmid samples, and their corresponding Cq values were measured. These 10 concentration gradient plasmid solutions were used as templates for real-time quantitative PCR amplification, with three replicates for each concentration. The reaction conditions for MG were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 sec, 60℃ annealing for 30 sec, and 72℃ extension for 20 sec, for 39 cycles; the reaction conditions for MS were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, and 72℃ extension for 1 min, for 39 cycles. Subsequently, standard curves for pTOPO-MG and pTOPO-MS were plotted based on the obtained Cq values and the calculated gene copy number of the standard plasmid samples. The results are shown below. Figure 16 As shown. Subsequently, standard curves for pTOPO-MG and pTOPO-MS were plotted based on the obtained Cq values and the calculated gene copy numbers of the standard plasmid samples. The formula for calculating the gene copy number is as follows: Copy number (copies / μL) = [6.02 × 10⁻⁶]. 23 [×cDNA(g / mL) / MW]×10-3 Molecular mass (MW) = (plasmid vector length + insert fragment length) × 660 dalton / bp.
[0122] Fourteen days after challenge, chickens were necropsed, and throat swabs and footpad tissues were collected for MG and MSDNA copy number detection. Bacterial genomic DNA extraction kits were used to extract DNA from the samples. Absolute quantitative PCR was used to quantify the MG DNA copy number in the throat swabs and the MSDNA copy number in the footpad samples. Total DNA extracted from the samples was measured using a micro spectrophotometer and uniformly diluted to 20 ng / μL for subsequent quantitative PCR detection, with three replicates per sample. After the reaction, the Cq value of each sample was read to determine whether it was within the detection limit of the corresponding standard curve, and the corresponding MG / MSDNA copy number was calculated based on the sample's Cq value. The results are shown below. Figure 17 As shown in the figure. The results showed that the rMGMS vaccine could significantly inhibit the DNA copy number of MG and MS in the pharynx and footpads, respectively.
[0123] 8. Measurement of changes in tracheal mucosal thickness in chickens
[0124] Fourteen days after viral challenge, chickens in each group underwent necropsy. During necropsy, the upper, middle, and lower trachea sections were collected and fixed in 4% paraformaldehyde, then sent to a biotechnology company for HE staining. To determine the average thickness of the upper, middle, and lower tracheal mucosa in each group, the prepared tracheal sections were observed and photographed under a microscope. ImageJ software was used to calibrate the scale and measure the tracheal mucosal thickness of each group's sections. The results are as follows: Figure 18 As shown in the figure. The results showed that the thickness of the upper, middle and lower tracheal mucosa in the rMGMS group was significantly lower than that in the challenge control group, achieving a tracheal mucosal protection effect comparable to that of the commercial attenuated live vaccine group.
[0125] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A Mycoplasma gallisepticum and Mycoplasma synoviae polyepitope recombinant protein, characterized in that, The amino acid sequence of the recombinant protein is shown as SEQ ID NO.
2.
2. A gene encoding the polyepitope recombinant protein of claim 1, characterized by, The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
3. A recombinant vector expressing Mycoplasma gallisepticum and Mycoplasma synoviae polyepitope recombinant protein, characterized by, The recombinant vector comprises the gene of claim 2.
4. A recombinant bacteria Escherichia coli rMGMS expressing a mycoplasma gallisepticum and synovial bursa mycoplasma polyepitope recombinant protein, characterized by, The recombinant Escherichia coli rMGMS is preserved in China Center for Type Culture Collection, Wuhan, Wuhan University, on April 3, 2025, with the preservation number of CCTCC NO: M2025703.
5. A method for preparing the Mycoplasma gallisepticum and synovial bursa mycoplasma polyepitope recombinant protein according to claim 1, characterized by, The steps comprise connecting the sequence shown as SEQ ID NO. 1 to an expression vector to construct a recombinant vector, then transforming into a host bacterium, inducing expression, purifying, and obtaining the Mycoplasma gallisepticum and synovial bursa Mycoplasma multi-epitope recombinant protein.
6. The production method according to claim 5, wherein The steps further comprise inducing expression of the recombinant bacterium Escherichia coli rMGMS of claim 4 by IPTG and purifying to obtain the Mycoplasma gallisepticum and synovial bursa Mycoplasma multi-epitope recombinant protein.
7. Use of the Mycoplasma gallisepticum and synovial bursa Mycoplasma multi-epitope recombinant protein of claim 1 or the Mycoplasma gallisepticum and synovial bursa Mycoplasma multi-epitope recombinant protein prepared by the preparation method of claim 5 or 6 in the preparation of a Mycoplasma gallisepticum and synovial bursa Mycoplasma double multi-epitope vaccine.
8. A Mycoplasma gallisepticum and Mycoplasma synoviae bivalent polyepitope vaccine, characterized in that, The double multi-epitope vaccine is prepared from the Mycoplasma gallisepticum and synovial bursa Mycoplasma multi-epitope recombinant protein of claim 1 and a vaccine adjuvant.