Molecular marker and identification method for identifying genuine and non-genuine astragalus membranaceus

By designing a SNP-based molecular marker-based method for Astragalus identification, and utilizing the polymorphism at position 131 bp of exon 5 of the Astragalus genome Am02G035490, the accuracy and efficiency issues of Astragalus origin identification were resolved, achieving precise traceability of Astragalus origin and stability of medicinal material quality.

CN119753200BActive Publication Date: 2026-06-23CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-12-04
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for accurately and quickly identifying Astragalus membranaceus from authentic and non-authentic producing areas. Traditional methods rely on experience, and molecular marker technology suffers from poor repeatability and insufficient accuracy, leading to unstable quality of medicinal materials and frequent counterfeiting.

Method used

Using a SNP-based molecular marker approach, primers were designed based on the polymorphism (A/T) at 131 bp of exon 5 of Astragalus membranaceus genome Am02G035490. The origin of Astragalus membranaceus was identified by PCR amplification and Sanger sequencing, providing a simple and rapid identification method.

Benefits of technology

It enables precise traceability of the origin of Astragalus membranaceus, which is fast, simple and safe. It can identify the origin of Astragalus membranaceus in a small number of leaf samples, without the need for high-cost equipment. It is suitable for dried medicinal materials and ensures the stability of the quality of medicinal materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The application provides a molecular marker and identification method for identifying genuine producing areas and non-genuine producing areas of Astragalus membranaceus. The molecular marker contains a nucleotide sequence with a polymorphism of A / T at the 131st base of the sequence shown in SEQ ID NO: 1 of the 5th exon of Am02G035490 of the Astragalus membranaceus genome. The application also provides a method for identifying the genuine producing areas of Astragalus membranaceus by using the SNP molecular marker, which provides technical support for the precise traceability, stable quality and healthy and orderly development of the Astragalus membranaceus industry of the genuine producing areas of Astragalus membranaceus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically, to a molecular marker and identification method for identifying Astragalus membranaceus from authentic producing areas and non-authentic producing areas. Background Technology

[0002] Astragalus Astragali Radix Astragalus membranaceus is a traditional Chinese medicinal herb and a perennial herb belonging to the genus Astragalus of the legume family. Astragalus membranaceus var. mongholicus Astragalus membranaceus A . membranaceus Astragalus root. Its medicinal history is long, first recorded in the "Fifty-Two Prescriptions," dating back over two thousand years. It is renowned as the "leader of tonics," the "holy medicine for replenishing qi," and "nine out of ten medicines contain astragalus." With the increasing market demand for astragalus, wild-sourced astragalus can no longer meet the demand. Since the 1950s, my country has begun large-scale artificial cultivation of astragalus. During the artificial cultivation process, there has been a phenomenon of indiscriminate introduction of varieties, often involving the cross-provincial transfer of seeds and seedlings, resulting in mixed germplasm and inconsistent quality of medicinal materials. In addition, the counterfeiting and substitution of inferior materials have also frequently occurred. Whether astragalus originates from a traditional producing area directly affects its use value and economic value.

[0003] However, due to the relatively complex historical changes in the varieties and authentic producing areas of Astragalus membranaceus, coupled with the mixed seed sources caused by disorderly introduction over the years, it is quite difficult to identify the producing area of ​​Astragalus membranaceus.

[0004] Currently, the identification techniques for Astragalus membranaceus origin still mainly rely on the traditional method of "identifying the appearance and quality". Molecular marker technologies such as AFLP, RAPD, ISSR, SCoT, SCAR, and DNA barcoding are also frequently used for the germplasm identification of authentic medicinal materials.

[0005] Traditional "symptom identification and quality assessment" requires a high level of experience from the identification personnel and is subject to a certain degree of subjectivity. Molecular marker technologies such as AFLP, RAPD, ISSR, SCoT, SCAR, and DNA barcoding suffer from poor repeatability, insufficient accuracy, and low efficiency. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker and identification method for identifying Astragalus membranaceus from authentic producing areas and non-authentic producing areas.

[0007] To achieve the objectives of this invention, in a first aspect, this invention provides a molecular marker for identifying Astragalus membranaceus from authentic producing areas and non-authentic producing areas, the molecular marker containing a nucleotide sequence with a polymorphism of A / T at the 131 bp of exon 5 of the Astragalus membranaceus genome Am02G035490 as shown in SEQ ID NO:1 (n is a or t).

[0008] In this invention, the reference genome is the first edition of the Astragalus membranaceus genome (http: / / www.gpgenome.com / species / 109).

[0009] Furthermore, if the nucleotide at position 131 bp is A, the corresponding Astragalus membranaceus originates from the traditional producing area; if the nucleotide at position 131 bp is T, the corresponding Astragalus membranaceus originates from a non-traditional producing area.

[0010] In a second aspect, the present invention provides a pair of primers for amplifying the molecular marker, including an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.

[0011] Thirdly, the present invention provides detection reagents or kits containing the primers.

[0012] Fourthly, the present invention provides a method for identifying Astragalus membranaceus from authentic producing areas and non-authentic producing areas, comprising: using the DNA of the Astragalus membranaceus sample to be tested as a template, performing PCR amplification using primers as shown in SEQ ID NO:2-3 or detection reagents or kits containing said primers, and determining the origin of the Astragalus membranaceus sample to be tested based on the amplification results.

[0013] Preferably, the PCR amplification system includes: 1 μL DNA template, 10 μL 2×M5 HiPer plus Taq HiFiPCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O added to 20 μL.

[0014] Preferably, the reaction program used for PCR amplification is as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 40 s, 55 °C annealing for 20 s, 72 °C extension for 2 min, for a total of 35 cycles; 72 °C extension for 10 min.

[0015] Furthermore, the source of the Astragalus membranaceus sample to be tested can be determined based on the amplification results: analysis of the polymorphic sites contained in the molecular marker in the amplification product shows that if the nucleotide at the 131 bp position of the amplification product is A, the Astragalus membranaceus sample to be tested originates from the authentic producing area; if the nucleotide at the 131 bp position of the amplification product is T, the Astragalus membranaceus sample to be tested originates from a non-authentic producing area.

[0016] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0017] (I) This invention provides a method for identifying the authentic producing areas of Astragalus membranaceus using SNP molecular markers. This method can be used for identification with only a small amount of leaf samples (100mg) without damaging the plant. Furthermore, this method is not limited to live samples and can also be applied to dried Astragalus membranaceus roots available in the market. This provides technical support for the accurate traceability of authentic Astragalus membranaceus producing areas, quality stability, and the healthy and orderly development of the Astragalus membranaceus industry.

[0018] (ii) There are a large number of DNA sequence variations in the genome. Based on this, the third-generation molecular marker SNP developed has the characteristics of large number, wide distribution, stable variation, biallelic variation and easy automated analysis compared with other molecular markers.

[0019] (III) This method only requires a pair of primers for PCR amplification to identify whether it is Astragalus membranaceus from the authentic producing area. Ordinary PCR reagents can meet the amplification requirements, and expensive high-fidelity enzymes are not needed. Moreover, it uses a simple and rapid first-generation sequencing technology—Sanger sequencing—for detection, and the detection results are clear and easy to read. The entire identification process is fast, simple, and safer for the environment and human body. Attached Figure Description

[0020] Figure 1 This is a preferred embodiment of the present invention, showing the sequence alignment of Astragalus membranaceus samples from authentic producing areas and non-authentic producing areas in the SEQ ID NO:1 interval during resequencing; wherein: NoDaoDi is the sequence of all non-authentic producing area samples in the SEQ ID NO:1 interval, and DaoDi is the sequence of all authentic producing area samples in the SEQ ID NO:1 interval.

[0021] Figure 2 The results of first-generation Sanger sequencing of samples from Astragalus membranaceus grown in authentic and non-authentic producing areas in a preferred embodiment of the present invention after amplification with the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3. Detailed Implementation

[0022] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0023] The traditional producing areas of Astragalus membranaceus mentioned in the following examples include Hunyuan County, Ying County, Fanshi County, and Wutai County in Shanxi Province, and Guyang County, Wuchuan County, Urad Front Banner, Fengzhen City, and Liangcheng County in Inner Mongolia Autonomous Region. Non-traditional producing areas of Astragalus membranaceus include Tahe County, Huma County, and Songling District in Heilongjiang Province, and Dangchang County, Qingshui County, and Zhang County in Gansu Province (as shown in Tables 1 and 2).

[0024] Table 1. Traditional and Non-Traditional Astragalus Producing Areas

[0025]

[0026] Table 2. Traditional and Non-Traditional Astragalus Producing Areas

[0027]

[0028] Example 1

[0029] Genome resequencing data analysis of 202 representative wild Astragalus membranaceus samples from the distribution areas of Astragalus membranaceus across China revealed an A / T base transversion in exon region Am02G035490 in both authentic and non-authentic producing areas. Primers were designed based on this SNP site. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. These primers were used for marker-assisted selection of Astragalus membranaceus germplasm from authentic producing areas.

[0030] This embodiment provides a method for identifying the authentic producing areas of Astragalus membranaceus using the SNP molecular marker located at the 131 bp site in the 5th exon region of Am02G035490 as shown in SEQ ID NO:1, with a polymorphism of A / T (n is a or t). For ease of description, this SNP molecular marker in the 5th exon region of Am02G035490 is named DD-SNP.

[0031] Furthermore, the method includes:

[0032] Genomic DNA of Astragalus membranaceus was extracted using an optimized modified CTAB method as a template. PCR amplification was performed using the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3. The PCR amplification products were then analyzed using first-generation Sanger sequencing. The type of bases at the sites identified in the Sanger sequencing results was used to determine whether the Astragalus membranaceus was from the authentic producing area: if the 131st bp of the sequence shown in SEQ ID NO:1 was A, then the Astragalus membranaceus was from the authentic producing area; if the 131st bp of the sequence shown in SEQ ID NO:1 was T, then the Astragalus membranaceus was from a non-authentic producing area. Figure 1 and Figure 2 ).

[0033] Preferably, the PCR amplification system comprises: DNA template, 1 μL; 2×M5 HiPer plus Taq HiFiPCR mix, 10 μL; 10 μM upstream and downstream primers, 1 μL each; ddH2O added to 20 μL.

[0034] Preferably, the PCR amplification reaction conditions are: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 40 s, 55 °C annealing for 20 s, 72 °C extension for 2 min, for a total of 35 cycles; 72 °C extension for 10 min.

[0035] The primer sequences are as follows (5'-3'):

[0036] Upstream primer: TCACGCTTTAGTCGCTTTCAC (SEQ ID NO:2)

[0037] Downstream primer: CAACAACGAAGGCTGAGAGTG (SEQ ID NO:3)

[0038] The PCR products were subjected to Sanger sequencing. The base at the 131 bp site of the Sanger sequencing results can be used to directly determine whether the Astragalus germplasm originates from the authentic producing area: if the base at the 131 bp site of the Sanger sequencing results is A, then the Astragalus to be identified originates from the authentic producing area; if the base at the 131 bp site is T, then the Astragalus to be identified originates from a non-authentic producing area.

[0039] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for identifying Astragalus membranaceus from authentic producing areas and non-authentic producing areas, characterized in that, include: Using the DNA of the Astragalus membranaceus sample to be tested as a template, PCR amplification was performed using primers or a kit, and the source of the Astragalus membranaceus sample to be tested was determined based on the amplification results. The primers include an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3; The kit contains the primers; The source of the Astragalus membranaceus sample to be tested was determined based on the amplification results, including: analysis of the polymorphic sites contained in the molecular markers in the amplification product, the nucleotide at the 131 bp position of the amplification product was A, and the Astragalus membranaceus sample to be tested originated from the authentic producing area; The nucleotide at position 131 bp of the amplification product is T, indicating that the Astragalus membranaceus being tested originated from a non-traditional producing area. The molecular marker contains a nucleotide sequence with a polymorphism of A / T at position 131 bp as shown in SEQ ID NO:

1.

2. The method according to claim 1, characterized in that, The PCR amplification system included: 1 μL DNA template, 10 μL 2×M5 HiPer plus Taq HiFi PCR mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O added to a final volume of 20 μL.

3. The method according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 40 s, 55 ℃ annealing for 20 s, 72 ℃ extension for 2 min, for a total of 35 cycles; 72 ℃ extension for 10 min.