SERS (Surface Enhanced Raman Scattering) biosensor based on magnetic metal organic framework material and method for detecting staphylococcus aureus

Abstract

The invention belongs to the field of detection of food-borne pathogenic bacteria, and relates to an SERS (Surface Enhanced Raman Scattering) biosensor based on a magnetic metal organic framework material and a method for detecting staphylococcus aureus. The SERS biosensor comprises a capture probe and a signal probe; the capture probe is Fe3O4 (at) MOF-5 modified by an antibody, and the antibody is a monoclonal antibody for resisting staphylococcus aureus; the signal probe is AuNPs (Authiophenol) modified by an HS (Hydroxyethyl Sulfonate)-aptamer and P-aminothiophenol; the aptamer is an aptamer nucleic acid sequence for specifically recognizing staphylococcus aureus. The capture probe constructed by the invention can realize enrichment and separation of target pollutants under the action of an external magnetic field, and then sensitive surface enhanced Raman scattering detection is realized through a signal probe. The whole detection process is rapid, efficient, sensitive and high in specificity. According to the sensor and the method disclosed by the invention, the staphylococcus aureus is successfully detected in an actual sample.

Description

Technical Field

[0001] The present invention belongs to the field of foodborne pathogenic bacteria detection, and in particular, relates to a SERS biosensor based on a magnetic metal organic framework material, and a method for detecting Staphylococcus aureus by using surface enhanced Raman scattering. Background Art

[0002] Food safety incidents caused by foodborne pathogenic bacteria have become one of the major public health issues in the world. Staphylococcus aureus, as the most common Gram-positive pathogen in food contamination, can cause a variety of infectious diseases, including gastrointestinal infections, necrotizing pneumonia, osteomyelitis, endocarditis, sepsis, and even toxic shock syndrome. Although the current national standards stipulate that Staphylococcus aureus can be detected in limited quantities in food, due to the widespread spread of antibiotic resistance, limited detection of Staphylococcus aureus still poses a potential hazard to food safety that cannot be ignored. Therefore, rapid and sensitive detection of Staphylococcus aureus in food is of great significance for maintaining food safety and the health of consumers.

[0003] At present, the main detection methods for foodborne pathogens in food include conventional culture methods, molecular biology techniques, fluorescence, colorimetry, and electrochemiluminescence detection. However, these detection methods require cumbersome operation steps, expensive instruments, and long pre-treatment time, which limits their application in the field of rapid food safety detection. Compared with other detection technologies, Raman spectroscopy has outstanding advantages in non-destructive detection and no sample pre-treatment. With the development of surface enhanced Raman scattering (SERS) technology, the signal intensity of Raman spectroscopy has been greatly improved, making it have broad application prospects in the field of food safety detection. In addition, due to the complexity and diversity of food matrices, the effective separation and enrichment of target bacteria from redundant samples is the key link to whether they can be detected and detected accurately. Magnetic nanoparticles (MNPs) represented by Fe3O4 play an important role in this. However, due to the high surface energy, thermodynamic instability, and easy aggregation of Fe3O4, it is subject to certain limitations in practical applications. The adjustable high porosity, large specific surface area, and uniform pore size structure of metal organic framework materials (MOFs) give them good adsorption performance and mechanical stability. Based on this, by combining the magnetic separation properties of MNPs with the adsorption properties of MOFs to prepare a composite material of MNPs and MOFs (MMOFs), the enrichment and separation of target pollutants in food samples can be achieved under the action of an external magnetic field. Summary of the invention

[0004] In order to solve the technical problems of long pretreatment time, cumbersome operation and inconvenience for rapid detection of conventional methods for detecting Staphylococcus aureus in food, the present invention aims to provide a rapid detection method and corresponding materials with simple operation, convenient detection and no need for complicated pretreatment, so as to realize efficient enrichment and specific detection of Staphylococcus aureus in food.

[0005] The purpose of the present invention is to provide a preparation method and optimization method of a magnetic MOF material that can be used for efficient enrichment of Staphylococcus aureus in food samples, and at the same time provide a pretreatment material and a detection method for establishing SERS sensing detection of Staphylococcus aureus in food.

[0006] In order to achieve the above object, the present invention provides a SERS biosensor based on a magnetic metal organic framework material, comprising a capture probe and a signal probe;

[0007] The capture probe is antibody-modified Fe3O4@MOF-5, and the antibody is a monoclonal antibody against Staphylococcus aureus;

[0008] The signal probe is AuNPs modified by HS-aptamer and P-aminothiophenol; the aptamer is an aptamer nucleic acid sequence that specifically recognizes Staphylococcus aureus.

[0009] The construction strategy of the system of the present invention is as follows Figure 1 As shown, A and B are the preparation processes of the capture probe and signal probe SERS tags, respectively, and C is the schematic diagram of the detection of S. aureus using the capture probe and signal probe. When S. aureus is present in the sample to be tested, the signal probe forms a sandwich structure with S. aureus and the capture probe, showing a strong Raman signal; in the absence of S. aureus, the capture probe cannot capture S. aureus, the sandwich structure construction fails, and the Raman signal intensity is almost 0. In short, when the target is present, the capture probe selectively enriches S. aureus, thereby generating a "SERS on" signal. In contrast, in the absence of S. aureus in the system, a "SERS off" signal is observed.

[0010] Based on the above mechanism, suitable anti-Staphylococcus aureus monoclonal antibodies and aptamer sequences can be selected. According to a preferred embodiment of the present invention, the anti-Staphylococcus aureus monoclonal antibody is a β-O-linked N-acetylglucosamine wall teichoic acid antibody; the sequence of the HS-aptamer is: 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCG CTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTA A-3' (SEQ ID NO: 1).

[0011] According to a preferred embodiment of the present invention, Fe3O4@MOF-5 (i.e., Anti-WTA-Fe3O4@MOF-5) modified with β-O-linked N-acetylglucosamine wall teichoic acid antibody (anti-WTA) is used as a capture probe, and a SERS tag (i.e., PATP-aptamer-AuNPs) surface-modified with a nucleic acid aptamer and p-aminothiophenol (PATP) is used as a signal probe to establish an "Anti-WTA-Staphylococcus aureus-aptamer" sandwich structure to achieve rapid and sensitive detection of Staphylococcus aureus. In the capture probe, the carboxyl group of Anti-WTA reacts with the amino group of Fe3O4@MOF-5 to undergo an amide reaction.

[0012] The present invention optimizes the weight ratio of Fe3O4 to MOF-5 in Fe3O4@MOF-5, and when the weight ratio of the two is controlled within the range of 1:1.5 to 2, the best Staphylococcus aureus enrichment effect is achieved.

[0013] According to a preferred embodiment of the present invention, the method for preparing the capture probe comprises the following steps:

[0014] (1) Synthesize MOF-5 by hydrothermal synthesis;

[0015] (2) reacting the MOF-5 obtained in step (1) with a Fe3O4 precursor to obtain Fe3O4@MOF-5;

[0016] (3) Activate the carboxyl functional groups on the surface of Fe3O4@MOF-5, and then add Anti-WTA solution to prepare Anti-WTA-Fe3O4@MOF-5.

[0017] Wherein, in step (1), the step of synthesizing MOF-5 by hydrothermal synthesis may include: dissolving zinc nitrate hexahydrate and terephthalic acid in a solvent, reacting in a high-pressure reactor, and drying the obtained product after the reaction to obtain MOF-5.

[0018] According to a preferred embodiment of the present invention, step (2) comprises:

[0019] The MOF-5 powder was dissolved in water and ultrasonicated to make it fully dissolved, and Fe3O4 precursor and ammonia solution were added, stirred for reaction, washed and dried to obtain Fe3O4@MOF-5;

[0020] The Fe3O4 precursor is preferably FeCl3·6H2O and / or FeCl2·4H2O.

[0021] According to a preferred embodiment of the present invention, the method for preparing the signal probe comprises the following steps:

[0022] (1) Mixing AuNPs and HS-aptamer to obtain HS-aptamer-AuNPs;

[0023] (2) HS-aptamer-AuNPs were mixed with P-aminothiophenol to obtain the signal probe PATP-aptamer-AuNPs.

[0024] In a preferred embodiment of the present invention, Staphylococcus aureus is efficiently enriched and magnetically separated based on Anti-WTA-Fe3O4@MOF-5, and SERS sensing is combined to achieve rapid detection of Staphylococcus aureus. This sensing strategy uses anti-WTA as a specific recognition probe. Once Staphylococcus aureus is captured by Anti-WTA-Fe3O4@MOF-5, the Staphylococcus aureus-Anti-WTA-Fe3O4@MOF-5 complex can be combined with the HS-aptamer functionalized SERS tag to form an "Anti-WTA-Staphylococcus aureus-aptamer-AuNPs" sandwich structure, generating a Raman signal enhancement "hotspot".

[0025] A second aspect of the present invention provides a method for detecting Staphylococcus aureus using surface enhanced Raman scattering, using the above-mentioned biosensor, comprising the following steps:

[0026] (1) mixing and incubating a sample containing Staphylococcus aureus with a capture probe, adding an external magnetic field for magnetic separation, discarding the supernatant, and resuspending the solid component;

[0027] (2) adding a signal probe to the product obtained in step (1) and detecting the 1078 cm -1 The SERS peak intensity at is substituted into the standard curve to obtain the concentration of Staphylococcus aureus in the sample to be tested.

[0028] According to a preferred embodiment of the present invention, the method for preparing the standard curve comprises:

[0029] (1) A series of solutions of Staphylococcus aureus with known concentrations are mixed and incubated with capture probes, an external magnetic field is added for magnetic separation, the supernatant is discarded, and the solid component is resuspended;

[0030] (2) adding a signal probe to the product obtained in step (1) and detecting the 1078 cm -1 The SERS peak intensity at 1078 cm -1 A standard curve was drawn based on the SERS peak intensity at 100 nm and the concentration of bacteria.

[0031] The present invention optimizes multiple conditions in the detection system, and determines the preferred conditions as follows: in the detection system, the concentration of the capture probe measured in Fe3O4@MOF-5 is 35-50 μg / mL, the system pH value is 7.2-7.8, the incubation time of the capture probe and the sample to be tested is 25-35 min, the incubation temperature is 35-40°C, and the magnetic separation time is 2-4 min; in the detection system, the concentration of the signal probe measured in HS-aptamer is 40-55 nmol / L.

[0032] Under the optimal experimental conditions (Anti-WTA concentration of 80 μg / mL, mass ratio of Fe3O4 to MOF-5 of 3:5, Fe3O4@MOF-5 concentration of 40 μg / mL, pH value of 7.5, incubation temperature of 37°C, incubation time of 30 min, and magnetic separation time of 3 min), the enrichment efficiency of Staphylococcus aureus by the capture probe can reach as high as 94.7%.

[0033] In the signal probe, the aptamer was modified with sulfhydryl (HS-) on the surface of AuNPs, and PATP was also connected to the surface of AuNPs through sulfhydryl. The concentration of HS-aptamer was further optimized. When its concentration was 50nm / L, the Raman signal was the strongest. Taking the concentration of S. aureus as the logarithm, the Raman signal at 1078cm -1 The Raman peak at the center can be used to quantitatively detect Staphylococcus aureus by the Raman signal intensity on the standard curve.

[0034] According to the method of the present invention, the sample to be tested is a food or a biological sample, and the food includes both liquid food such as milk and coconut water and solid food such as meat.

[0035] According to the IUPAC recommended criteria, the detection limit was calculated as 3Sb / m (where Sb and m represent the standard deviation of the blank signal and the slope of the calibration graph, respectively). The detection method established in the present invention has good biosensor performance, and its linear range is 42-4.23×10 5 CFU / mL, and the detection limit is as low as 6 CFU / mL. This method has high specificity and has been successfully applied to the detection of Staphylococcus aureus in actual samples such as skim milk, fresh pork and coconut milk, and the entire detection process can be completed within 50 minutes. At the same time, this dual-probe sensing strategy provides a new idea for the detection of foodborne pathogens in food safety. In addition, by replacing the recognition element, this method can be applied to the detection of other food safety hazards, and it has good application potential in public health safety detection and evaluation.

[0036] The technical effects of the present invention are:

[0037] (1) By preparing MMOFs materials, the magnetic separation performance of Fe3O4 and the adsorption performance of MOFs are combined, and the target pollutants in food samples can be enriched and separated under the action of an external magnetic field. The magnetic MOF material can achieve an enrichment efficiency of 94.7% for Staphylococcus aureus under the optimal magnetic separation conditions. Combined with the SERS signal of the signal probe, the entire SERS sensing detection process can be completed within 50 minutes. The concentration range of Staphylococcus aureus detection is 42-4.23×10 5 CFU / mL, and the minimum detection limit is as low as 6 CFU / mL.

[0038] (2) The specificity of the constructed detection method was verified by adding bacteria of different species, including Gram-positive pathogens such as Staphylococcus aureus, Listeria monocytogenes, and Streptococcus mutans, and Gram-negative pathogens such as Escherichia coli, Salmonella, and Pseudomonas aeruginosa. The results showed that the Raman intensity of the sample containing Staphylococcus aureus was higher, while the Raman signal of the sample without Staphylococcus aureus was very weak. At the same time, the Raman intensity of single interfering bacteria and mixed interfering bacteria was further tested, and the results showed that the interfering bacteria had no significant effect on the Raman signal, indicating that the method has ideal specificity.

[0039] (3) The storage stability of Fe3O4@MOF-5 was further identified by continuously detecting the changes in the enrichment efficiency of S. aureus by Fe3O4@MOF-5 within 30 days. The results showed that its enrichment efficiency only decreased by 5.7% on the 30th day, indicating that Fe3O4@MOF-5 has high stability. At the same time, the reproducibility of the constructed method was verified by measuring the Raman signal intensity of parallel samples. The results showed that there was no obvious difference in the Raman signal between the 10 parallel samples, indicating that the constructed detection method has good reproducibility. In addition, the "S. aureus-Anti-WTA-Fe3O4@MOF-5" complex after enrichment of S. aureus was immersed in 0.2 M NaOH for 2 min and then treated with 0.1 M Fe3O4@MOF-5 was gently rinsed with PBS (pH=7.4), and then anti-WTA was reconnected to Fe3O4@MOF-5 to evaluate its regeneration stability. The process was repeated 5 times. The results showed that there was no significant difference between the five repeated results and the original results, indicating that Fe3O4@MOF-5 has good regeneration ability.

[0040] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The above and other objects, features and advantages of the present invention will become more apparent through a more detailed description of exemplary embodiments of the present invention with reference to the accompanying drawings.

[0042] Figure 1Diagram of the construction strategy of capture probe and signal probe and their use in SERS sensing detection of Staphylococcus aureus: (A) Schematic diagram of the synthesis of capture probe Anti-WTA-Fe3O4@MOF-5; (B) Schematic diagram of the synthesis of signal probe SERS tag; (C) Schematic diagram of the enrichment and SERS sensing detection of Staphylococcus aureus based on Anti-WTA-Fe3O4@MOF-5.

[0043] Figure 2 The characterization results of Fe3O4@MOF-5 are shown: (A) SEM image of MOF-5; (B) TEM image of MOF-5; (C) SEM image of Fe3O4@MOF-5; (D) TEM image of Fe3O4@MOF-5; (E) HAADF-STEM mapping analysis of Fe3O4@MOF-5; (F) XRD spectrum; (G) FTIR spectrum; (H) hysteresis loops of Fe3O4@MOF-5, Fe3O4 and MOF-5.

[0044] Figure 3 The comparison of the capture efficiency of Staphylococcus aureus by Anti-WTA-Fe3O4@MOF-5 and CHO-aptamer-Fe3O4@MOF-5 is shown: (A) Zeta potential of Staphylococcus aureus enriched by Anti-WTA-Fe3O4@MOF-5; (B) SEM image of Staphylococcus aureus captured by Anti-WTA-Fe3O4@MOF-5; (C) Effect of Anti-WTA-Fe3O4@MOF-5 concentration on the enrichment efficiency of Staphylococcus aureus; (D) Effect of CHO-aptamer concentration on its UV-vis value at 267nm under the same concentration of Fe3O4@MOF-5; (E) Enrichment efficiency of Staphylococcus aureus by CHO-aptamer-Fe3O4@MOF-5 and Anti-WTA-Fe3O4@MOF-5; (F) Effect of Anti-WTA-Fe3O4@MOF-5 and Anti-WTA-Fe3O4 concentration on the enrichment efficiency of Staphylococcus aureus. All data are expressed as standard deviation ± the mean of three parallel measurements.

[0045] Figure 4 The optimization of the capture probe Anti-WTA-Fe3O4@MOF-5 on the enrichment conditions of S. aureus is shown: (A) The effect of the weight ratio of Fe3O4 to MOF-5 on the enrichment efficiency of S. aureus; (B) The effect of Fe3O4@MOF-5 concentration on the enrichment efficiency of S. aureus; (C) The effect of solution pH on the enrichment efficiency of S. aureus; (D) The effect of reaction temperature on the enrichment efficiency of S. aureus; (E) The effect of incubation time on the enrichment efficiency of S. aureus; (F) The effect of magnetic separation time on the enrichment efficiency of S. aureus. All data are expressed as standard deviation ± the average of three parallel measurements.

[0046] Figure 5 The characterization results of the signal probe SERS tag are shown: (A) SEM images of AuNPs (inset) and HS-aptamer-AuNPs; (B) Zeta potential analysis of AuNPs and HS-aptamer-AuNPs; (C) DLS analysis before and after HS-aptamer is connected to AuNPs; (D) SERS spectra of AuNPs, HS-aptamer-AuNPs, PATP, and PATP-aptamer-AuNPs; (E) UV-visible spectra of AuNPs, HS-aptamer-AuNPs, and PATP-aptamer-AuNPs; (F) CD spectra of HS-aptamer, S. aureus, and S. aureus-aptamer. All data are expressed as standard deviation ± the average of three parallel measurements.

[0047] Figure 6 The optimization results of the signal probe SERS Raman signal are shown: (A) The effect of HS-aptamer concentration on the Raman signal of the signal probe; (B) The effect of HS-aptamer concentration on the Raman signal of the signal probe at 1078 cm -1 The Raman intensity is affected.

[0048] Figure 7 The establishment of the standard curve for detecting Staphylococcus aureus based on the signal probe SERS is shown: (A) Raman signals of Staphylococcus aureus before and after binding with SERS tag and Anti-WTA-Fe3O4@MOF-5; (B) The effect of Staphylococcus aureus concentration on the signal probe SERS Raman signal; (C) The Raman signal of Staphylococcus aureus based on the signal probe 1078 cm -1 The SERS peak intensity at 400 nm was used to establish a standard curve of S. aureus concentration.

[0049] Figure 8 The feasibility verification of Anti-WTA-Fe3O4@MOF-5 and SERS detection of Staphylococcus aureus is shown: (A) Changes in the enrichment efficiency of Staphylococcus aureus by Anti-WTA-Fe3O4@MOF-5 within one month of storage; (B) Raman spectra of ten parallel samples; (C) Raman spectra of ten parallel samples at 1078 cm -1 (D) Changes in the SERS peak at the 40°C; (E) Effects of Anti-WTA-Fe3O4@MOF-5 regeneration on the Raman spectrum of Staphylococcus aureus. All data are expressed as standard deviation ± the average of three parallel measurements.

[0050] Fig. 9The specific verification of Anti-WTA-Fe3O4@MOF-5 and SERS detection of Staphylococcus aureus is shown: (A) Enrichment efficiency of Anti-WTA-Fe3O4@MOF-5 for Staphylococcus aureus and interfering bacteria and their mixed bacterial samples; (B) Raman signals of Staphylococcus aureus and five different types of interfering bacteria; (C) Raman spectra of Staphylococcus aureus mixed with interfering bacteria. All data are expressed as standard deviation ± the average of three parallel measurements.

[0051] Fig.10 The detection of Staphylococcus aureus in actual samples based on the capture probe Anti-WTA-Fe3O4@MOF-5 and the signal probe SERS is shown: (A) Raman spectrum of Staphylococcus aureus in skim milk; (B) Raman spectrum of Staphylococcus aureus in fresh pork; (C) Raman spectrum of Staphylococcus aureus in coconut milk; (D) Raman spectrum of Staphylococcus aureus at 1078 cm in skim milk, fresh pork and coconut milk -1 (E) Enrichment efficiency of S. aureus in skim milk, fresh pork and coconut milk. All data are expressed as standard deviation ± the average of three parallel measurements. DETAILED DESCRIPTION

[0052] The preferred embodiments of the present invention will be described in more detail below. Although the preferred embodiments of the present invention are described below, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein.

[0053] Example 1

[0054] Preparation of MOF-5 and Fe3O4@MOF-5

[0055] MOF-5 was synthesized by hydrothermal synthesis. First, 1.785 g zinc nitrate hexahydrate and 1.005 g terephthalic acid (TPA) were dissolved in 60 mL DMF and reacted in a 100 mL autoclave. Then, the mixture was dried in an electric heating air-cooled drying oven at 140 ° C for 24 h. The obtained mixture was naturally cooled to room temperature and washed repeatedly with DMF for 3-6 times. Finally, the obtained MOF-5 precipitate was dried in a vacuum drying oven at 60 ° C until a white solid powder was obtained. Further, in order to prepare Fe3O4@MOF-5, the ground MOF-5 powder (1 g) was dissolved in 5 mL deionized water and ultrasonically treated for 15 min to fully dissolve it. 0.486 g FeCl3·6H2O and 0.18 g FeCl2·4H2O were added to the MOF-5 solution, followed by 10 mL of ammonia solution. The mixed solution was stirred at 85°C for 45 min, and the obtained black product was washed with anhydrous ethanol for 3-6 times and dried in a vacuum oven at 60°C for 12 h to obtain Fe3O4@MOF-5.

[0056] Characterization of Fe3O4@MOF-5

[0057] Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to analyze the morphology and structure of MOF-5 and Fe3O4@MOF-5. Figure 2 Figures A and B show the SEM and TEM images of MOF-5, respectively. Both images show that MOF-5 has a layered and smooth crystal surface. Figure 2 Figures C and D show the SEM and TEM images of Fe3O4@MOF-5, where it can be observed that Fe3O4 is covered on the surface of the MOF-5 framework. By comparing the SEM images of MOF-5 and Fe3O4@MOF-5, it can be observed that the crystal structure of MOF-5 changes from smooth to more granular, indicating that Fe3O4 is successfully embedded on the surface of MOF-5. In addition, Figure 2 The presence of carbon, zinc, oxygen and iron elements in Fe3O4@MOF-5 was demonstrated by HAADF-STEM mapping analysis, among which the iron element came from Fe3O4. Figure 2 Figure 4 shows the X-ray diffraction (XRD) patterns of Fe3O4@MOF-5, Fe3O4 and MOF-5. MOF-5 has an obvious characteristic diffraction peak at 2θ=9.6°, corresponding to the lattice plane (200), indicating that the layered crystalline MOF-5 has a tetragonal structure. In the XRD pattern, the diffraction peaks at 30.34°, 35.67°, 43.31°, 53.61°, 57.31° and 62.82° correspond to the cubic structure of Fe3O4, specifically the lattice planes 220, 311, 400, 422, 511 and 440 of Fe3O4. These results indicate that although Fe3O4 is embedded in the surface of MOF-5, it does not change its crystal structure. In addition, when it is embedded in MOF-5, the peak intensity of Fe3O4 is weakened, indicating that the addition of MOF-5 during the synthesis process affects the expression of Fe3O4 signals. Figure 2 Figure G shows the Fourier transform infrared spectra (FTIR) of Fe3O4, MOF-5 and Fe3O4@MOF-5. It can be seen that the wavelengths of the absorption peaks are similar, indicating that during the combination of Fe3O4 and MOF-5, only the shape of MOF-5 changed, while the molecular structure remained unchanged. It is worth noting that the 752cm -1 The absorption peak at 1400-1700 cm -1 Two obvious infrared absorption peaks were observed in the range of 1585cm -1 The peak at 1392 cm corresponds to the asymmetric stretching vibration of COO-, while the peak at 1392 cm -1The peak at 3427 cm corresponds to the symmetric stretching vibration of COO-. These results indicate that the CO bond of the carboxyl group on terephthalic acid remains intact. -1 The broad peak observed near 585 cm-1 may be attributed to the stretching vibration of OH and the absorption of water in the sample. -1 The absorption peak at represents the stretching vibration of Fe-O-Fe in Fe3O4. Figure 2 The H shows that the hysteresis loops of Fe3O4, MOF-5 and Fe3O4@MOF-5 were measured using a vibrating sample magnetometer (VSM), and the saturation magnetization of Fe3O4, Fe3O4@MOF-5 and MOF-5 were determined to be 82.13, 63.01 and 0emu / g, respectively. The reduction in magnetization may be due to the introduction of non-magnetic MOF-5 during the preparation process. Table 1 summarizes the BET specific surface area and pore structure of the two samples. The BET specific surface area of ​​Fe3O4 is 107.02m 2 / g, while the BET specific surface area of ​​Fe3O4@MOF-5 increased significantly to 175.23 m 2 / g, the abundant nanopore surface area in Fe3O4@MOF-5 provides more binding sites for the recognition elements.

[0058] Table 1 Specific surface area and pore structure of Fe3O4 and Fe3O4@MOF-5

[0059]

[0060] Comparison of the enrichment efficiency of Anti-WTA-Fe3O4@MOF-5 and CHO-aptamer-Fe3O4@MOF-5 for Staphylococcus aureus

[0061] In order to verify the enrichment effect of Fe3O4@MOF-5 on Staphylococcus aureus, the present invention compares the enrichment efficiency of two Fe3O4@MOF-5 modified with different recognition elements: Anti-WTA-Fe3O4@MOF-5 and CHO-aptamer-Fe3O4@MOF-5 on Staphylococcus aureus.

[0062] Preparation of Anti-WTA-Fe3O4@MOF-5:

[0063] Based on the successful preparation of Fe3O4@MOF-5, 5 mg of Fe3O4@MOF-5 was weighed and dissolved in 10 mL of sterile saline, and ultrasonicated for 15 min to fully disperse it to form a stable suspension. 290 μL of EDC solution (10 mg / mL) and 325 μL of NHSS solution (10 mg / mL) were added to the suspension, and reacted on a DNA vortexer for 30-60 min to activate the carboxyl functional groups on the surface of Fe3O4@MOF-5. Then, 1 mL of the activated Fe3O4@MOF-5 suspension was placed in an ice bath, and 80 μL of Anti-WTA solution (1 mg / mL) was slowly added thereto, and stirred at 4 ° C for 12-24 h to allow the antibody to fully contact and react with the activated composite material to form a stable covalent bond. After the reaction, the precipitate was collected by centrifugation at 10000 rpm for 10 min, and the precipitate was repeatedly washed with PBS for 3-5 times to remove unreacted antibodies and impurities, and further washed with anhydrous ethanol for 2-3 times, and dried in a vacuum oven at 60 °C for 12 h to obtain Anti-WTA-Fe3O4@MOF-5.

[0064] Preparation of CHO-aptamer-Fe3O4@MOF-5:

[0065] 5 mg Fe3O4@MOF-5 was weighed and dissolved in 10 mL sterile saline, and ultrasonic treatment was performed for 15 min to fully disperse it to form a stable suspension. 80 μL of the suspension was slowly added to 820 μL of acetate buffer (pH 4.5), and then 100 μL of CHO-aptamer solution (600 nmol / L, the sequence is also shown in SEQ ID NO: 1) was added. The mixed solution was placed on a DNA vortexer for reaction for 30-60 min to allow CHO-aptamer to fully bind to the surface of Fe3O4@MOF-5. After the reaction was completed, the precipitate was collected by centrifugation at 10000 rpm for 10 min, and the precipitate was repeatedly washed with PBS for 3-5 times to remove unreacted aptamers and impurities, and further washed with anhydrous ethanol for 2-3 times, and dried in a vacuum oven at 60°C for 12 h to obtain CHO-aptamer-Fe3O4@MOF-5.

[0066] Preparation of Anti-WTA-Fe3O4:

[0067] Fe3O4 was prepared by chemical coprecipitation method. First, 0.486g FeCl3·6H2O and 0.18g FeCl2·4H2O were dissolved in 10mL deionized water. After ultrasonic treatment for 15min, NaOH solution (0.2mol / L) was slowly added. When the solution turned into black particles, the addition of NaOH was stopped and stirred for 30min. The obtained black particles were washed with deionized water for 3-6 times and dried in a vacuum oven at 60℃ for 12h to obtain Fe3O4. The subsequent preparation of Anti-WTA-Fe3O4 is the same as that of Anti-WTA-Fe3O4@MOF-5. First, 5 mg of Fe3O4 is weighed and dissolved in 10 mL of sterile saline. Ultrasonic treatment is performed for 15 min to fully disperse it to form a stable suspension. Then, 290 μL of EDC solution (10 mg / mL) and 325 μL of NHSS solution (10 mg / mL) are added to the suspension. The suspension is reacted on a DNA vortexer for 30-60 min to activate the carboxyl functional groups on the surface of Fe3O4. Subsequently, 1 mL of the activated Fe3O4 suspension is placed in an ice bath, and 80 μL of Anti-WTA solution (1 mg / mL) is slowly added thereto. Stir at 4 ° C for 12-24 h to allow the antibody to fully contact and react with the activated magnetic material to form a stable covalent bond. After the reaction, the precipitate was collected by centrifugation at 10000 rpm for 10 min, and the precipitate was repeatedly washed with PBS for 3-5 times to remove unreacted antibodies and impurities, and further washed with anhydrous ethanol for 2-3 times, and dried in a vacuum oven at 60°C for 12 h to obtain Anti-WTA-Fe3O4.

[0068] The enrichment experimental steps are as follows: take 1 mL of overnight culture of Staphylococcus aureus and centrifuge at 8000 rpm for 5 min to collect the bacterial precipitate, wash the bacterial precipitate three times with sterile PBS, and measure its OD after resuspending. 600 The concentration was adjusted to 10 5CFU / mL, weigh 1mg of the magnetic composite material of Anti-WTA-Fe3O4@MOF-5 (CHO-aptamer-Fe3O4@MOF-5 or Anti-WTA-Fe3O4) and dissolve it in 1mL of sterile PBS for mixing. Take 100μL of bacterial suspension and 100μL of Anti-WTA-Fe3O4@MOF-5 suspension and add 800μL of sterile PBS solution, and incubate in a 37℃ horizontal shaker for 30min. After the incubation, the mixed solution was magnetically separated for 3-5min with the help of a magnetic stand, 200μL of the supernatant was taken and diluted 100 times, and 100μL was applied to the TSB agar plate. In addition, the magnetic separation precipitate was resuspended with 1mL of sterile PBS, 200μL of the suspension was taken and diluted 100 times, and 100μL was applied to the TSB agar plate, and the TSB agar plate was placed in a 37℃ constant temperature incubator for 12-16h for colony counting.

[0069] Figure 3 Figure A shows the change in the Zeta potential of Anti-WTA-Fe3O4@MOF-5 before and after binding with S. aureus. The Zeta potentials of Anti-WTA-Fe3O4@MOF-5 and S. aureus are -4.37mV and -11.63mV, respectively, while the Zeta potential of Anti-WTA-Fe3O4@MOF-5 adsorbed with S. aureus is -16.25mV, indicating that Anti-WTA-Fe3O4@MOF-5 successfully captured S. aureus. Figure 3 B shows the results of Anti-WTA-Fe3O4@MOF-5 capturing S. aureus through SEM images. Figure 3 C shows that with the increase of Anti-WTA concentration, the enrichment efficiency of Anti-WTA-Fe3O4@MOF-5 for Staphylococcus aureus tends to increase. When the Anti-WTA concentration is 80μg / mL, the enrichment efficiency of Staphylococcus aureus reaches the equilibrium value. Figure 3 D shows that the UV-vis value of CHO-aptamer at 267nm in the supernatant of Fe3O4@MOF-5 with the same concentration increases with the increase of CHO-aptamer concentration. When the concentration of CHO-aptamer reaches 60nmol / L, the UV-vis intensity reaches the maximum value. When the concentrations of CHO-aptamer and Anti-WTA are 60nm / mL and 80μg / mL, respectively, the enrichment efficiency of CHO-aptamer-Fe3O4@MOF-5 for Staphylococcus aureus is about 85%, while the enrichment efficiency of Anti-WTA-Fe3O4@MOF-5 is higher than 90%, as shown in Figure 2. Figure 3 At the same time, the present invention also compares the effect of MOFs materials in the capture probe Anti-WTA-Fe3O4@MOF-5 on the enrichment efficiency of Staphylococcus aureus. Figure 3 It can be seen from the F that with the increase of Anti-WTA-Fe3O4@MOF-5 and Anti-WTA-Fe3O4 concentrations, the enrichment efficiency of Staphylococcus aureus also increases. However, at any concentration, the enrichment efficiency of Anti-WTA-Fe3O4@MOF-5 is significantly higher than that of Anti-WTA-Fe3O4, indicating the criticality of MOF-5 material in the capture probe Anti-WTA-Fe3O4@MOF-5. Therefore, Anti-WTA-Fe3O4@MOF-5 was selected as the capture probe for enriching Staphylococcus aureus.

[0070] Optimization of enrichment conditions of Staphylococcus aureus using capture probe Anti-WTA-Fe3O4@MOF-5

[0071] The present invention studies the enrichment effect of the capture probe on Staphylococcus aureus under different weight ratios of Fe3O4 to MOF-5, different Fe3O4@MOF-5 concentrations, different system pH values, different incubation temperatures, different incubation times, and different magnetic separation times. The results are as follows Figure 4 shown.

[0072] Figure 4 A shows the weight ratio of Fe3O4 to MOF-5 in the capture probe. When the ratio between the two is 3:5, the enrichment efficiency of Staphylococcus aureus is the highest. Figure 4 Figure B shows that as the concentration of Fe3O4@MOF-5 increases, the enrichment efficiency of the capture probe for Staphylococcus aureus also increases, and its enrichment efficiency almost reaches the maximum value at 40 μg / mL. Further increasing the concentration of Fe3O4@MOF-5 will not significantly affect the enrichment efficiency of the capture probe. Figure 4 The C showed that the enrichment efficiency of S. aureus increased with the increase of pH value in the solution, and the enrichment efficiency reached the maximum value at pH 7.5. Figure 4 D shows that the enrichment efficiency of S. aureus increases with increasing temperature and reaches a peak at 37°C. Figure 4 E shows that the enrichment efficiency increases with the incubation time of S. aureus and the capture probe, and remains unchanged when the incubation time exceeds 30 min. Figure 4 The results of F showed the effect of magnetic separation time on the enrichment efficiency of Staphylococcus aureus. When the magnetic separation time was 3 min, the best enrichment efficiency of 92.4% was obtained, and further increasing the magnetic separation time had almost no effect on the enrichment efficiency. Therefore, the optimal experimental conditions were determined as follows: Fe3O4@MOF-5 concentration of 40 μg / mL, incubation time of 30 min, temperature of 37 °C, magnetic separation time of 3 min, and pH value of 7.5.

[0073] Example 2

[0074] Preparation of signal probe SERS tag (PATP-aptamer-AuNP)

[0075] 2.98 mL of HAuCl4 (10 mM) was added to a round-bottom flask containing 100 mL of deionized water, heated and stirred until the temperature reached 110 ° C. Subsequently, 3.27 mL of sodium citrate solution (100 mg / mL) was added and stirring continued at 110 ° C. When the solution turned brick red, stirring was continued for 30 min. The product AuNPs was naturally cooled to room temperature and stored at 4 ° C. 5 mL of AuNPs and 1 mL of HS-aptamer (50 nmol / L, SEQ ID NO: 1) were placed in a 10 mL centrifuge tube and rotated on a rotary agitator for 4 h to complete the entire reaction. After the reaction was completed, the unattached HS-aptamer was washed from the solution by centrifugation at 15000 rpm for 10 min using a low-speed centrifuge. The remaining solution was resuspended to obtain HS-aptamer-AuNPs, and PATP (10 -4 mol / L) and rotated on a rotary stirrer for 30 min to completely connect PATP to HS-aptamer-AuNPs to obtain PATP-aptamer-AuNPs.

[0076] Characterization of signal probe SERS tags

[0077] The morphologies of bare AuNPs and HS-aptamer-AuNPs were observed using TEM. Figure 5 As shown in Figure A, compared with the bare AuNPs, there is a layer of cloud-like substance on the surface of HS-aptamer-AuNPs, indicating that HS-aptamer is successfully attached to AuNPs. Figure 5 Figure B shows that the Zeta potentials of AuNPs and HS-aptamer-AuNPs are -20.38 mV and -29.46 mV, respectively, which is due to the negative charge of HS-aptamer. Further, dynamic light scattering (DLS) was used to analyze the size distribution of AuNPs before and after HS-aptamer probe attachment, as shown in Figure 2. Figure 5 As shown in Figure C, after HS-aptamer connection, the size of the nanoparticles increased by 2-5 nm, which is consistent with the TEM results. Figure 5 The results of D Raman scattering showed that the SERS intensity was almost 0 before and after AuNPs combined with HS-aptamer. However, after PATP combined with AuNPs, the SERS intensity changed significantly. AuNPs enhanced the SERS intensity of PATP, indicating that AuNPs have excellent SERS enhancement performance. Figure 5 The E ultraviolet absorption spectrum further confirmed this result, and the absorption peak shifted from 521nm to 523nm. Figure 5The results of F circular dichroism spectrum showed that after binding with S. aureus, the weaker peak intensity of HS-aptamer and the strong peak intensity of HS-aptamer-S. aureus were both at 280 nm, indicating that there was a binding interaction between HS-aptamer and S. aureus.

[0078] Optimization of signal probe SERS Raman signal

[0079] Figure 6 A shows that the Raman signal increases with the increase of HS-aptamer concentration, reaching a maximum value when the concentration is 50nmol / L, and then the Raman signal weakens with the further increase of HS-aptamer concentration, which may be attributed to the availability of limited sites on AuNPs and the competition between HS-aptamer and PATP. When it is at a concentration of 50nmol / L, HS-aptamer and PATP reach an optimal state, at which time the strongest Raman signal appears. Figure 6 The B probe showed a signal at 1078 cm -1 The Raman signal changes with the concentration of HS-aptamer. Therefore, 50nmol / L HS-aptamer was selected as the optimal condition for subsequent experiments.

[0080] Establishment of standard curve for detection of Staphylococcus aureus based on signal probe SERS

[0081] like Figure 7 As shown in A, the SERS intensity of Staphylococcus aureus before and after binding to Fe3O4@MOF-5 through Anti-WTA is negligible. However, when the SERS tag is combined with Staphylococcus aureus Anti-WTA-Fe3O4@MOF-5, the SERS intensity is significantly enhanced. -1 、1078cm -1 、1173cm -1 、1451cm -1 、1486cm -1 and 1587cm -1 The characteristic peaks observed at correspond to specific vibration modes, such as CH in-plane bending, CC stretching, and CN stretching in the benzene ring. Figure 7 Figure B shows that the Raman signal increases with the increase of S. aureus concentration, while the number of SERS tags attached to the target bacteria depends on the number of bacteria captured by Anti-WTA-Fe3O4@MOF-5. Figure 7 The C display uses 1078cm -1 The target bacteria were quantified by the prominent Raman peak at 1078 cm -1The SERS peak intensity at 400 nm corresponds to the concentration of bacteria, and the linear equation is y = 1269.21x-32.02, ranging from 42 to 4.23 × 10 5 CFU / mL, R 2 The value was 0.9985, and the detection limit was 6 CFU / mL.

[0082] Example 3

[0083] Feasibility verification of Anti-WTA-Fe3O4@MOF-5 and SERS detection of Staphylococcus aureus

[0084] In order to evaluate the storage stability of Anti-WTA-Fe3O4@MOF-5, the enrichment efficiency of Anti-WTA-Fe3O4@MOF-5 on S. aureus was monitored every five days within 30 days. Figure 8 As shown in A, the enrichment efficiency of Staphylococcus aureus decreased by only 5.7% within 30 days, indicating that Fe3O4@MOF-5 has high stability. At the same time, the reproducibility of the constructed method was verified by measuring the Raman signal intensity of parallel samples. Figure 8 B and C show the SERS intensity of ten samples and 1078 cm -1 The intensity changes of the SERS peak at the 10 samples were consistent, indicating that the constructed strategy has good repeatability. In order to evaluate the regeneration ability of Anti-WTA-Fe3O4@MOF-5, Staphylococcus aureus-Anti-WTA-Fe3O4@MOF-5 was immersed in 0.2MNaOH for 2min, then gently rinsed with 0.1M PBS (pH=7.4), and then anti-WTA was reconnected to Fe3O4@MOF-5 to evaluate its regeneration stability. The process was repeated five times. The results are shown in Figure 2. Figure 8 As shown in D and E, there is no significant difference between the five repetitions and the initial results, indicating that Anti-WTA-Fe3O4@MOF-5 has good reproducibility.

[0085] Verification of the specificity of Anti-WTA-Fe3O4@MOF-5 and SERS in detecting Staphylococcus aureus

[0086] The specificity of the detection method was evaluated by incubation with different types of bacteria, including Gram-positive pathogens such as Staphylococcus aureus, Listeria monocytogenes, and Streptococcus mutans, and Gram-negative pathogens such as Escherichia coli, Salmonella, and Pseudomonas aeruginosa. The enrichment efficiency of Staphylococcus aureus alone, five different types of interfering bacteria, and their mixed samples with Staphylococcus aureus were tested. The results are as follows: Fig. 9 As shown in A, a is Staphylococcus aureus, b is Listeria monocytogenes, c is Streptococcus, d is Escherichia coli, e is Salmonella typhimurium, and f is Pseudomonas aeruginosa. The concentration of bacteria is 4.23×10 5CFU / mL, g is a mixed bacterial solution of five interfering bacteria b, c, d, e, and f, the mixing ratio is equal volume, and the total bacterial volume is 4.23×10 5 CFU / mL, h is the mixed bacterial solution of Staphylococcus aureus and five interfering bacteria b, c, d, e, and f, with a mixing ratio of 5:1:1:1:1:1, and the total bacterial count is 8.46×10 5 CFU / mL, i, j, k, l, and m are the mixed bacterial solutions of Staphylococcus aureus and five interfering bacteria b, c, d, e, and f at a ratio of 1:1, respectively, with a total bacterial count of 8.46×10 5 CFU / mL. Fig. 9 A shows that Anti-WTA-Fe3O4@MOF-5 has the highest enrichment efficiency for Staphylococcus aureus, and the enrichment efficiency of interfering bacteria is less than 10%. At the same time, the enrichment efficiency of samples containing Staphylococcus aureus and interfering bacteria is generally high. The results show that the presence of interfering bacteria does not significantly affect the enrichment efficiency of Staphylococcus aureus in the same system. Fig. 9 Figures B and C show the Raman intensity of five single interfering bacteria and mixed samples containing five different types of interfering bacteria, among which the sample containing Staphylococcus aureus exhibits a higher Raman intensity, while the presence of other interfering bacteria has little effect on the Raman intensity, indicating that the method has good specificity.

[0087] In order to verify the applicability of the constructed biosensing strategy, different concentrations of S. aureus were added to skim milk, fresh pork and coconut water purchased from a local supermarket, and their Raman spectra were shown as follows: Fig.10 AC, 1078cm -1 The Raman intensity at Fig.10 As shown in D, the enrichment efficiency of Staphylococcus aureus is as follows Fig.10 As shown in E, the above results further demonstrate that the established detection method has good biosensing performance and can be successfully applied to the detection of Staphylococcus aureus in actual samples.

[0088] In order to avoid false negative results caused by the failure to detect or inaccurate detection of trace pollutants in food samples with complex matrices, the present invention establishes a surface enhanced Raman scattering (SERS) biosensor detection strategy based on magnetic metal organic framework materials (MMOF) for Staphylococcus aureus in food, wherein MMOF utilizes the magnetic separation performance of Fe3O4 and the adsorption performance of MOFs to achieve the enrichment and separation of target pollutants in food samples under the action of an external magnetic field. On this basis, in order to achieve the maximum efficiency of Fe3O4@MOF-5 enrichment, the present invention prepares anti-Staphylococcus aureus monoclonal antibodies - β-O-linked N-acetylglucosamine wall-teichoic acids (β-O-linked N-acetylglucosamine wall-teichoic acids, anti-WTA) and CHO-aptamer modified capture probes. The signal probe is based on AuNPs and is modified by HS-aptamer and P-aminothiophenol (PATP) to ensure the specific recognition of Staphylococcus aureus, thereby successfully preparing SERS tags. Through the characterization and performance verification of the capture probe and signal probe, the capture probe modified with Anti-WTA was selected. Under the optimal magnetic separation conditions, the enrichment efficiency of S. aureus can reach 94.7%. Combined with the SERS detection of the signal probe, the whole detection process can be completed within 50 min. The concentration range of S. aureus detection is 42-4.23×10 5 CFU / mL, and the minimum detection limit (LOD) is 6 CFU / mL. The sensor has successfully detected Staphylococcus aureus in skim milk, fresh pork and coconut milk. Subsequent replacement of the recognition element will provide a reference for the detection of other foodborne pathogens or harmful contaminants in food.

[0089] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments.

Claims

1. A SERS biosensor based on magnetic metal organic framework materials, comprising a capture probe and a signal probe; The capture probe is antibody-modified Fe3O4@MOF-5, and the antibody is a monoclonal antibody against Staphylococcus aureus; The signal probe is AuNPs modified by HS-aptamer and P-aminothiophenol; the aptamer is an aptamer nucleic acid sequence that specifically recognizes Staphylococcus aureus.

2. The SERS biosensor based on magnetic metal organic framework material according to claim 1, wherein: The anti-Staphylococcus aureus monoclonal antibody is a β-O-linked N-acetylglucosamine wall teichoic acid antibody; The weight ratio of Fe3O4 to MOF-5 in Fe3O4@MOF-5 is 1:1.5~2; The sequence of the HS-aptamer is: 5'-GCAATGGTACGGTACTTCCTCGGCAC GTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCA CGCTACTTTGCTAA-3'.

3. The SERS biosensor based on magnetic metal organic framework material according to claim 1, wherein: The method for preparing the capture probe comprises the following steps: (1) Synthesize MOF-5 by hydrothermal synthesis; (2) reacting the MOF-5 obtained in step (1) with a Fe3O4 precursor to obtain Fe3O4@MOF-5; (3) Activate the carboxyl functional groups on the surface of Fe3O4@MOF-5, and then add Anti-WTA solution to prepare Anti-WTA-Fe3O4@MOF-5.

4. The SERS biosensor based on magnetic metal organic framework material according to claim 3, wherein: In step (1), the step of synthesizing MOF-5 by hydrothermal synthesis includes: dissolving zinc nitrate hexahydrate and terephthalic acid in a solvent, reacting in a high-pressure reactor, and drying the obtained product after the reaction to obtain MOF-5.

5. The SERS biosensor based on magnetic metal organic framework material according to claim 3, wherein: Step (2) comprises: The MOF-5 powder was dissolved in water and ultrasonicated to make it fully dissolved, and Fe3O4 precursor and ammonia solution were added, stirred for reaction, washed and dried to obtain Fe3O4@MOF-5; The Fe3O4 precursor is preferably FeCl3·6H2O and / or FeCl2·4H2O.

6. The SERS biosensor based on magnetic metal organic framework material according to claim 1, wherein: The method for preparing the signal probe comprises the following steps: (1) Mixing AuNPs and HS-aptamer to obtain HS-aptamer-AuNPs; (2) HS-aptamer-AuNPs were mixed with P-aminothiophenol to obtain the signal probe PATP-aptamer-AuNPs.

7. A method for detecting Staphylococcus aureus using surface enhanced Raman scattering, using the biosensor according to any one of claims 1 to 6, comprising the following steps: (1) mixing and incubating a sample containing Staphylococcus aureus with a capture probe, adding an external magnetic field for magnetic separation, discarding the supernatant, and resuspending the solid component; (2) adding a signal probe to the product obtained in step (1) and detecting the 1078 cm -1 The SERS peak intensity at is substituted into the standard curve to obtain the concentration of Staphylococcus aureus in the sample to be tested.

8. The method according to claim 7, wherein: The method for preparing the standard curve comprises: (1) A series of solutions of Staphylococcus aureus with known concentrations are mixed and incubated with capture probes, an external magnetic field is added for magnetic separation, the supernatant is discarded, and the solid component is resuspended; (2) adding a signal probe to the product obtained in step (1) and detecting the 1078 cm -1 The SERS peak intensity at 1078 cm -1 A standard curve was drawn based on the SERS peak intensity at 100 nm and the concentration of bacteria.

9. The method according to claim 7, wherein: In the detection system, the concentration of the capture probe measured in Fe3O4@MOF-5 is 35-50 μg / mL, the pH value of the system is 7.2-7.8, the incubation time of the capture probe and the sample to be tested is 25-35 min, the incubation temperature is 35-40°C, and the magnetic separation time is 2-4 min; in the detection system, the concentration of the signal probe measured in HS-aptamer is 40-55 nmol / L.

10. The method according to claim 7, wherein: The sample to be tested is food or a biological sample.

Images