CRISPR / Cas12a micro-fluidic chip aptamer sensor based on G4 dimer enhancement and application of CRISPR / Cas12a micro-fluidic chip aptamer sensor

Abstract

The invention provides a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a (CRISPR / Cas12a) micro-fluidic chip aptamer sensor based on G4 dimer enhancement and application of the CRISPR / Cas12a The sensor adopts a three-layer PMMA (Polymethyl Methacrylate) structure and integrates a replaceable self-assembled pre-stored reagent tube and a contraction-expansion micro-mixing channel with a rhombic micro-column, so that the rapid, sensitive and specific detection of salmonella typhimurium is realized; wherein the rhombic micro-column design of the micro-mixing channel can generate asymmetric vortexes, so that the fluid mixing efficiency is enhanced; the self-assembly pre-storage reagent tube realizes automatic addition of the reagent, so that the chip can be repeatedly used. The detection range of the sensor is 3.6 * 10 < 1 >-3.6 * 10 < 6 > CFU / mL, the detection limit is 36 CFU / mL, and the recovery rate of the sensor in actual samples such as milk, pre-cut vegetables and chicken is 88.11-105.19%. According to the present invention, the detection sensitivity is improved through the fluorescence enhancement effect of the G4 dimer, the automation and the high efficiency of the detection process are achieved by combining the microfluidic technology, and the method is suitable for the food safety detection field.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and in particular relates to a novel CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement and its application in Salmonella typhimurium. Background Art

[0002] Salmonella Typhimurium (S. typhimurium) is one of the most prevalent foodborne pathogens worldwide and the leading causative agent of salmonellosis in humans. Consumption of contaminated food, particularly meat, eggs, and dairy products, can result in severe gastrointestinal symptoms, including diarrhea, fever, nausea, and vomiting. In immunocompromised individuals, the elderly, and young children, infection can progress to life-threatening complications, such as sepsis and intestinal perforation. While traditional culture-based detection methods remain the gold standard and have high specificity, they are time-consuming and labor-intensive. Other methods, including immunological and molecular biology methods, have their own strengths and weaknesses in terms of speed, sensitivity, and practical implementation. Immunological methods provide rapid results but face challenges with cross-reactivity and matrix interference, while molecular techniques such as PCR, while highly specific and sensitive, require specialized techniques and equipment.

[0003] The emergence of CRISPR / Cas system as a gene editing tool has revolutionized biosensing applications, especially in rapid food safety testing. Among various Cas proteins, Cas12a has emerged as a promising candidate due to its unique lateral cleavage activity. CRISPR / Cas12a, guided by crRNA, exhibits nonspecific cleavage activity against surrounding single-stranded DNA (ssDNA) after recognizing a target DNA sequence containing a protospacer adjacent motif (PAM) site. This unique property, combined with its programmability and single-base accuracy, has promoted the development of various biosensing platforms, including colorimetric, fluorescence, electrochemical, surface plasmon resonance (SPR), and surface-enhanced Raman spectroscopy (SERS) detection systems. Although fluorescence methods dominate CRISPR / Cas12a biosensing applications, current methods usually rely on expensive fluorescein / quencher-labeled single-stranded DNA or quantum dot-modified probes, which limit their practical applications due to high cost and complicated preparation procedures.

[0004] The G-quadruplex structure is a complex quadruplex DNA or RNA structure formed by folding of guanine-rich nucleotide sequences through Hoogsteen hydrogen bonds in the presence of specific cations (K⁺, Na⁺, NH4⁺). G-quadruplexes are widely used to establish label-free fluorescent biosensors due to their unique fluorescence enhancement properties when combined with certain water-soluble fluorescent dyes such as thiophene T (ThT) or N-methylmorpholine IX (NMM). Interestingly, activated CRISPR / Cas12a can not only cut single-stranded DNA, but also G4. Based on this property, CRISPR / Cas12a label-free biosensors based on G4 probes have been constructed for the detection of multiple targets.

[0005] However, these methods not only involve tedious experimental procedures such as target DNA extraction and nucleic acid amplification, but also exhibit low fluorescence intensity when using G4 / ThT and G4 / NMM probes. Notably, recent findings have shown that the G4 dimer / ThT complex exhibits approximately nine times higher fluorescence intensity than the traditional G4 / ThT system, but their potential in CRISPR / Cas12a-based detection has not yet been explored.

[0006] Microfluidic chips provide a miniaturized platform for integrating complex biochemical reactions and simplifying sample preparation, biochemical detection, and detection processes. Leveraging their compact design and automation capabilities, these systems have applications in various fields that require rapid and sensitive detection, such as environmental monitoring, food safety assessment, and clinical diagnosis. The synergistic combination of CRISPR-based biosensors and microfluidic chip technologies has made significant progress in achieving high specificity, sensitivity, throughput, and rapid detection. The precise nucleic acid recognition capabilities of the CRISPR / Cas12a system, coupled with the miniaturization, automation, and high-throughput advantages of microfluidic chips, have greatly improved biosensor performance. However, traditional reagent pre-loading methods in microfluidic chips, such as drying, encapsulation, and direct filling, face challenges such as long reconstitution time, susceptibility to thermal or photochemical degradation, limited chip reusability, stability issues, adsorption problems, and complex valve switching.

[0007] Therefore, in order to solve the above problems, a new reagent preloading method is urgently needed to ensure high reproducibility and facilitate the replacement of reagents in microfluidic chips. Summary of the invention

[0008] The object of the present invention is to provide a CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement, and a CRISPR / Cas12a microfluidic chip aptamer sensor for label-free rapid detection of Salmonella and a corresponding detection method.

[0009] In order to achieve the above-mentioned object, one of the objects of the present invention is to provide a CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement, comprising: at least one detection unit;

[0010] The detection unit comprises: a sample inlet, a detection chamber, and a plurality of micro-mixing channels, a reaction chamber and a self-assembled pre-stored reagent tube;

[0011] The self-assembly pre-stored reagent tube is at least provided with a Cas12a / crRNA self-assembly pre-stored reagent tube, a G4 dimer self-assembly pre-stored reagent tube and a ThT self-assembly pre-stored reagent tube connected in sequence;

[0012] The injection port is sequentially connected to a micro-mixing channel, a reaction chamber and a Cas12a / crRNA self-assembly pre-stored reagent tube;

[0013] The self-assembled pre-stored reagent tubes are connected in series with the reaction chamber via a micro-mixing channel;

[0014] The end of the ThT self-assembly pre-stored reagent tube is connected to the detection chamber through a micro-mixing channel.

[0015] Furthermore, the aptamer sequence of Salmonella is:

[0016] TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG, as shown in SEQ ID NO.1;

[0017] The crRNA sequence is:

[0018] UAAUUUCUACUAAGUGUAGAUCCCCGUCGGGUGACGCCGCC, such as SEQ ID NO.2;

[0019] The G4 dimer sequence is:

[0020] GGGTAGGGCGGGTTGGGGGGTAGGGCGGGTTGGG, as shown in SEQ ID NO.3.

[0021] The beneficial effects of adopting the above technical solution include at least: The present invention proposes an innovative fluorescent aptamer sensor based on a microfluidic chip, which combines G-quadruplex (G4) dimer signal enhancement technology and CRISPR / Cas12a technology for rapid label-free detection of Salmonella typhimurium. The present invention includes a self-assembled, replaceable reagent pre-storage tube and an automatic micro-mixing module, which realizes one-pot efficient multi-step reaction.

[0022] At the same time, the integration of G4 dimer enhancement technology significantly improves the signal-to-noise ratio and detection accuracy, achieving automation, rapidity and high sensitivity in food safety testing.

[0023] Preferably, the micro-mixing channel is a contraction-expansion micro-mixing channel;

[0024] Wherein, the size of the shrinkage channel is 1.67 × 0.5 mm;

[0025] The expansion channel has a size of 2.33 × 2.15 mm.

[0026] The beneficial effects of adopting the above technical solution include at least: the diamond-shaped microcolumns with "contraction-expansion" channel configuration function designed in the automatic micro-mixing module of the present invention eliminate the need for complex microvalves and realize efficient one-pot multi-step reactions.

[0027] Preferably, a diamond-shaped microcolumn is provided in the micro-mixing channel, and the size of the diamond-shaped microcolumn is 0.8×0.8 mm.

[0028] Preferably, the self-assembled pre-stored reagent tube comprises a tapered tube, a sealing cover, a micro-mixing channel connecting tube and a reaction chamber connecting tube;

[0029] Wherein, the micro-mixing channel connecting tube and the reaction chamber connecting tube are both fixed to the top of the conical tube through a sealing cover;

[0030] Furthermore, one end of the micro-mixing channel connecting tube is connected to the micro-mixing channel, and the other end thereof is inserted into the reagent in the conical tube through a needle;

[0031] One end of the reaction chamber connecting tube is connected to the reaction chamber, and the other end is suspended above the reagent in the conical tube through a needle.

[0032] The beneficial effects of adopting the above technical solution include at least: the self-assembled pre-storage reagent tube designed by the present invention is an easily replaceable reagent pre-storage tube with a simple structure, low cost, and easy assembly.

[0033] Further, the easily replaceable self-assembled pre-stored reagent tube includes: a PCR tube and two syringe needles of different lengths;

[0034] Among them, the flat end of the longer syringe needle is inserted into the center of the PCR tube and extends to the bottom;

[0035] The flat end of the shorter syringe needle is inserted along the longer needle, and its tip does not touch the reagent; the tip of the shorter needle is connected to the reaction chamber through an elastic rubber tube;

[0036] The tip of the longer needle is connected to the micro-mixing channel through an elastic rubber tube.

[0037] Preferably, the sensor is made of three layers of PMMA material by thermal bonding;

[0038] Among them, the front side of the first layer is mainly a pipeline connection layer, the back side is a functional area layer, the second layer is a detection chamber layer, and the third layer is a channel-free base layer for sealing the detection chamber.

[0039] Furthermore, the front side of the first layer includes a detection chamber, an injection port and a self-assembled pre-stored reagent tube slot, which are mainly used for pipeline connection; the back side of the first layer includes a "contraction-expansion" micro-mixing channel based on diamond columns, a reaction chamber, a detection chamber and a pipeline connection port, which are mainly used to form different functional area structures.

[0040] The second layer is a deepened detection chamber, which is mainly used to store the reaction liquid in the reaction chamber.

[0041] The third layer is a channel-free substrate, which is mainly used to seal the deepening chamber.

[0042] Preferably, three detection units are provided, and the size of the sensor is 95 mm × 60 mm × 5 mm.

[0043] The beneficial effects of adopting the above technical solution include at least: the structure designed by the present invention includes at least three independent detection units, each unit is equipped with four micro-mixing channels with integrated diamond micro-columns, three reaction chambers and three self-assembled pre-stored reagent tubes pre-loaded with Cas12a / crRNA, G4 dimer and ThT respectively; the present invention realizes the simultaneous detection of three samples or triple repeated experiments, with stronger reliability and accuracy and higher sensitivity.

[0044] The second object of the present invention is to provide an application of a CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement in detecting Salmonella typhimurium in food samples.

[0045] Preferably, the detection range of Salmonella typhimurium is 3.6×10 1 to 3.6×10 6 CFU / mL.

[0046] The third object of the present invention is to provide a method for detecting Salmonella typhimurium in food, which uses the G4 dimer-enhanced CRISPR / Cas12a microfluidic chip aptamer sensor to detect Salmonella typhimurium, specifically comprising:

[0047] 1) The sample and the aptamer mixture are mixed in the micro-mixing channel 1 and then enter the reaction chamber 1;

[0048] 2) The unbound aptamer is mixed with the pre-stored Cas12a / crRNA in micro-mixing channel two through the Cas12a / crRNA self-assembly pre-stored reagent tube; after the mixture passes through reaction chamber two, it is mixed with the pre-stored G4 dimer in micro-mixing channel three through the G4 dimer self-assembly pre-stored reagent tube; after the mixture passes through reaction chamber three, it is mixed with ThT in micro-mixing channel four through the ThT self-assembly pre-stored reagent tube and enters the detection chamber for detection.

[0049] Preferably, the detection conditions are: ThT concentration is 12.5 µM; Cas12a concentration is 12.5 nM; aptamer concentration is 2 nM; reaction time is 30 minutes;

[0050] The detection recovery rate was 88.11-105.19%.

[0051] In summary, the present invention applies G-quadruplex (G4) dimer signal enhancement technology to CRISPR / Cas12a-based detection, which significantly improves the signal-to-noise ratio and detection accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0053] Figure 1 Schematic diagram of the structure of the CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement;

[0054] Figure 2 This is a schematic diagram of the structure of the micro-mixing channel and the self-assembled pre-stored reagent tube in Example 3;

[0055] in, Figure 2 a is a physical picture of the "contraction-expansion" micro-mixing channel based on diamond-shaped micro-pillars;

[0056] Figure 2 b and Figure 2 c is a physical picture of a self-assembled and easily replaceable self-assembled pre-stored reagent tube;

[0057] And, 1 is an elastic rubber tube, 2 is a 1 mL syringe needle, 3 is a 5 mL syringe needle, and 4 is a PCR tube;

[0058] Figure 3a This is a schematic diagram of the results of exploring ThT concentration in Example 4;

[0059] Figure 3b This is a schematic diagram of the results of exploring the aptamer concentration in Example 5;

[0060] Figure 3c This is a schematic diagram of the results of exploring the concentration of CRISPR / Cas12a in Example 6;

[0061] Figure 3d This is a schematic diagram of the results of exploring the cutting time in Example 7;

[0062] FIG4 a is a fluorescence emission spectrum of different concentrations of Salmonella typhimurium detected using the G4 dimer-enhanced CRISPR / Cas12a aptamer sensor in Example 8;

[0063] Figure 4b This is a graph showing the relationship between the fluorescence intensity and concentration of Salmonella typhimurium at 492 nm in Example 8;

[0064] Figure 4c This is a linear relationship diagram between the logarithm of the concentration of Salmonella typhimurium and the fluorescence intensity in Example 8;

[0065] Figure 4d This is a graph showing the specificity analysis results of the CRISPR / Cas12a aptamer sensor enhanced by G4 dimer according to Example 9;

[0066] Figure 5a A physical picture of the microfluidic chip aptamer sensor prepared in Example 10;

[0067] Figure 5b This is a fluorescence spectrum diagram of detecting different concentrations of Salmonella typhimurium based on the G4 dimer-enhanced CRISPR / Cas12a microfluidic aptamer sensor in Example 10;

[0068] Figure 5c This is a fluorescence intensity diagram of different concentrations of Salmonella typhimurium at 492 nm in Example 10;

[0069] Figure 5d This is a linear relationship diagram between the logarithm of the concentration of Salmonella typhimurium and the fluorescence intensity in Example 10. DETAILED DESCRIPTION

[0070] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0072] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0073] Example 1

[0074] This embodiment provides a CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement

[0075] Please refer to Figure 1 : The front of the first layer contains the detection chamber, the injection port and the self-assembled pre-stored reagent tube slot, which is mainly used for pipeline connection;

[0076] The back side of the first layer includes a "contraction-expansion" micro-mixing channel based on diamond columns, a reaction chamber, a detection chamber, and a pipeline connection port, which are mainly used to form structures with different functional areas;

[0077] The second layer is a deepened detection chamber, which is mainly used to store the reaction liquid in the reaction chamber.

[0078] The third layer is a channel-free substrate, which is mainly used to seal the deepening chamber.

[0079] The CRISPR / Cas12a microfluidic chip aptamer sensor was made of three layers of PMMA by thermal bonding and had a size of 95 mm × 60 mm × 5 mm.

[0080] The CRISPR / Cas12a microfluidic chip aptamer sensor has three independent detection units, each equipped with four micro-mixing channels with integrated diamond-shaped micro-columns, three reaction chambers, and three self-assembled pre-stored reagent tubes pre-loaded with Cas12a / crRNA, G4 dimer, and ThT, respectively. This design enables simultaneous detection of three samples or triple replicate experiments.

[0081] Example 2 Design of a micro-mixing channel with a "contraction-expansion" structure and integrated diamond-shaped micro-pillars

[0082] like Figure 2 Shown in a: A micro-mixing channel with a "contraction-expansion" structure and integrated diamond-shaped micro-pillars.

[0083] The dimensions of the contraction channel are 1.67×0.5 mm, the expansion channel are 2.33×2.15 mm, and the diamond microcolumn are 0.8×0.8 mm.

[0084] The micro-mixing channel designed in this embodiment not only promotes the formation of vortex, but also generates variable shear force, thereby promoting full mixing of fluids. Compared with traditional circular micro-pillars, diamond-shaped micro-pillars generate stronger fluid disturbance and improve mixing efficiency.

[0085] The above principle mechanism is:

[0086] 1. Asymmetric vortices: The sharp corners of the diamond-shaped micropillars produce asymmetric vortices with significantly enhanced mixing capabilities, which is in contrast to the symmetric vortices produced by circular micropillars;

[0087] 2. Strong shear force and secondary flow: Diamond microcolumns generate strong shear force and secondary flow in the fluid;

[0088] 3. Increased interfacial area and flow resistance: The sharp edges of the diamond-shaped micropillars not only increase the interfacial area between the fluid and the solid surface, but also produce greater flow resistance, further enhancing the mixing effect.

[0089] Example 3 Design of a self-assembled and easily replaceable self-assembled pre-stored reagent tube

[0090] like Figure 2 As shown in b and 2c: The pre-loaded self-assembled pre-stored reagent tube includes: a PCR tube and two syringe needles of different lengths.

[0091] The self-assembled and easily replaceable pre-stocked reagent tubes contain a PCR tube, a 1 mL syringe needle, and a 5 mL syringe needle.

[0092] When not in use, the reagents are sealed in the tubes.

[0093] In operation, the flat end of the longer needle is inserted into the center of the reservoir and extended to the bottom, while the flat end of the shorter needle is inserted along the longer needle, ensuring that its tip does not touch the reagent.

[0094] The tip of the shorter needle is connected to the reaction chamber through an elastic rubber tube, and the tip of the longer needle is connected to the micro-mixing channel through an elastic rubber tube.

[0095] After the reaction reagent flows into the storage chamber through the shorter needle, the mixed liquid in the tube is pushed into the subsequent micro-mixing channel and reaction chamber under the action of air pressure. The reaction reagent is pre-stored in the storage chamber in the form of liquid or freeze-dried powder.

[0096] Compared with the method of pre-embedded reaction reagents inside the microfluidic chip, the pre-loaded self-assembled pre-stored reagent tube in this embodiment gives the microfluidic chip reusability, thereby significantly reducing the detection cost. Secondly, the pre-loaded self-assembled pre-stored reagent tube integrates multiple continuous processes such as mixing, incubation, reaction and detection into a single microchannel, realizing one-pot method, automation and rapid sample detection. In addition, the pre-loaded self-assembled pre-stored reagent tube can not only meet the ventilation requirements of the microfluidic chip, but also can be used as a microvalve for fluid flow control. Moreover, the size of the pre-loaded self-assembled pre-stored reagent tube and the length of the two needles can be customized and assembled according to specific requirements.

[0097] Example 4 Optimization of ThT concentration

[0098] To optimize ThT concentration, different volumes (0, 5, 10, 15, 20, 25, 30, and 35 μL) of 50 μM ThT were dispensed into a 96-well plate. Subsequently, 2.5 μL of 5 μM G4 dimer was added to each well. The reaction volume was adjusted to 100 μM with 10 mM Tris-HCl buffer containing 100 mM NaCl and 20 mM MgCl2. This resulted in a final ThT concentration range of 0 to 17.5 μM. The fluorescence intensity of the G4 dimer / ThT complex was measured after incubation at room temperature in the dark for 30 minutes.

[0099] like Figure 3a As shown in the figure, when the concentration of ThT increased from 0 to 12.5 μM, the fluorescence intensity of the G4 dimer / ThT complex gradually increased, but remained essentially constant at higher concentrations. Therefore, the optimal concentration of ThT was determined to be 12.5 μM.

[0100] Example 5 Optimization of aptamer concentration

[0101] 30 μM of Cas12a / crRNA at a concentration of 250 nM was dispensed into a 96-well plate. Subsequently, different volumes (0, 2, 4, 6, 8, 10, and 12 μ2) of 50 nM aptamer were added to each well. The reaction volume was adjusted to 100 μM with Tris-HCl buffer and incubated at 37 °C for 30 minutes. Next, 10 μM of 5 μM G4 dimer was added to each well and incubated again at 37 °C for 30 minutes. Finally, 2.5 μM of 1 mM ThT was added to each well, and the final volume was adjusted to 200 μM with Tris-HCl buffer. After incubation at room temperature in the dark for 30 minutes, the fluorescence intensity of the G4 dimer / ThT complex at different aptamer concentrations was measured. Figure 3b As shown in the figure, as the Cas concentration increased from 0 to 12.5 nM, the fluorescence intensity of the G4 dimer / ThT complex decreased in a concentration-dependent manner. However, further increasing the Cas concentration did not result in a significant decrease in fluorescence, indicating that 12.5 nM is the optimal concentration for this assay.

[0102] Example 6 Optimization of Cas12a / crRNA concentration

[0103] 10 μM of aptamer at a concentration of 50 nM was added to each well of a 96-well plate. Subsequently, different volumes (0, 10, 20, and 30 μM) of 250 nM Cas12a / crRNA were added to each well. The reaction volume was adjusted to 100 μM with Tris-HCl buffer and incubated at 37 °C for 30 minutes. Next, 10 μL of 5 μM G4 dimer was added to each well and incubated again at 37 °C for 30 minutes. Finally, 2.5 μM of 1 mM ThT was added to each well, and the final volume was adjusted to 200 μM with Tris-HCl buffer. After incubation at room temperature in the dark for 30 minutes, the fluorescence intensity of the G4 dimer / ThT complex at different Cas12a / crRNA concentrations was measured. Figure 3c The results showed that in the range of 0-2 nM, the aptamer concentration was negatively correlated with the fluorescence intensity of the G4 dimer / ThT complex. Beyond this range, the fluorescence intensity reached a plateau, indicating that 2 nM was the optimal concentration of the aptamer in this assay.

[0104] Example 7 Optimization of cutting time

[0105] Add 10 μL of aptamer at a concentration of 50 nM to each well of a 96-well plate. Subsequently, add 10 μM of 250 nM Cas12a / crRNA and 80 μL of Tris-HCl buffer to each well. Incubate the plate at 37 °C for 30 minutes. Next, add 10 μM of 5 μM G4 dimer to each well and incubate at 37 °C for different time intervals (0, 5, 10, 15, 20, 30, 40, and 50 minutes). Finally, add 2.5 μL of 1 mM ThT to each well, and adjust the final volume to 200 μL with Tris-HCl buffer. After incubation at room temperature in the dark for 30 minutes, measure the fluorescence intensity of the G4 dimer / ThT complex at each time point. Figure 3d As shown, as the trans-cleavage reaction time increases from 0 to 30 minutes, the fluorescence intensity of the G4 dimer / ThT complex gradually decreases, but remains essentially constant at longer reaction times. Therefore, the optimal trans-cleavage reaction time is determined to be 30 minutes.

[0106] Example 8 G4 dimer-enhanced CRISPR / Cas12a aptamer sensor for detection of Salmonella typhimurium

[0107] At the beginning of the assay, 10 μL of aptamer at a concentration of 50 nM was added to each well of a 96-well plate. Then, 80 μL of aptamer at concentrations ranging from 0 to 7.2×10 7CFU / mL of Salmonella typhimurium suspension was incubated at 37 °C for 30 minutes. Subsequently, 10 μM Cas12a / crRNA at a concentration of 250 nM was added to each well and incubated at 37 °C for another 30 minutes. To trigger the fluorescence signal, 10 μL of G4 dimer at a concentration of 5 μM was added to each well, followed by 2.5 μL of ThT at a concentration of 1 mM. The final volume was adjusted to 200 μL with Tris-HCl buffer. After incubation at room temperature in the dark for 30 minutes, the fluorescence intensity was measured using a fluorescence microplate reader.

[0108] Using G4 dimer-enhanced CRISPR / Cas12a aptamer sensor, the expression of 500 mM of aptamer was detected in the range of 0 to 3.6 × 10 7 CFU / mL concentration range for detecting Salmonella Typhimurium, as shown in Figure 4 , Figure 4 a shows the fluorescence emission spectra of different concentrations of Salmonella Typhimurium detected using the G4 dimer-enhanced CRISPR / Cas12a aptamer sensor. Figure 4b Relationship between the fluorescence intensity of Salmonella typhimurium at 492 nm and its concentration. Figure 4c Linear relationship between the logarithm of S. Typhimurium concentration and fluorescence intensity.

[0109] That is, Figure 4a , 4b As shown in Figure 4c, the fluorescence intensity of the G4 dimer / ThT complex increased with the increase of the concentration of S. typhimurium. 1 to 7.2×10 6 A strong linear correlation (R²=0.989) was observed between the fluorescence intensity and the linear regression equation was FI=1656.5 lgC+14287. The limit of detection (LOD) was determined to be 36 CFU / mL, demonstrating that the G4 dimer-enhanced CRISPR / Cas12a aptamer sensor has high sensitivity and a wide linear detection range in the detection of Salmonella typhimurium.

[0110] Example 9 Evaluation of specificity of CRISPR / Cas12a aptamer sensor based on G4 dimer enhancement

[0111] 10 μL of aptamer at a concentration of 50 nM was added to each well of a 96-well plate. 80 μL Tris-HCl (control), Staphylococcus aureus, Escherichia coli, Salmonella typhimurium, and a mixed bacterial solution of the three bacteria were added to each well and incubated at 37 °C for 30 minutes. Subsequently, 10 μM Cas12a / crRNA at a concentration of 250 nM was added to each well and incubated at 37 °C for 30 minutes. Finally, 10 μL of G4 dimer at a concentration of 5 μM and 2.5 μM ThT at a concentration of 1 mM were added to each well, and the final volume was adjusted to 200 μM with Tris-HCl buffer. After incubation at room temperature in the dark for 30 minutes, the fluorescence intensity was measured. That is, the specificity of the G4 dimer-enhanced CRISPR / Cas12a aptamer sensor for Salmonella typhimurium (S), Escherichia coli (D), Staphylococcus aureus (J) and their mixture was analyzed.

[0112] The concentration used was 3.6×10 5 CFU / mL of Staphylococcus aureus, Escherichia coli O157:H7, Salmonella typhimurium and their mixtures were tested. Figure 4d As shown, significant fluorescence signals were observed only in the Salmonella typhimurium sample, while the fluorescence intensity of non-target pathogens and negative controls was negligible. These results clearly demonstrated that the G4 dimer-enhanced CRISPR / Cas12a microfluidic aptamer sensor was highly specific for Salmonella typhimurium, which may be attributed to the precise base pairing complementarity between the CRISPR / Cas12a system and the aptamer, as well as the strong affinity between Salmonella typhimurium and the aptamer.

[0113] Although the G4 dimer-enhanced CRISPR / Cas12a aptamer sensor has robust sensitivity and specificity, its manual pipetting, mixing, and incubation steps are time-consuming and labor-intensive. In order to automate these processes and improve efficiency, the present invention developed a rapid microfluidic chip-based detection method.

[0114] Example 10 G4 dimer-enhanced CRISPR / Cas12a microfluidic aptamer sensor for detection of Salmonella typhimurium

[0115] Under pneumatic pressure, the sample-aptamer mixture is fully mixed in the micro-mixing channel a1 before entering the reaction chamber b1. In the absence of target Salmonella typhimurium, the unbound aptamer is transported to the pre-storage reagent tube c1 and then mixed with the Cas12a / crRNA pre-stored in the micro-mixing channel a2 before entering the reaction chamber b2. After activation, Cas12a / crRNA is transferred to the pre-storage reagent tube c1 and mixed with the G4 dimer pre-stored in the micro-mixing channel a3 before entering the reaction chamber b3. The cut G4 dimer is then transported to the pre-storage reagent tube c3 and mixed with ThT in the micro-mixing channel a4. In the detection chamber, a weak fluorescent signal is generated due to the lack of G4 dimer / ThT complex. In contrast, when the target Salmonella typhimurium is present, the aptamer binds to the target bacteria, preventing the activation of Cas12a / crRNA and the subsequent cutting of G4 dimer. This results in a higher concentration of G4 dimer / ThT complex in the detection chamber, generating a strong fluorescence signal.

[0116] To evaluate the performance of the G4 dimer-enhanced one-pot CRISPR / Cas12a microfluidic aptamer sensor, a concentration range of 0 to 3.6 × 10 7 CFU / mL of the Salmonella typhimurium detection experiment, the experimental results are shown in Figure 5. Figure 5 a The actual photo of the prepared microfluidic chip, Figure 5b Fluorescence spectra of different concentrations of Salmonella typhimurium detected using the G4 dimer-enhanced CRISPR / Cas12a microfluidic aptamer sensor. Figure 5c Fluorescence intensity of different concentrations of Salmonella typhimurium at 492 nm. Figure 5d Linear relationship between the logarithm of S. Typhimurium concentration and fluorescence intensity.

[0117] In such Figure 5b and 5c As shown, at 3.6×10 1 to 3.6×10 6 The fluorescence intensity of the G4 dimer / ThT complex increased linearly with the increase of the concentration of S. typhimurium within the range of CFU / mL. The linear regression equation was determined as FI = 1871.37 lgC + 133351.71, and the correlation coefficient (R 2 ) was 0.999. The limit of detection (LOD) for Salmonella typhimurium was calculated to be 36 CFU / mL.

[0118] Example 11 Practical Applicability Evaluation

[0119] The effectiveness of the proposed method was evaluated by spiking milk, pre-cut vegetables, and chicken samples with Salmonella typhimurium. The final concentration of the inoculum in the treated samples was 3.6 × 10 3and 3.6×10 4 CFU / mL of S. Typhimurium. The recoveries ranged from 88.11% to 105.19% (Table 1), demonstrating the accuracy and precision of this method for quantifying S. Typhimurium in complex food matrices. The variety of food matrices tested highlights the versatility of this method and its potential for wider application.

[0120] Table 1. G4 dimer-enhanced CRISPR / Cas12a microfluidic aptamer sensor for the detection of Salmonella Typhimurium in various real food samples.

[0121] Samples C(S.typhimurium)(CFU / mL) Result (CFU / mL) Recovery(%) RSD(%) Milk <![CDATA[3.6×10 3 ]]> 3787 105.19 4.89 Milk <![CDATA[3.6×10 4 ]]> 33336 92.60 6.10 Salad <![CDATA[3.6×10 3 ]]> 3172 88.11 4.56 Salad <![CDATA[3.6×10 4 ]]> 32875 91.32 5.24 Chicken <![CDATA[3.6×10 3 ]]> 3386 94.06 4.75 Chicken <![CDATA[3.6×10 4 ]]> 36996 102.77 5.07

[0122] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0123] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the concept or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement, characterized in that: include: at least one detection unit; The detection unit comprises: a sample inlet, a detection chamber, and a plurality of micro-mixing channels, a reaction chamber and a self-assembled pre-stored reagent tube; The self-assembly pre-stored reagent tube is at least provided with a Cas12a / crRNA self-assembly pre-stored reagent tube, a G4 dimer self-assembly pre-stored reagent tube and a ThT self-assembly pre-stored reagent tube connected in sequence; The injection port is sequentially connected to a micro-mixing channel, a reaction chamber and a Cas12a / crRNA self-assembly pre-stored reagent tube; The self-assembled pre-stored reagent tubes are connected in series with the reaction chamber via a micro-mixing channel; The end of the ThT self-assembly pre-stored reagent tube is connected to the detection chamber through a micro-mixing channel.

2. The CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement according to claim 1, characterized in that, The micro-mixing channel is a contraction-expansion micro-mixing channel; Wherein, the size of the shrinkage channel is 1.67×0.5 mm; The expansion channel has a size of 2.33×2.15 mm.

3. The CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement according to claim 2, characterized in that, A diamond-shaped microcolumn is arranged in the micro-mixing channel, and the size of the diamond-shaped microcolumn is 0.8×0.8 mm.

4. The CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement according to claim 1, characterized in that, The self-assembled pre-stored reagent tube comprises a conical tube, a sealing cover, a micro-mixing channel connecting tube and a reaction chamber connecting tube; Wherein, the micro-mixing channel connecting tube and the reaction chamber connecting tube are both fixed to the top of the conical tube through a sealing cover; Furthermore, one end of the micro-mixing channel connecting tube is connected to the micro-mixing channel, and the other end thereof is inserted into the reagent in the conical tube through a needle; One end of the reaction chamber connecting tube is connected to the reaction chamber, and the other end is suspended above the reagent in the conical tube through a needle.

5. The CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement according to claim 1, characterized in that, The sensor is made of three layers of PMMA material by thermal bonding.

6. The CRISPR / Cas12a microfluidic chip aptamer sensor based on G4 dimer enhancement according to any one of claims 1-5, characterized in that, There are three detection units, and the size of the sensor is 95 mm×60 mm×5 mm.

7. Application of the G4 dimer-enhanced CRISPR / Cas12a microfluidic chip aptamer sensor in detecting Salmonella typhimurium in food samples according to claim 6.

8. The use according to claim 7, characterized in that: The detection range of Salmonella typhimurium is 3.6×10 1 to 3.6×10 6 CFU / mL.

9. A method for detecting Salmonella typhimurium in food, characterized in that: Detection of Salmonella typhimurium using the G4 dimer-enhanced CRISPR / Cas12a microfluidic chip aptamer sensor according to claims 1-6 specifically comprises: 1) mixing the sample and the aptamer mixture in a micromixing channel one and then entering a reaction chamber one; 2) The unbound aptamer is mixed with the pre-stored Cas12a / crRNA in micro-mixing channel two through the Cas12a / crRNA self-assembly pre-stored reagent tube; after the mixture passes through reaction chamber two, it is mixed with the pre-stored G4 dimer in micro-mixing channel three through the G4 dimer self-assembly pre-stored reagent tube; after the mixture passes through reaction chamber three, it is mixed with ThT in micro-mixing channel four through the ThT self-assembly pre-stored reagent tube and enters the detection chamber for detection.

10. The method for detecting Salmonella typhimurium in food according to claim 9, characterized in that: The detection conditions are as follows: ThT concentration is 12.5 µM; Cas12a concentration is 12.5 nM; aptamer concentration is 2 nM; reaction time is 30 minutes; The detection recovery rate was 88.11-105.19%.

Images